ID: 1069757466

View in Genome Browser
Species Human (GRCh38)
Location 10:70782001-70782023
Sequence CTGAAACTGGAGAAGAAGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 304}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069757466_1069757475 10 Left 1069757466 10:70782001-70782023 CCTGACTTCTTCTCCAGTTTCAG 0: 1
1: 0
2: 3
3: 31
4: 304
Right 1069757475 10:70782034-70782056 GGACTGAAGGAGGGGGTTTCAGG 0: 1
1: 0
2: 2
3: 13
4: 257
1069757466_1069757469 -3 Left 1069757466 10:70782001-70782023 CCTGACTTCTTCTCCAGTTTCAG 0: 1
1: 0
2: 3
3: 31
4: 304
Right 1069757469 10:70782021-70782043 CAGCTCAGCCTTTGGACTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 242
1069757466_1069757470 0 Left 1069757466 10:70782001-70782023 CCTGACTTCTTCTCCAGTTTCAG 0: 1
1: 0
2: 3
3: 31
4: 304
Right 1069757470 10:70782024-70782046 CTCAGCCTTTGGACTGAAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 214
1069757466_1069757472 2 Left 1069757466 10:70782001-70782023 CCTGACTTCTTCTCCAGTTTCAG 0: 1
1: 0
2: 3
3: 31
4: 304
Right 1069757472 10:70782026-70782048 CAGCCTTTGGACTGAAGGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 195
1069757466_1069757473 3 Left 1069757466 10:70782001-70782023 CCTGACTTCTTCTCCAGTTTCAG 0: 1
1: 0
2: 3
3: 31
4: 304
Right 1069757473 10:70782027-70782049 AGCCTTTGGACTGAAGGAGGGGG 0: 1
1: 0
2: 1
3: 25
4: 252
1069757466_1069757471 1 Left 1069757466 10:70782001-70782023 CCTGACTTCTTCTCCAGTTTCAG 0: 1
1: 0
2: 3
3: 31
4: 304
Right 1069757471 10:70782025-70782047 TCAGCCTTTGGACTGAAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 179
1069757466_1069757476 22 Left 1069757466 10:70782001-70782023 CCTGACTTCTTCTCCAGTTTCAG 0: 1
1: 0
2: 3
3: 31
4: 304
Right 1069757476 10:70782046-70782068 GGGGTTTCAGGAGAAGCTAATGG 0: 1
1: 0
2: 2
3: 17
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069757466 Original CRISPR CTGAAACTGGAGAAGAAGTC AGG (reversed) Exonic
900923227 1:5687063-5687085 GTGAAACAGAAGAAGAAGTTGGG - Intergenic
901337337 1:8462469-8462491 CTGAGACTGGAGAACGAGTAGGG + Intronic
901957611 1:12797811-12797833 CTGAAGCTGAAGGAGAAGTGGGG - Intergenic
904508890 1:30984963-30984985 CTCAAACTGGTAAAAAAGTCAGG - Intronic
905098703 1:35499005-35499027 CTGAGACTGGAGAATATGGCAGG + Intronic
905359015 1:37405508-37405530 GTGAAACTGGAAAAGAAGTCAGG + Intergenic
905485952 1:38296702-38296724 ATGAAACTGGAGAGGCAGGCAGG - Intergenic
905908675 1:41638973-41638995 AAGAAAGTGGAGAAGAAGGCTGG + Intronic
906180625 1:43815321-43815343 TTGAAACTGGAGAGTAAGACAGG - Intronic
908432539 1:64073097-64073119 GTGAGACTGGAGATGAAGCCTGG - Intronic
909935688 1:81547515-81547537 ATGAAAGTGAGGAAGAAGTCGGG - Intronic
912644887 1:111383265-111383287 CTGAGACTGAACAAGAATTCGGG - Intergenic
912882449 1:113429745-113429767 CTGCAACTGCAGAAAAAGTAGGG + Intronic
912961013 1:114196127-114196149 ATGAAAAGGGAGAAGAAGTTGGG + Intergenic
914828641 1:151154537-151154559 CTGAAGCTGGAGAGGAAAACAGG + Intergenic
