ID: 1069755926

View in Genome Browser
Species Human (GRCh38)
Location 10:70774468-70774490
Sequence CGAGGGGACCTGAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 327}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069755926_1069755934 1 Left 1069755926 10:70774468-70774490 CCTTCTGCCCTCAGGTCCCCTCG 0: 1
1: 0
2: 4
3: 49
4: 327
Right 1069755934 10:70774492-70774514 GAGAGCTCCCCCTTCTCTCCTGG 0: 1
1: 0
2: 0
3: 35
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069755926 Original CRISPR CGAGGGGACCTGAGGGCAGA AGG (reversed) Intronic
900479742 1:2892168-2892190 CGAGGGGACCTGAGCCAAGCTGG + Intergenic
900780374 1:4614030-4614052 CGGAGGGCCCTGAGGGCAGCTGG + Intergenic
901050172 1:6421986-6422008 CTAGGGGTGCTGTGGGCAGAAGG + Intronic
901303587 1:8217074-8217096 GGAGGGGACCGGAGAGCAGAGGG + Intergenic
901936561 1:12630821-12630843 CAAGGGGGGCTGAGGGCAGCAGG + Intergenic
902278741 1:15359078-15359100 CCTGGGGACCTGATGGCATAGGG + Intronic
902375326 1:16027629-16027651 CAAGGGGCCCTGAGGGTAGAAGG + Intronic
902380289 1:16049426-16049448 GCAGGGGCCCTGAGGGTAGAAGG + Intronic
903019092 1:20381108-20381130 CAAGGGGACCTCAGGACAGCTGG - Intergenic
903310645 1:22452335-22452357 CGAAGGGACCTGAAGGGAGGGGG - Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
904058199 1:27686130-27686152 CCAGGGGAGCTGAGGGCAGGAGG + Intergenic
904957546 1:34297617-34297639 AAAGGGGAGCTGAGGGCAGGGGG - Intergenic
905956595 1:42002420-42002442 CGAGGTGTCATGTGGGCAGATGG - Intronic
906216169 1:44042044-44042066 CCAGGGGCCGTGTGGGCAGAAGG - Intergenic
906324183 1:44834019-44834041 CGAGGGGACATGTGAGCATATGG - Intronic
906523558 1:46480992-46481014 CTAGGAGACCTGAGTGCATAGGG - Intergenic
906668182 1:47636413-47636435 CCAGGGGAAATGAAGGCAGAGGG - Intergenic
907257622 1:53191717-53191739 CTAGGGGACATGAGGACAGATGG + Intergenic
907314905 1:53562038-53562060 AAAGAGGACCTGGGGGCAGATGG + Intronic
907923167 1:58931749-58931771 TTAAGGGACCTGAGGGCAGTGGG - Intergenic
914826009 1:151138398-151138420 CGAAGTTATCTGAGGGCAGAGGG + Exonic
915166428 1:153950428-153950450 AGAGGGGACCTGAGTAAAGATGG + Intronic
915213395 1:154325740-154325762 CGCGGGGCCAGGAGGGCAGAGGG + Intronic
915529759 1:156496613-156496635 TGAGGGGACCGGAGGCAAGAAGG - Intronic
916056453 1:161071996-161072018 AGAGGCCACCAGAGGGCAGAGGG + Exonic
917631865 1:176898310-176898332 CGAGGGGACCAGAAGGCAGTGGG - Intronic
918424385 1:184393299-184393321 ACAGGGGCCCTGAGGGAAGAAGG - Intronic
921183013 1:212646156-212646178 AGAGGGACCCAGAGGGCAGAAGG + Intergenic
922236045 1:223723504-223723526 CGAGGGGACATGATGGCCCATGG - Intronic
922239753 1:223748024-223748046 CCAGGGAACCTGTGGTCAGAGGG - Intronic
922699308 1:227749351-227749373 GGATGGAACCTGAGGGCAGAGGG - Intronic
922958216 1:229623441-229623463 GGAGGGCCCCTGAGGGGAGAAGG - Intronic
1062898203 10:1121097-1121119 CCATGGGACCTGTGGGCTGAGGG + Intronic
1064424906 10:15222047-15222069 CGATGGCAGCTGTGGGCAGAAGG + Intronic
1065134987 10:22659084-22659106 CAGAGGGACCTGAGGCCAGAGGG - Intronic
1065628281 10:27653384-27653406 AGAGGGGACCTGAGCTCAGGAGG - Intergenic
1066438510 10:35415512-35415534 AGCTGGGTCCTGAGGGCAGAAGG + Intronic
1069557373 10:69407039-69407061 AGTGGGGCCCTGAGGGCAGAGGG + Intronic
1069618380 10:69820735-69820757 TGGGGGGCTCTGAGGGCAGAAGG - Intronic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1069932133 10:71890029-71890051 GGAGGGGAGCAGAGGGCAGAGGG - Intergenic