915142131 1:153774458-153774480 CTGTACCTGGAGATAAAGTCTGG + Intronic
915169650 1:153968854-153968876 CTGAAAATGAAGCATAAGTCAGG + Intronic
915240990 1:154521578-154521600 CTGACTGTGGAGAAGAAGGCAGG + Intronic
915610243 1:156986168-156986190 CTTAACCTGGAGAAGGAGTAAGG + Exonic
916276699 1:163001688-163001710 CTGAGGCTGGAGAGGGAGTCAGG - Intergenic
916458879 1:165000315-165000337 CTGATAATGGAGAAGAGGTTAGG - Intergenic
916473146 1:165143182-165143204 CTGTTACTGGAGAAGAGGACAGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917165699 1:172110282-172110304 CTGAAAATAGTGTAGAAGTCCGG - Intronic
917232777 1:172855978-172856000 AGGAAACTAGAGAAGCAGTCTGG + Intergenic
917393543 1:174566225-174566247 CAGTAACTGGAGAGGAAGTGAGG + Intronic
918363715 1:183784664-183784686 CAGATACTGGAGAAACAGTCAGG + Intronic
919536114 1:198790117-198790139 TTGAAACTGTGGAAGAAGACAGG - Intergenic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
921151738 1:212408284-212408306 CTGGCACAGGAGAAGCAGTCAGG + Intronic
922456291 1:225776328-225776350 CTGAAACTGGAGATCATATCTGG - Intergenic
1064476894 10:15700304-15700326 CTGAGATTGGAGAAGCAATCAGG - Intronic
1066244449 10:33568899-33568921 CTGACACTGGTGATGAAGTGGGG - Intergenic
1067084757 10:43231870-43231892 CAGAAAGTAGAGAAGAAGCCAGG + Intronic
1069757466 10:70782001-70782023 CTGAAACTGGAGAAGAAGTCAGG - Exonic
1071444539 10:85733406-85733428 CTGTAACTGGAGAAGAAGATGGG + Intronic
1072001555 10:91200281-91200303 CTGAAACTGAACCAGAACTCTGG + Intronic
1072799397 10:98382699-98382721 CTGGAACTGGAGAAGCTGGCTGG + Intergenic
1072982066 10:100107087-100107109 CTGAAGCTGGTGAAGAGCTCAGG - Intergenic
1073356695 10:102860693-102860715 CTGAGACTACAGAAGAAGTGGGG + Intronic
1073423642 10:103443202-103443224 CTGAACCTGGAGAACATGTACGG + Exonic
1073567304 10:104546112-104546134 CAGAAACTGAAGAAAAAGTATGG - Intergenic
1074015560 10:109530457-109530479 AGGAATCTGGAGAAGGAGTCTGG - Intergenic
1074222237 10:111449292-111449314 CTGACACCAGAGAAGAAGCCCGG - Intergenic
1075490484 10:122863765-122863787 CTGAAAATGGAAAAACAGTCAGG - Intronic
1075639159 10:124051951-124051973 ATGAAACTTCAGAAGAAATCTGG + Intronic
1077069324 11:660768-660790 CTGACACTGGAGAACAAGGCAGG + Intronic
1077309687 11:1882828-1882850 CTGAACCTGGAGGAGAAGATGGG - Intronic
1078184014 11:9036286-9036308 CTGCATTTAGAGAAGAAGTCTGG - Intronic
1078995989 11:16700488-16700510 CTCAAAGTGGAGAATGAGTCTGG - Intronic
1079408725 11:20166785-20166807 CGTAAACTGGAGAAGGAGTGTGG + Intergenic
1080848718 11:36048932-36048954 CTGGAAGTGGGGAAGAAGACTGG - Intronic
1081470815 11:43368833-43368855 CTGAGGCTGGAGGAGAAGACAGG - Intronic
1081650294 11:44819100-44819122 CTGGATCTGGGGAAGGAGTCAGG + Intronic
1082711694 11:56560723-56560745 TTGAAAATAGAGAAGAAGCCAGG - Intergenic
1083421518 11:62556014-62556036 GAGAAACTGGAGAAGGGGTCGGG - Intronic
1085103532 11:73822128-73822150 ATGAAACTGGGGCAGCAGTCAGG + Intronic
1087050824 11:93884774-93884796 CTGAGGCTGGAGAATAGGTCTGG - Intergenic
1087655014 11:100911999-100912021 CTGAAAAGGGAGAGTAAGTCAGG - Intronic
1088162781 11:106893689-106893711 CTAAAACTGGAGAGAAAGACAGG + Intronic
1088789086 11:113208370-113208392 ATGAGGCTGGAGAAGAAGGCAGG - Intronic
1089096247 11:115922415-115922437 ATAAAAATGGAGAGGAAGTCAGG - Intergenic
1089295991 11:117468629-117468651 CTGAATCTGGAGAGGAACCCTGG + Intronic
1090108718 11:123881262-123881284 TTGAAACTGTAGAATAAGTTAGG - Intergenic
1090418138 11:126555100-126555122 CTGACACTGGACAAGAAGCTGGG + Intronic
1090641737 11:128735102-128735124 AATAAACTGGAGAAGAAGGCAGG - Intronic
1090991878 11:131825096-131825118 CAGAAGCTGGACAAGAAGCCTGG - Intronic
1092024163 12:5226930-5226952 CTGGGACTGGTGAAGAATTCTGG - Intergenic
1092110836 12:5963414-5963436 CTGAAATTAGAGAAGCAGTAAGG + Intronic
1092896680 12:13018678-13018700 CGGAAACTGAAAAAGAAGGCAGG - Intergenic
1094267408 12:28574577-28574599 CTGAAGCTGGATAAGAAGAAGGG + Intronic
1094693667 12:32795340-32795362 ATGACACAGGAGAAGCAGTCAGG - Intronic
1095221167 12:39618002-39618024 CTGAAATTAGAGAAGAAATGAGG - Intronic
1095573874 12:43712644-43712666 CTGAAACTTGAGAAGAGGGAGGG + Intergenic
1095828763 12:46560181-46560203 ATGAAAATGGAGAAGAAGGCAGG + Intergenic
1095866605 12:46979308-46979330 CTGAGAGTGGAGAAGCAGTTTGG + Intergenic
1096464399 12:51840324-51840346 CTGAAAGTGGTGAAGAGCTCTGG - Intergenic
1098262273 12:68683461-68683483 AAGAAACTGGAGAAAAGGTCTGG - Intergenic
1098442588 12:70534284-70534306 AAGAAAGTGGAAAAGAAGTCAGG + Intronic
1099500323 12:83405879-83405901 CTGAGACTTGAAAAGAAGTCTGG - Intergenic
1099532004 12:83793993-83794015 TTGAAACAAGAGAAGAAATCAGG - Intergenic
1103316835 12:120062946-120062968 CTGAAACTTGTGAAAAAATCTGG - Intronic
1103399977 12:120637225-120637247 CAGAAACTGGAGAGGAAAGCAGG - Intergenic
1103400033 12:120637557-120637579 ATGAAACTGGAGAGGAGGCCGGG - Intergenic
1103682105 12:122702358-122702380 ATCAAAGTGGAGAAGAAGTTGGG + Exonic
1103683848 12:122715812-122715834 ATCAAAGTGGAGAAGAAGTTGGG + Exonic
1103992824 12:124810554-124810576 CTGAATCTGGAAAAGAAGTGTGG + Intronic
1104744399 12:131202004-131202026 ATAAAACTGGAGAGGAAGTGAGG + Intergenic
1104789980 12:131475219-131475241 ATAAAACTGGAGAGGAAGTGAGG - Intergenic
1105991726 13:25628675-25628697 CAGAAGCTGGAGGAGAAGCCTGG - Intronic
1105999252 13:25704293-25704315 CAGAAACTGGAGCTGAAGTGAGG - Intronic
1107297877 13:38932565-38932587 ATCCAACTGGAGAAAAAGTCAGG + Intergenic
1107682023 13:42861935-42861957 CTGGAACTCAAGCAGAAGTCAGG - Intergenic
1107991248 13:45820706-45820728 CAGAAACTGCAGAAGCAGCCAGG - Intronic
1108094487 13:46886877-46886899 CTCAAAATGGAGAACACGTCAGG + Intronic
1108372569 13:49785161-49785183 CTGAATCTGGAGAAATAATCAGG + Intronic
1110169870 13:72487780-72487802 CTGAAAATGGAGAGCAAGTATGG - Intergenic
1110365460 13:74679954-74679976 CTGAAAATGGAGAAAATATCAGG - Intergenic
1112407493 13:99134262-99134284 ATGAGACTGGAGAAGAGGCCAGG + Intergenic