1070777005 10:79115647-79115669 TGGGGGGAACTGAGGGCTGAGGG + Intronic
1071272009 10:84016633-84016655 CGAGGGGTCCTGGGAGAAGAGGG + Intergenic
1072204010 10:93186663-93186685 CGAGGGGCCATGTGGGTAGAAGG + Intergenic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073112221 10:101069574-101069596 TGAAGGCAGCTGAGGGCAGAGGG + Intergenic
1073510548 10:104039991-104040013 CTGGGGGACCTGAGGGAAAAAGG + Exonic
1075732935 10:124647007-124647029 CGATGGGAACTGGGAGCAGAAGG + Intronic
1076840671 10:133043756-133043778 CAAGGAGACCTCAGGGCAGGTGG - Intergenic
1077367736 11:2167925-2167947 CGAGAAGCCCTGAGGGCAGAGGG + Exonic
1077397700 11:2332932-2332954 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1078105650 11:8356546-8356568 TGGGGGGACCTTAGGGCTGATGG + Intergenic
1078265872 11:9756074-9756096 AAAGGGAACCTGAGAGCAGAGGG - Intergenic
1078338892 11:10485115-10485137 ACAGGGGACCCCAGGGCAGAGGG - Intronic
1078638662 11:13075717-13075739 GGAGGGGAAATGAGGGCAGAGGG - Intergenic
1079242335 11:18729575-18729597 CGAGGGGACCGGTGGGGTGAGGG + Intronic
1080659600 11:34285181-34285203 CGAGGGGACCGGTGGGGAGGGGG + Intronic
1081489493 11:43556561-43556583 AGAGGGGAGGTGAGGGTAGAGGG - Intronic
1083628725 11:64085150-64085172 GGATGGGGCTTGAGGGCAGAGGG + Intronic
1085038789 11:73314863-73314885 ATCAGGGACCTGAGGGCAGAAGG - Intronic
1085509805 11:77082512-77082534 GGAGGTGACCTTGGGGCAGATGG + Intronic
1085517411 11:77119495-77119517 CAAGGGGCCCTGAGGCCTGAGGG - Intronic
1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG + Intronic
1087415511 11:97850692-97850714 GGATGGGGCCTGAGGGCAAAGGG - Intergenic
1088688314 11:112303742-112303764 AGAGAGGACCTGAGGGCTGTGGG - Intergenic
1089609877 11:119663248-119663270 CCAGGGGATCTGGGAGCAGATGG + Exonic
1089638378 11:119831301-119831323 GGAGGACACGTGAGGGCAGATGG + Intergenic
1090327789 11:125904239-125904261 GGCGCGGACCGGAGGGCAGAGGG - Intronic
1090446507 11:126769137-126769159 AGATGGGACCTGTGGGAAGAGGG - Intronic
1091663402 12:2401000-2401022 GGAGGGGGTCTGAGGGCAGTGGG - Intronic
1091673139 12:2467308-2467330 AGAGGAGCCCTGAGGCCAGAGGG + Intronic
1092861611 12:12724398-12724420 CGAGCGGGGGTGAGGGCAGAGGG - Intergenic
1096623634 12:52879792-52879814 TGGGGGGAGCTGAGGGCGGAGGG - Intergenic
1096667430 12:53175312-53175334 GGAGTGGGCCTGAGGGAAGAGGG + Intronic
1097329171 12:58314609-58314631 CAGGGGGAGCTGAGGCCAGAGGG - Intergenic
1097373669 12:58815330-58815352 AGTGGGGAACAGAGGGCAGATGG + Intergenic
1101200697 12:102433060-102433082 AGAGAGGACCTGAGTTCAGAAGG - Intronic
1101594615 12:106153121-106153143 CCAAGGACCCTGAGGGCAGATGG - Intergenic
1102465398 12:113127998-113128020 CCTGGGCACCTGAGGGGAGAGGG - Intronic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1102598449 12:114011345-114011367 CCAGGCTACCTGAGGGAAGAGGG - Intergenic
1103363013 12:120364821-120364843 AGAGAGGTCCTGAGGGCTGAAGG - Intronic
1103937122 12:124482662-124482684 CTGGGTCACCTGAGGGCAGATGG + Intronic
1104501750 12:129293010-129293032 AGAGAGGATCTGAGGGCAGAGGG + Intronic
1104895538 12:132161944-132161966 GGAGAGGAGCTGAGGGAAGAGGG - Intergenic
1104967158 12:132513535-132513557 AGAGGTGACCAGAGGGCTGATGG - Intronic
1104972249 12:132537126-132537148 CGACAGGATGTGAGGGCAGAGGG + Intronic
1105211880 13:18261787-18261809 CGCAGGGTCCTGAAGGCAGAGGG + Intergenic