1112797385 13:103071260-103071282 ACTAAACTTGAGAAGAAGTCAGG + Intergenic
1114183502 14:20383645-20383667 CTGTACATGGAGAGGAAGTCAGG + Intronic
1118932113 14:70252560-70252582 CTGAGACTGGAGAGGGAGTGAGG - Intergenic
1119747223 14:77052948-77052970 CAGGAACTGGAGAAGAACCCGGG + Intergenic
1119972300 14:78984851-78984873 ATGAGACTGGAGAAGGAGGCAGG + Intronic
1120117158 14:80633466-80633488 AAGACACTGGAGAAGAAGGCAGG - Intronic
1120242140 14:81961826-81961848 CTGAGGCAGGAGAAGAAGCCAGG - Intergenic
1120251723 14:82066968-82066990 ATGAAATTGGAGAATAGGTCTGG - Intergenic
1120955688 14:90079930-90079952 CTGAAAGTGGAGAAGGAAACAGG + Intronic
1121171716 14:91859931-91859953 CTGGAACTGGAGCAGCAGGCAGG + Intronic
1121407905 14:93729942-93729964 CTGAAACTGGTGAAGGGGTGAGG + Intronic
1122454870 14:101842346-101842368 CTGAAACAGGAGGAGAGGGCAGG + Intronic
1125262155 15:37838920-37838942 CAGAAAGAGGACAAGAAGTCAGG + Intergenic
1126063827 15:44809925-44809947 CTGAAATTGGAGATGTAATCTGG + Intergenic
1126781686 15:52144493-52144515 CTGACACTGCAGCAGAGGTCTGG + Intronic
1126811457 15:52409927-52409949 CTGAAAGAGGAGAAGAAGGAAGG + Intronic
1127877443 15:63122673-63122695 CTGTAGATGGAAAAGAAGTCTGG + Exonic
1128013577 15:64321825-64321847 CTGAAAGTGGAGAAGAATGGAGG + Intronic
1128749809 15:70140794-70140816 CTGCAGCTGGAGAAGAAGGCAGG + Intergenic
1129157862 15:73730001-73730023 CTGAATCTGGAGAGGGAGTTAGG + Intergenic
1129552664 15:76470354-76470376 CTGAATCTGGGGAAAGAGTCAGG + Intronic
1130048886 15:80467193-80467215 GTGAGACTGGAGAAAAAGGCTGG + Intronic
1130608670 15:85340447-85340469 CAGAAACAGGAGAAGAAAACAGG + Intergenic
1131574162 15:93569751-93569773 CTGAAATTTGAAATGAAGTCAGG + Intergenic
1133854440 16:9536451-9536473 CTGAAACTGGAGAGGCAGGCAGG + Intergenic
1133910211 16:10059061-10059083 CTGTAACAGGAGAAGAACTTGGG + Intronic
1138279885 16:55764674-55764696 CTGGATATGGAGAAGAAATCAGG - Intergenic
1138913468 16:61431845-61431867 ATGAAAGTGGAGAAGAAGGCCGG - Intergenic
1139242062 16:65403208-65403230 CTGTAACTGGAGAAGCAATTTGG - Intergenic
1141397418 16:83717333-83717355 CAAAAAGTGGGGAAGAAGTCAGG - Intronic
1142728025 17:1830435-1830457 CTGAAACCAGACAAGAAGTTTGG - Intronic
1142950862 17:3478930-3478952 GTAAAACTGGAGAGGAAGGCTGG - Intronic
1143066690 17:4255001-4255023 CTGATACTGGAGCTGAAATCTGG - Intronic
1145901380 17:28492583-28492605 ATGAAGCTGGAGAAGTAGGCAGG + Intronic
1146301416 17:31692579-31692601 CTAGAACTAGAGAAGAAGGCTGG + Intergenic
1148452883 17:47791540-47791562 CTGGAAGTGGAGAAGAAGGTAGG - Intergenic
1151781184 17:76246705-76246727 CTGAAACTGGAGCTGAGGTCAGG + Intergenic
1153784875 18:8525849-8525871 CTGAGGCTGGAGAAGAAAGCAGG + Intergenic
1154362210 18:13673243-13673265 AGGAAACTGGAAATGAAGTCGGG - Intronic
1154362222 18:13673332-13673354 AGGAAACTGGAAATGAAGTCGGG - Intronic
1154362228 18:13673375-13673397 AGGAAACTGGAAATGAAGTCGGG - Intronic
1154362234 18:13673418-13673440 AGGAAACTGGAAATGAAGTCGGG - Intronic
1154362279 18:13673771-13673793 AGGAAACTGGAAATGAAGTCGGG - Intronic
1154362309 18:13673997-13674019 AGGAAACTGGAAATGAAGTCGGG - Intronic
1154362393 18:13674669-13674691 AGGAAACTGGAAATGAAGTCGGG - Intronic
1154362409 18:13674801-13674823 AGGAAACTGGAAATGAAGTCGGG - Intronic
1154362470 18:13675300-13675322 AGGAAACTGGAAATGAAGTCGGG - Intronic
1154362482 18:13675389-13675411 AGGAAACTGGAAATGAAGTCGGG - Intronic
1154362507 18:13675567-13675589 AGGAAACTGGAAATGAAGTCGGG - Intronic
1154362525 18:13675702-13675724 AGGAAACTGGAAATGAAGTCGGG - Intronic
1154362583 18:13676166-13676188 AGGAAACTGGAAATGAAGTCGGG - Intronic
1156684372 18:39627122-39627144 CGGACACTGGACAAGAATTCAGG - Intergenic
1156944374 18:42810859-42810881 CTGAAACTAGAAAGGCAGTCTGG - Intronic
1157843247 18:50978814-50978836 CTGGACCTAGAGAAGAAGTCAGG + Intronic
1159623788 18:70669272-70669294 CTGAGATTGGAGAAGGAGTCAGG - Intergenic
1163386661 19:17004200-17004222 TAGAAACTGGTGAAGAAGGCCGG - Intronic
1163574891 19:18104919-18104941 CTGTAACTGGAGATGACGTGAGG - Intronic
1165218628 19:34296329-34296351 CTGAAGCTGGAGCTGCAGTCTGG + Intronic
1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG + Intronic
925242265 2:2341714-2341736 GTGAAACTAGAGGAGAAATCTGG - Intergenic
927283418 2:21331790-21331812 GAGAAACTGGAGCAGAAGCCAGG + Intergenic
929354761 2:41007822-41007844 CTGAAACTGGAGATTAATTTGGG + Intergenic
929588217 2:43129263-43129285 CTCAAACTAGAGCTGAAGTCAGG + Intergenic
929654432 2:43716292-43716314 CTGAAACTGGAGGAAAAGTGAGG + Intronic
929940856 2:46332949-46332971 CTGACACAGGTGAACAAGTCCGG - Intronic
932404358 2:71503679-71503701 CTGAATCTGGAGAAGAGGGCTGG - Intronic
933165933 2:79074715-79074737 CTGATACTGGCGAAGGAGTAAGG - Intergenic
933443088 2:82339066-82339088 CTAAGACTGAAAAAGAAGTCAGG + Intergenic
935290094 2:101602912-101602934 CTGAGATTGGAGAGGAACTCAGG + Intergenic
935408712 2:102736725-102736747 CGGAAACAGGAGCAGAAGACAGG - Exonic
935566843 2:104618336-104618358 CAGAAACTGAAGAGGAATTCAGG + Intergenic
935903432 2:107817300-107817322 CCAAAACTGGAGAAGCAGTGGGG - Intergenic
937312028 2:120908505-120908527 CTGAAAAGGGAAAAGAAGCCTGG + Intronic
940036339 2:149315782-149315804 CTGAAACTGGAAAAGAAACCTGG - Intergenic
940812923 2:158266030-158266052 CTGAAAGTGGAGAACCAGTTAGG - Intronic
941422862 2:165304807-165304829 ATGAAACTGGAGAAGTAGACAGG + Intronic
942198545 2:173547448-173547470 CTGAAAATGGTAAAGCAGTCGGG + Intergenic
943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG + Intergenic
943339877 2:186667730-186667752 CTGAGACTGAAGAAGATGTTGGG + Exonic
943390549 2:187262060-187262082 CTGAAAGTTGAAAAGAAGTTAGG - Intergenic
943972236 2:194425590-194425612 CTGTAACTTGAAATGAAGTCTGG + Intergenic
943981081 2:194551157-194551179 CTGAGACTGGAAAGGAAGTTAGG + Intergenic
944600418 2:201297655-201297677 CTGGGATTGGAGCAGAAGTCAGG + Intronic
944681683 2:202083383-202083405 GTGCAACTGGAGTAGAGGTCGGG - Intronic
947246642 2:228055848-228055870 ATGAAACTGGAGGAGCAATCTGG - Intronic