1105302716 13:19150503-19150525 AGAGGGGACCTGAGGGCTGGCGG + Intergenic
1105422303 13:20264009-20264031 CCAGGGGACCACTGGGCAGAGGG - Intergenic
1106308866 13:28535389-28535411 TGAGGGGGACTGAGGGCAGCTGG + Intergenic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1108410772 13:50144294-50144316 GGAGGGGACCACATGGCAGAGGG - Intronic
1108542540 13:51457053-51457075 AGAGGAGACCTGAGGGCAATGGG - Intergenic
1108709263 13:53016971-53016993 TAAGGGGCTCTGAGGGCAGAAGG - Intergenic
1113420975 13:110171269-110171291 CTAGAGGACCAGAAGGCAGATGG + Intronic
1114654074 14:24305496-24305518 CGAGGGGATCAGAGGACAGTGGG + Exonic
1115752562 14:36506385-36506407 CAAGGGAACCTGGGGGCAGAGGG - Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1119213315 14:72849324-72849346 CCAGGAGACATGACGGCAGAGGG + Intronic
1122070727 14:99203967-99203989 CTGGGGGACCTGGGGGCTGATGG - Intronic
1122299156 14:100722329-100722351 AGAGGGGACCTGGGGGCAGAGGG - Intergenic
1122744182 14:103888314-103888336 CGTGGGGACCTGAGGTCAGGAGG - Intergenic
1122861230 14:104583210-104583232 AGAGGGGACCTCAGGGCTCAGGG + Intronic
1122996422 14:105267753-105267775 CAAGGGGGCCTGGTGGCAGAAGG + Intronic
1125328992 15:38564490-38564512 CGAGGGAAGTTGAGGGCGGAGGG - Intronic
1125399601 15:39286855-39286877 CATGGGGACATGAGGGGAGAAGG - Intergenic
1125697657 15:41652302-41652324 AGAGGGGAGGGGAGGGCAGAGGG - Intronic
1125731556 15:41895140-41895162 CCAGGGGCAGTGAGGGCAGAAGG - Intergenic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1128212778 15:65913965-65913987 TGAGGGCAGCTGCGGGCAGAGGG + Exonic
1128760363 15:70212594-70212616 AGAGGGGCTCTGAGGGCAGCTGG + Intergenic
1129466321 15:75726127-75726149 CATGGGGACCTGCGGGCAGCTGG - Exonic
1130231089 15:82097514-82097536 TCAGGGGGCCTGAGGCCAGAAGG - Intergenic
1130727318 15:86452736-86452758 CGTGAGGAGATGAGGGCAGAAGG - Intronic
1130992020 15:88881308-88881330 CACTGGGACCTGAGAGCAGAGGG - Intronic
1132111526 15:99105344-99105366 CGAGAGGGCCTGTGGGCCGAGGG + Exonic
1132588940 16:718013-718035 CGAAGGGGCCTGAGGACAGAGGG - Exonic
1132690828 16:1181143-1181165 GGAGGGGACCTTGGGGAAGACGG - Intronic
1132726483 16:1341115-1341137 CGTGGGGGCCTGTGGACAGAGGG - Exonic
1132801704 16:1757868-1757890 CGATGGGAGCAGAGGGCAGCAGG + Intronic
1132897063 16:2234089-2234111 CCAGGGGATCTGTGGGCAGGTGG + Intronic
1132923333 16:2411918-2411940 GTGGGGGAGCTGAGGGCAGAGGG - Intergenic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1135060463 16:19267064-19267086 GGAGGTGACCTGAGGGCTGCAGG + Exonic
1135548570 16:23381327-23381349 CGAGGTGCCCTGATGGCGGAAGG + Intergenic
1136113313 16:28078673-28078695 CCAGGGGGTCTGTGGGCAGAAGG - Intergenic
1137801003 16:51262103-51262125 AGAGGGGAGGTGAGGGGAGAAGG - Intergenic
1140240022 16:73192079-73192101 CGAGGGGATCTGGGGACAGAGGG + Intergenic
1141677454 16:85525120-85525142 ACAGGGAACCTGAGGGCAGTGGG + Intergenic
1141846286 16:86611150-86611172 GAAGGGGAGCTGAGAGCAGAAGG - Intergenic
1142066548 16:88066096-88066118 CGAGGCGGCCTCAGGGCAGACGG + Intronic
1142174705 16:88639737-88639759 AGAGGGGCCCTGAGGGGAGAGGG + Intronic
1142515251 17:423599-423621 CTAGGTGACATGAGGACAGAAGG - Intronic
1142636680 17:1261903-1261925 CTAGGGGACCTGAGGCCAAGAGG + Intergenic
1142995450 17:3757371-3757393 AGAGGGGCCCTGCAGGCAGAGGG - Intronic
1143110724 17:4551375-4551397 CAAGGGGGCCTGCTGGCAGAAGG + Intronic