947972909 2:234338893-234338915 CTGGAACTGGAGATGAATCCAGG - Intergenic
948006524 2:234613796-234613818 CAAAAAGTGGAGAAGAAGGCTGG + Intergenic
948361373 2:237422899-237422921 ATGAAAGTGGGAAAGAAGTCCGG + Intronic
1168783282 20:513659-513681 TTGAAACAGCAGAAGAAGACTGG - Intronic
1169152804 20:3303909-3303931 ATGGAGCTGGAGAGGAAGTCTGG + Intronic
1169284656 20:4297846-4297868 CTGAACAAGGAGAAAAAGTCAGG - Intergenic
1170930510 20:20766021-20766043 CAGAAACTAGAGGAGAAGGCGGG + Intergenic
1172250686 20:33477255-33477277 CTGAAAAGGGAGAAAAACTCTGG - Intergenic
1174365783 20:50055367-50055389 CTGAAGCTGCAGGAGCAGTCCGG + Intergenic
1174602365 20:51734993-51735015 CTGAAGCTGGAGCTGCAGTCTGG - Intronic
1174745678 20:53059578-53059600 CTAAAACTGGATATGAATTCAGG - Intronic
1176650295 21:9540251-9540273 CTGAAATTGGAGGTGAAGTTTGG + Intergenic
1176977548 21:15339750-15339772 CTGATAGTGGAGAACAAGACAGG - Intergenic
1178218351 21:30626279-30626301 TTGAAACTGGATAAGAGGTAGGG - Intergenic
1180233892 21:46444730-46444752 CTGGATCTTGAGAAGCAGTCAGG - Exonic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1183184576 22:36284749-36284771 ATGTAACTGGAAAAGAGGTCTGG + Intronic
1183583468 22:38738989-38739011 CTGAGACAGGAGAGGAAGGCAGG + Intronic
1184828256 22:46967965-46967987 CTGGAACTGGAGTAGAGGACTGG - Intronic
950736930 3:15016883-15016905 GTGAGACTGAAGAAGATGTCTGG + Intronic
951027618 3:17846315-17846337 CAGCAGCTGGAGAGGAAGTCAGG - Intronic
952058545 3:29478674-29478696 CTGAGACTGTAGATGATGTCAGG + Intronic
952498195 3:33934674-33934696 ATGAAACTGGAGAAGTAGCCAGG - Intergenic
953152626 3:40338921-40338943 CTAAAAAGGGAGAAGAAGCCAGG + Intergenic
953819878 3:46198286-46198308 CTGATACTGGAGAAGGAGAATGG + Intronic
954444117 3:50537443-50537465 CAGGAACTGGAGAAGAGGTGGGG + Intergenic
955328786 3:58029987-58030009 CTGAGACATGGGAAGAAGTCAGG + Intronic
956350539 3:68330344-68330366 CTGCAACTGGAGAGTAAGGCTGG + Intronic
957302230 3:78407206-78407228 CTTAAGGTGGAGAAGAAGACTGG - Intergenic
958054790 3:88395673-88395695 CTGAAACTGCAGAAAAATTTGGG + Intergenic
958478015 3:94609830-94609852 ATGAAACTGAAGAAAAAATCTGG + Intergenic
958833630 3:99118363-99118385 CTGAAACTGCAGAACCAGTGTGG - Intergenic
959387797 3:105733550-105733572 CTGAAATTGGAGAATCAGACAGG - Intronic
959653906 3:108779280-108779302 CTGGACCTGGAGAAGAAATAAGG - Intergenic
959800979 3:110495181-110495203 CTGGAAAGGGAGATGAAGTCAGG + Intergenic
961090670 3:124108551-124108573 ATGAAACGTGAGCAGAAGTCAGG + Intronic
961936384 3:130588990-130589012 CTGAAACTGTGGTAGAAGTCTGG + Intronic
962130015 3:132662628-132662650 CTCAAACTGAAGCAAAAGTCAGG - Intronic
963401717 3:144806714-144806736 AGGAATCTAGAGAAGAAGTCTGG + Intergenic
966138943 3:176733034-176733056 CTGAGAATGGAGCAGAAGTAAGG - Intergenic
966793187 3:183691727-183691749 CTGACCCTGGAAAAGAAGTCCGG - Intergenic
968167064 3:196475249-196475271 CTGAAGCTGTACAAGAAGTCAGG - Exonic
968459059 4:714729-714751 CTGAGACTGAAGAGGACGTCAGG - Intronic
969911752 4:10453988-10454010 CTGTAACTGGGGAAGAGGTGGGG + Intronic
975302306 4:72804764-72804786 CTGAAAGATGAGAAGAAGTCAGG + Intergenic
976306253 4:83562565-83562587 GTGAGCCTGGCGAAGAAGTCAGG + Intronic
976785448 4:88814507-88814529 CTGACACTGGAGAAACAGGCAGG + Intronic
977245238 4:94623249-94623271 ATGAAGCTGGAGAAGAAGGTTGG - Intronic
977750413 4:100603195-100603217 CTGGAAAAGGAGAGGAAGTCAGG - Intronic
977922174 4:102657832-102657854 CTGAAACTGTTGCAGAAGCCTGG - Exonic
978458574 4:108924565-108924587 ATGTGACTGGAGAAGAAGGCTGG - Intronic
978644985 4:110919369-110919391 ATGAAACTGGAAAAGGAGACAGG - Intergenic
978666216 4:111185154-111185176 CTTAAACTGGAGAAACAGACAGG - Intergenic
978669479 4:111228788-111228810 CTGAACCAGGAGAAGCAGACTGG - Intergenic
979657281 4:123209886-123209908 CTGAAGCTGTTGAAGAAGTGGGG - Intronic
980182909 4:129423830-129423852 AATGAACTGGAGAAGAAGTCAGG - Intergenic
980998668 4:139807114-139807136 CAGAAACTGGAATAGAAGCCAGG - Intronic
981721985 4:147811086-147811108 CTGAAAATGAAGAGGAAGCCAGG - Intronic
981935931 4:150239866-150239888 CTGAAACTGGGTAAGACTTCTGG + Exonic
987136418 5:14903654-14903676 CTGAGGCTGGACAGGAAGTCAGG - Intergenic
990512654 5:56502795-56502817 CTGAAACTGGGAAAAAAATCAGG + Intergenic
991646597 5:68807537-68807559 CTGAAAAAGGAGATCAAGTCTGG + Intergenic
992743331 5:79795496-79795518 CTGAAACTGCAGAGGAGGTGCGG - Intronic
994259114 5:97635716-97635738 GTGAAAGTGGAGAACAAGTCTGG + Intergenic
996635355 5:125682322-125682344 CTGAAACAGTAGAGGAAATCAGG - Intergenic
996809777 5:127503795-127503817 CTGTAGTTGGAGAAGAAGTAGGG + Intergenic
997375119 5:133392223-133392245 CTGAAACGTGAGGAGAGGTCAGG + Intronic
997646441 5:135485080-135485102 CTTAGCCTGGAGAAGAAGTTGGG + Intergenic
1000650077 5:163806701-163806723 CTGAAACTGGACAGGTAGCCTGG + Intergenic
1001917160 5:175571396-175571418 TTGTCACTGGACAAGAAGTCTGG - Intergenic
1002163349 5:177330214-177330236 CCAGAACTGGAGAAGAAGGCAGG + Intergenic
1002177704 5:177410831-177410853 CTGGAACATGAGAAGAAGACGGG + Intronic
1003344948 6:5258173-5258195 CTGAGACTGGAGGAGCAGACAGG + Intronic
1005417157 6:25612158-25612180 CTGAAAATGTACATGAAGTCTGG + Intronic
1005605539 6:27473287-27473309 CTGAAACAGGAGCAAAAGACTGG - Intergenic
1005819958 6:29589662-29589684 ATGACCCTGGAGCAGAAGTCTGG - Intronic
1006910368 6:37559465-37559487 CTGGAGCTGGAGCAGAAGTGTGG + Intergenic
1007646824 6:43389068-43389090 CTGGAACTGGAGGTGAAGTAGGG + Intergenic
1009170294 6:60390716-60390738 ATGAAACTGGAGAACAAATTTGG + Intergenic
1011006944 6:82656162-82656184 GTTAAACTGGACTAGAAGTCAGG + Intergenic
1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG + Intronic
1017748341 6:157467017-157467039 CTCAAACAGGAGAAGTAGGCTGG - Intronic
1018027729 6:159818882-159818904 TTCAGACTGGATAAGAAGTCAGG + Intronic
1020362395 7:7341569-7341591 CTGAAAATTAATAAGAAGTCAGG - Intergenic
1021271535 7:18593397-18593419 CTGAAACTGCCCCAGAAGTCAGG + Intronic