1143532673 17:7514167-7514189 CGAGGAGAACTGAGGGCACGTGG + Exonic
1144004603 17:11088766-11088788 CGAGGGGGCCGGGGGGCAGCGGG - Intergenic
1144421457 17:15102764-15102786 GGAAGGGTCGTGAGGGCAGAAGG + Intergenic
1144650697 17:17005104-17005126 CCCTGGGACCTGAGGGCTGAGGG - Intergenic
1146256886 17:31396920-31396942 AGAGGGGACCTGAGGACTCAGGG - Intronic
1146457613 17:33019611-33019633 TGATGGGACCTGATGGCTGAGGG + Intronic
1146569903 17:33943305-33943327 AGTGCGGACATGAGGGCAGATGG - Intronic
1147168201 17:38604486-38604508 CGAGGGACCCTGGGGGCCGAGGG - Intronic
1147265604 17:39232461-39232483 CGAGTGGACTGGAAGGCAGAGGG + Intergenic
1147425121 17:40342541-40342563 CGCGGGGACTTCAGGGCAGGGGG + Intronic
1147559670 17:41501131-41501153 CAGGGGGTCCTGAGAGCAGAGGG + Exonic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148051553 17:44772296-44772318 CGAGGGGATCTGGGAGGAGAGGG - Exonic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1148846189 17:50531574-50531596 GGAGGGGATCTGAGGGCAGGTGG - Intergenic
1149651296 17:58278214-58278236 CCAGAGGTCCTGAGGGCAGGGGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151483327 17:74383266-74383288 GGAGGAGACCTGGGGGCAGAGGG + Intergenic
1151527418 17:74680596-74680618 GGAGAGGACCTAAGGGTAGAAGG - Intronic
1151529401 17:74695015-74695037 TGAGGGGAGCAGGGGGCAGACGG + Exonic
1151562385 17:74877672-74877694 CCAGGGGAAGTGAGGGGAGAAGG - Exonic
1151577228 17:74958876-74958898 CGAGGGGCCCTGCAGGGAGATGG - Intronic
1151578267 17:74963558-74963580 GGAGGGGAACTGAGGGCCCAAGG + Intronic
1151665089 17:75541210-75541232 GGAGGGGACAAGAGGGCACAGGG - Intronic
1151732882 17:75921552-75921574 ACAGGGGACCTGAGGACACAGGG + Exonic
1151764096 17:76123141-76123163 CCTGGGCCCCTGAGGGCAGAGGG + Intergenic
1151819867 17:76491588-76491610 AGAAGGGAACTGAGGCCAGAGGG - Intronic
1152255131 17:79234569-79234591 AGAGGCCACCTGAGGGCCGATGG + Intronic
1152419379 17:80183899-80183921 CCATGAGACCTGTGGGCAGATGG - Exonic
1152726357 17:81948686-81948708 GAAAGGGACCTGAGGGCGGATGG - Intergenic
1152806600 17:82359760-82359782 TGAGGGAACCTGAGGGAAGCTGG - Intronic
1152806874 17:82360641-82360663 CGAGGGAACCTGAGGGAAACTGG - Intronic
1152821669 17:82440827-82440849 CAAGGGGACCTGGGGGCAAATGG - Intronic
1153563304 18:6393991-6394013 CGAATGGACCTGAGGCCAGCGGG - Intronic
1154188832 18:12210295-12210317 CAAGGGTCCCTGAGGGCAGTGGG + Intergenic
1157307193 18:46525834-46525856 TGTGGGGTCCTGGGGGCAGAGGG - Intronic
1158444574 18:57508304-57508326 GGAGGGGAAATGAGGTCAGAAGG - Intergenic
1158505728 18:58044568-58044590 CGGGGGGACCTGGAGGCAGAGGG + Exonic
1160048545 18:75409794-75409816 CCTGAGGACCTGAGTGCAGATGG - Exonic
1160732376 19:647114-647136 CGTGGGGACCTGCGGGCTCAGGG - Intergenic
1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG + Exonic
1162478594 19:10915313-10915335 CGATGGGACATGAAGCCAGATGG + Intronic
1163369938 19:16896365-16896387 GGAGGGGACCCAAGGGCCGAGGG + Intronic
1163591055 19:18194310-18194332 AGAGGGAACCAGCGGGCAGAGGG + Intronic
1164720582 19:30429022-30429044 CCAGGGCACCTGAGGCCACATGG + Intronic
1165120150 19:33553673-33553695 GGAGGGGCCCTGATGGAAGAAGG - Intergenic
1165383817 19:35498814-35498836 AGAAGGGGCCTGAGGCCAGAGGG - Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1166871179 19:45872179-45872201 CCAGGGGTCCTGAGGGCAGTGGG - Exonic
1167242309 19:48351588-48351610 AGAGAGGAGGTGAGGGCAGAGGG - Intronic
1167269863 19:48500660-48500682 TGACGGGACCTGGAGGCAGAGGG + Intronic
1168240491 19:55086649-55086671 CGAGGGGTCCTGGGGCCAGAGGG - Intronic
1168713554 19:58514729-58514751 GGAGGGTACCTGAGGGTAGAGGG - Intronic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
927031738 2:19127100-19127122 TGAGGGAGCCTGAGAGCAGATGG - Intergenic
927441236 2:23119507-23119529 AGAGGGGATCTGAAAGCAGAGGG - Intergenic
928437835 2:31267172-31267194 CTAGGAGATCTGAGGGCAGGCGG + Exonic
932125750 2:69144271-69144293 GGAGAGACCCTGAGGGCAGAGGG - Intronic
932815913 2:74861587-74861609 CAAGGTCACCTGTGGGCAGATGG + Intronic
933663468 2:84946095-84946117 CGAGGGGAGGGGAGGGGAGAGGG + Intergenic
933935321 2:87199169-87199191 CCAGGGTGCCTGTGGGCAGATGG + Intergenic
934301746 2:91780686-91780708 CGCAGGGTCCTGAAGGCAGAGGG - Intergenic
934571582 2:95376070-95376092 CGAGGGGTCCTGTGGTCACAGGG - Intronic
935286778 2:101571686-101571708 CTAGTGGTCATGAGGGCAGAAGG - Intergenic
936264503 2:110992492-110992514 GGTGGGGACCTGAGGAAAGATGG + Intronic
936357827 2:111766730-111766752 CCAGGGTGCCTGTGGGCAGATGG - Intronic
936918218 2:117661585-117661607 CCTGGGGACCCGAGGGAAGAGGG + Intergenic
937293900 2:120798480-120798502 CGAGTGGACCTGAGGGCCTGCGG + Intronic
937437751 2:121893241-121893263 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
937726765 2:125175976-125175998 CTAGGGGAGCTGTGGGAAGAGGG + Intergenic
938092032 2:128440561-128440583 AGAGGGCAGCTGAGGTCAGAAGG + Intergenic
938128848 2:128693794-128693816 TGAGGGGACCTGAGGGGTGAGGG - Intergenic
942074651 2:172345530-172345552 CTCGGGGGGCTGAGGGCAGAAGG + Intergenic
942462449 2:176177913-176177935 CGAGGGGGATTGAGGGAAGATGG - Intergenic
943416052 2:187605439-187605461 CGAGGGGAGGTGAGTACAGAGGG + Intergenic
944770691 2:202911624-202911646 AGAGGAGACCGGAGGGCAGAAGG - Exonic
946010111 2:216557735-216557757 AGAGGGCAGCCGAGGGCAGAGGG + Intronic
946369149 2:219270108-219270130 CCAGGGGACCTGAAGGGAGTGGG - Intronic
946420157 2:219560490-219560512 TGGGGGGACCTGGGGGCAGCAGG - Intronic
947521609 2:230850067-230850089 AGAGGGGAGGAGAGGGCAGAGGG + Intergenic
947745970 2:232507561-232507583 AGAGGGGTCCTCAGAGCAGAGGG - Intergenic
947757891 2:232581518-232581540 AGAGGAGACCGGAGGGCATAAGG - Intronic
948502810 2:238407261-238407283 CCAGGGGACCTGGGGTGAGAGGG + Intergenic
948626075 2:239268831-239268853 CCAGGGGACCTTAGGGCACCAGG + Intronic
948716691 2:239869802-239869824 CCAAGGGACCTGAGGGCACCGGG + Intergenic
948824372 2:240567179-240567201 CGTGGGGACCTGAGGTCCTACGG + Intronic
949042848 2:241857516-241857538 CGGGGGAACCAGAGGGCAGAGGG - Intronic
1171390219 20:24796573-24796595 AGAGGGAAGCTGAGGGCAGTGGG + Intergenic
1172118211 20:32583903-32583925 CGAGGGGCCCGGGGGGCTGAGGG + Intronic
1172362633 20:34324741-34324763 TGAAGTGAGCTGAGGGCAGAGGG + Intergenic
1172781294 20:37438353-37438375 AGAGGGCAGCTGAGAGCAGAGGG + Intergenic
1173540167 20:43845083-43845105 GTAGGGGACCTGATGCCAGAAGG - Intergenic
1175252281 20:57616790-57616812 AGAGGGGAGTAGAGGGCAGAAGG + Intronic
1175330138 20:58158039-58158061 CCAGGGGCCCTGGTGGCAGAGGG - Intronic
1175709826 20:61210503-61210525 CATGGGATCCTGAGGGCAGATGG + Intergenic
1175907185 20:62386701-62386723 TGAGGGGACCGGAGGGCGGGAGG + Intergenic
1175921078 20:62450916-62450938 GGAGGGGACCTGGGGGAGGAAGG - Intergenic
1176243021 20:64083789-64083811 CGAGGGGGTCGGAGGGCAGAGGG - Intronic
1176292822 21:5055318-5055340 GGAGGGGACCCCAGGGCAGGTGG - Intergenic
1176369567 21:6054121-6054143 GGAAGGGCCCTGAGGGCTGATGG + Intergenic
1177397959 21:20562114-20562136 GGAATGCACCTGAGGGCAGAGGG - Intergenic
1178639904 21:34337383-34337405 TGAGGGGGCCTGGGGGCAGATGG + Intergenic
1179541957 21:42088760-42088782 CGAGGGGGCAGGAGGCCAGAGGG - Intronic
1179714759 21:43280933-43280955 GGAGGGGAGGTGGGGGCAGAGGG + Intergenic
1179753952 21:43484420-43484442 GGAAGGGCCCTGAGGGCTGATGG - Intergenic
1179864438 21:44208332-44208354 GGAGGGGACCCCAGGGCAGGTGG + Intergenic
1180983185 22:19888977-19888999 CGATGGGACCTGAGGCCAGCAGG - Intronic
1181074561 22:20367036-20367058 GGAGGGGGCCTGAGAGCAGCGGG - Intronic
1181161402 22:20962138-20962160 GGAGGGGACGGGAGGGGAGAAGG - Intergenic
1181630184 22:24147083-24147105 CCAGGGCAGCTGGGGGCAGAGGG - Intronic
1182297166 22:29316342-29316364 CGAGGGGAAGTGGGGACAGAGGG + Intronic
1182428141 22:30285680-30285702 CTCGGGCACCTGAGGGCAGGTGG + Exonic
1182711857 22:32328170-32328192 ATGGGGGAACTGAGGGCAGAAGG - Intergenic
1183300635 22:37057384-37057406 GGGTGGGACCTGTGGGCAGAAGG - Exonic
1183588783 22:38768141-38768163 ACAGGGCCCCTGAGGGCAGAGGG - Intronic
1183735545 22:39642938-39642960 CCAGGGGACCTGAGGAGGGAGGG + Intronic
1184038218 22:41928547-41928569 GGAGGGAGCCTGGGGGCAGAGGG + Intergenic
1185076843 22:48687732-48687754 GGAGGTGACCTGAGGCCAGCAGG - Intronic
1185223156 22:49639321-49639343 AGAGGGGGCGTGAGGGCAGGGGG - Intronic
1185236422 22:49716217-49716239 CTGGGGGCCCTCAGGGCAGATGG - Intergenic
949578269 3:5360094-5360116 CCAGGGGAGCTGAAGTCAGAGGG + Intergenic
949737845 3:7194938-7194960 GAAGAGGACCTGAGGGAAGAGGG + Intronic
952331259 3:32366375-32366397 CGAGGGGGCCAGAGAGGAGATGG - Intronic
953851716 3:46469995-46470017 GGAGAGGGCCAGAGGGCAGAGGG - Intronic
954712284 3:52511171-52511193 CAAGGGCACCTGAGAGCTGAGGG + Intronic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
956723352 3:72137344-72137366 AGAGAGGATCTGAGGGAAGAAGG + Intergenic
957469323 3:80638272-80638294 CCTGGGAACCTGAGGGGAGAGGG - Intergenic
961367160 3:126407306-126407328 TGAGGGGATCTGGGGGCAGAGGG - Intronic
962432849 3:135336061-135336083 TGTGGGGTCCTGAGGGGAGAGGG - Intergenic
963605145 3:147406828-147406850 GGAGGGGACCTAAGGGGGGAAGG - Intronic
963881446 3:150533264-150533286 AGATGGGAGGTGAGGGCAGAGGG - Intergenic
964645628 3:158956153-158956175 AGGAGGGGCCTGAGGGCAGAGGG + Intergenic
965106569 3:164363058-164363080 CGAGTGGAGTGGAGGGCAGACGG + Intergenic
966885140 3:184373338-184373360 CTAGAAGACCTGAGGGAAGAAGG - Intronic
967169837 3:186814415-186814437 CTAGGGCAGCTGAGGGAAGAAGG - Intergenic
968483149 4:845692-845714 GGAGGTGGCCTGAGGGCAGCTGG + Intergenic
968618976 4:1595184-1595206 CGGGGGTCCCTGTGGGCAGAGGG - Intergenic
968970535 4:3791359-3791381 CCAGGGAAGGTGAGGGCAGACGG - Intergenic
969099389 4:4757440-4757462 CAGGGGGACCTGAGAGCACAGGG - Intergenic
969610211 4:8223470-8223492 AGAGGGGCACTGAGGTCAGAGGG - Intronic
970483922 4:16505721-16505743 TGTGGGGAGCTGAGGGCATATGG - Intronic
970736570 4:19176994-19177016 CTAGGGGAAATGTGGGCAGAGGG - Intergenic
973566048 4:52188657-52188679 CAGGGCTACCTGAGGGCAGAGGG - Intergenic
973572275 4:52252639-52252661 CCAGGGGACCTGATGGTATAAGG - Intergenic
979853009 4:125596376-125596398 AGAGGTGACATGAGTGCAGAAGG + Intergenic
985546087 5:509900-509922 AGAGGGGCCCTGCGGGCAGCCGG + Intronic
985699337 5:1361110-1361132 CTAGGGGTTTTGAGGGCAGAGGG + Intergenic
985727719 5:1524537-1524559 GGAGGGGTCCTGAGGTCTGAGGG - Intergenic
985746841 5:1652715-1652737 TGGGGGGCCCTGAGGGCAAAGGG + Intergenic
985891982 5:2723282-2723304 AGAGGGGACTTGAGGGAAAATGG - Intergenic
986693835 5:10334639-10334661 AGAGGAGAAGTGAGGGCAGAAGG + Intergenic
987080211 5:14419189-14419211 AGAAGGAATCTGAGGGCAGAGGG + Intronic
987114580 5:14715905-14715927 CAGGGGAACCTGAGGCCAGATGG - Intronic
988821746 5:34893298-34893320 CTAGGGCGCCTGAGGGAAGATGG + Intronic
988906378 5:35794903-35794925 GAGGGGGACCTGAGGGCGGAAGG - Intronic
992527867 5:77629828-77629850 AGAGGGGACCGGAGGGGAGGCGG + Exonic
997585258 5:135039874-135039896 CGCCGGGACCTGCGGGGAGAGGG + Intronic
997698685 5:135881099-135881121 AGAGGAGGCCTGAGGGCATATGG - Intronic
997727375 5:136132991-136133013 CGAGGGGAACTGGGGGCTGCAGG + Intronic
1001564008 5:172687899-172687921 CCAGGGGACCTGCTGGCAGGAGG + Exonic
1001565506 5:172696941-172696963 CGTGGGAAACTGCGGGCAGATGG - Intergenic
1001648787 5:173301191-173301213 GGAGGGGACGGGAGGGGAGAGGG - Intergenic
1002103673 5:176869528-176869550 GGACGGGGCGTGAGGGCAGAGGG - Intronic
1002601116 5:180354217-180354239 CGAGGGGCCCAGAGTGCAGGGGG - Intergenic
1002852679 6:1010529-1010551 AGAGGGGAAATGAGGGAAGAAGG - Intergenic
1006713547 6:36097519-36097541 TAAGAGGACCTAAGGGCAGAGGG + Intronic
1006788987 6:36686466-36686488 AGAGGGGCCATGAGGGCAGGCGG - Exonic
1007483178 6:42163289-42163311 CTTGGGGACCTGAGGTCACAGGG - Exonic
1008368603 6:50709545-50709567 GAAGGGGGCCCGAGGGCAGATGG + Intergenic
1008564057 6:52749995-52750017 CAAGGTGGCCTGAGAGCAGAGGG + Intergenic
1008598717 6:53067636-53067658 CGAGGGGACCTGAGTTCTGTGGG - Intronic
1009826701 6:68875236-68875258 GGAGGGGAGGGGAGGGCAGAGGG - Intronic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1012040186 6:94194247-94194269 CCAGGGGTCATGAGGGCAAATGG + Intergenic
1015181618 6:130366605-130366627 GGAGGGGAGGGGAGGGCAGAGGG - Intronic
1016841847 6:148533194-148533216 AGAGGGAAGCTGAGGTCAGAGGG - Intronic
1017991711 6:159494826-159494848 GGTGGGGAGCTGAGGACAGATGG - Intergenic
1018908703 6:168089663-168089685 CCCAGGGACCTGAGGACAGACGG - Intergenic
1019013475 6:168861771-168861793 GGAGGGGACTCGAGGGCAGAAGG + Intergenic
1019358828 7:594600-594622 GGAGGAGACCTGAGGCCATAAGG + Intronic
1019863252 7:3680306-3680328 AGAGGGGAGGTGAGGGGAGACGG + Intronic
1020278580 7:6638382-6638404 CGAAGGGCTCTGAGGGCAGCGGG + Intronic
1024066355 7:45739883-45739905 AGAGGGCATCTGAGGGGAGATGG - Intergenic
1025111232 7:56218043-56218065 AGAGGAGACCTGAGGGCTGCTGG - Intergenic
1025217492 7:57070942-57070964 AGAGGGCATCTGAGGGGAGACGG - Intergenic
1025301359 7:57821599-57821621 CGAGGGGCGCAGAGGGCTGATGG + Intergenic
1025628407 7:63244592-63244614 AGAGGGCATCTGAGGGGAGACGG - Intergenic
1025653859 7:63499523-63499545 AGAGGGCATCTGAGGGGAGACGG + Intergenic
1029413976 7:100431525-100431547 GAAGGGGACCCGGGGGCAGAGGG + Exonic
1029435666 7:100562709-100562731 GGAGGGGACCTGAGGCCAGGAGG + Intronic
1031052128 7:116954367-116954389 CGAAGGGACCGGAGGGAAGAGGG + Intronic
1031196862 7:118627014-118627036 AGAGGGGACCTGAGAGCAGGTGG - Intergenic
1032522302 7:132554627-132554649 CCAGGGTGCCTCAGGGCAGAGGG + Intronic
1033569602 7:142614875-142614897 TAACGGGACCTGAGGTCAGAGGG + Intergenic
1034251102 7:149691386-149691408 CTAGGGGAAATGAGGGCAGAAGG - Intergenic
1034452427 7:151144145-151144167 CAATGGCACCTTAGGGCAGAGGG - Exonic
1035228292 7:157445518-157445540 GGAAGGGACCTGGGGGCAGTGGG + Intergenic
1035635101 8:1138467-1138489 CCCGTGGACCTGAGGGCCGATGG - Intergenic
1036212628 8:6854582-6854604 CCATGGGAGCTGAGGGCTGAAGG - Intergenic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1036810997 8:11867738-11867760 GGAGGGGAGCGGAGGGCAGAGGG + Intronic
1036815914 8:11902724-11902746 GGAGGGCATCTGCGGGCAGATGG + Intergenic
1041110270 8:54476886-54476908 GGAGGGGCCCTGTGGGCAGCGGG - Intergenic
1043087184 8:75849507-75849529 CGTGAGGACCTGAAGGCAGGGGG - Intergenic
1045098725 8:98825324-98825346 CGAGGGGACCTGAGGGGAGCGGG - Intronic
1047267501 8:123320659-123320681 CGAGGGAATCTCAAGGCAGATGG + Exonic
1048498118 8:134952203-134952225 CCAGGGGACAGGATGGCAGAAGG - Intergenic
1049367839 8:142249289-142249311 GGAGGAGAACTGTGGGCAGAGGG + Intronic
1049578808 8:143401557-143401579 GGAGGGGAAGGGAGGGCAGAGGG + Intergenic
1049578822 8:143401584-143401606 GGAGGGGAGGGGAGGGCAGAGGG + Intergenic
1049702903 8:144023142-144023164 AAAGGGGTCCTGAGGGAAGAGGG - Intronic
1049849435 8:144822937-144822959 CCAGGGGTCCTGAGGGGAGATGG - Intergenic
1054452532 9:65410921-65410943 CTAGGTGACCTGAGGGCTGAAGG - Intergenic
1056691323 9:88810987-88811009 GGAGGGAGCCTGAGGGTAGAAGG - Intergenic
1057122936 9:92593465-92593487 TTAGGGGAAATGAGGGCAGAAGG - Intronic
1057185272 9:93053958-93053980 CAAGGCGCCCAGAGGGCAGAAGG - Intergenic
1059553210 9:115251251-115251273 AGAAGGTCCCTGAGGGCAGAAGG - Intronic
1060199715 9:121645397-121645419 CCAGGGCTCCTGTGGGCAGAAGG + Intronic
1060481580 9:124019198-124019220 TGAGGGGACCTGAGTGCCGGTGG + Intronic
1061118668 9:128629924-128629946 ACAGGAGACCTCAGGGCAGAGGG - Intronic
1061394007 9:130333421-130333443 AGAGGGGCCCAGGGGGCAGAGGG - Intronic
1061743284 9:132722702-132722724 GGAGGGGAGCTGAGGGCAGCTGG - Intergenic
1061881555 9:133571587-133571609 CGTGGGGCCCAGAAGGCAGAGGG - Intronic
1062118422 9:134821418-134821440 CGAGGGTAGCGGAGGGCTGATGG - Intronic
1062333196 9:136053509-136053531 AGTGGGGACCTGAGGGTGGAGGG - Intronic
1062501887 9:136855240-136855262 CAGGAGGATCTGAGGGCAGAGGG - Exonic
1062624219 9:137435666-137435688 CGAGGGTCCCTGAGGGTACAGGG - Intronic
1185506383 X:634592-634614 CGTGGGGAGCGGAGGGCACAGGG - Intronic
1185585042 X:1236494-1236516 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1188710244 X:33387930-33387952 AGCGGGGGCCTGGGGGCAGAGGG - Intergenic
1189014106 X:37077841-37077863 CGAAGAGACCTGAGCCCAGACGG - Intergenic
1190817244 X:53939308-53939330 GGAGGTGGCCTGAGGGCAGTTGG - Intronic
1191216132 X:57933969-57933991 CGTGGGGACCTTAGAGCAGCTGG + Intergenic
1191779359 X:64849364-64849386 AGAGGTGACCTGAGGGGTGATGG - Intergenic
1196765126 X:119236141-119236163 GGAGGGGGCCTGAGGGCTGCGGG + Intergenic
1197822770 X:130558306-130558328 CCAGGGGAGCTGATGGCTGAGGG + Intergenic
1199452438 X:147991551-147991573 TGAGGGGACTTGAGGGAAGGAGG - Intronic
1200101069 X:153689267-153689289 CGAGGGGAGGGGAGGGCAGGGGG - Intronic
1200180997 X:154150642-154150664 CGAAGGGGCCTGAGGGCAGGAGG - Exonic
1200186640 X:154187756-154187778 CGAAGGGGCCTGAGGGCAGGAGG - Intergenic
1200192292 X:154224894-154224916 CGAAGGGGCCTGAGGGCAGGAGG - Exonic
1200198047 X:154262698-154262720 CGAAGGGGCCTGAGGGCAGGAGG - Exonic