1021469200 7:20981871-20981893 CTGAAACTGGAGGACACGTTTGG - Intergenic
1021496392 7:21279097-21279119 CTGAATATGGAGAAACAGTCAGG - Intergenic
1022828009 7:34036488-34036510 CTGAAACTGGAGGAGAGGCGGGG - Intronic
1022887114 7:34658037-34658059 TTGAAGCTGGAGCAGAAGTGGGG + Intergenic
1024264874 7:47598796-47598818 CTGAAGCTGTAGAAGGAGGCAGG - Intergenic
1025622995 7:63191335-63191357 CTGAAAGTGGGGAAGAAATGTGG - Intergenic
1026045112 7:66901782-66901804 CTGGGACTGGAGAAGAGGCCGGG - Intergenic
1026223496 7:68420760-68420782 CTGAAAGTGGGGATGAAGACTGG - Intergenic
1027940103 7:84667458-84667480 CTGACACAGGAGAAGAAGAAAGG - Intergenic
1030106147 7:105989220-105989242 CAGAAAGTGGAGAAGAGGTGGGG - Intronic
1032281731 7:130508654-130508676 CTGCAACTGGAGGAGAAGGGAGG + Exonic
1032541690 7:132708211-132708233 CAGAAACTAGAGGAGAAATCTGG + Intronic
1034558654 7:151865722-151865744 ATGAAAGTGGAGAAGAGGCCGGG + Intronic
1036038722 8:5049169-5049191 CTGATACTGGTAAAGAAGTGTGG - Intergenic
1036523982 8:9518323-9518345 GTGGAACTGGAGAAGTAATCGGG + Intergenic
1037160106 8:15759307-15759329 CTTAAACTGGAGAGGAAGTCAGG - Intronic
1037234671 8:16703879-16703901 GTGAAAGTGGAGATGAAGTCGGG - Intergenic
1038838272 8:31153058-31153080 CTGAAAGTTGAGAACAAGTTTGG - Intronic
1042480610 8:69297990-69298012 GTGAAACTGGAGGAGAAGAAGGG + Intergenic
1043536318 8:81208952-81208974 CTCAAACAGGAAAAGAAGTAGGG - Intergenic
1044056471 8:87576462-87576484 CTTAAACTGGGGAGGAAGTGGGG + Intronic
1044194472 8:89357919-89357941 CTGAGACTGGAGAGGGAGACAGG - Intergenic
1044749276 8:95400701-95400723 CTGACACTGGGGAAGTAGGCAGG - Intergenic
1045913159 8:107434303-107434325 ATGAAACAGGAAAAGGAGTCTGG + Intronic
1047900688 8:129418811-129418833 CTGAACCTAGGGAAGAAGTAAGG + Intergenic
1048341393 8:133541639-133541661 CAGAAACTAGAGCAGAAGACTGG - Intronic
1048837862 8:138538306-138538328 CTGAGAGTGGAGAAGAAGGAAGG + Intergenic
1048931819 8:139321330-139321352 CTGAAATTTGAGCAGAAGTCAGG + Intergenic
1049034186 8:140061750-140061772 CTGAGAATGGAGCAGCAGTCAGG + Intronic
1050719321 9:8567368-8567390 CTGAAATTGGAGAAGAGGTCAGG - Intronic
1053187640 9:36031905-36031927 CTGGGACTGGAGAAGAAGACAGG + Intergenic
1055126364 9:72722419-72722441 CTCAAACGGGAGATAAAGTCAGG - Intronic
1056310997 9:85340935-85340957 CTAAACCTTGAGAAGAAGTCTGG + Intergenic
1057412743 9:94832042-94832064 CTGAAAGTGGAGAAAACTTCTGG + Intronic
1057923021 9:99114570-99114592 CTTAAACTGGAGAAGAAAGATGG - Intronic
1058128540 9:101223982-101224004 TTGAAACAGGAGAAGAACTCGGG - Intronic
1058574989 9:106391289-106391311 CTCAAAATGGAGAGGAAATCAGG + Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059065894 9:111083358-111083380 TTGAAACTGGAGGTGGAGTCAGG - Intergenic
1059842052 9:118228616-118228638 CTGAAGAGGGAGAAGAAGTTTGG + Intergenic
1060070683 9:120544468-120544490 CATAACCTGGAGAAGAAGCCTGG + Intronic
1060125476 9:121040347-121040369 ATGAAGCTGGGGAAGAAGGCAGG + Intronic
1061412563 9:130429440-130429462 CTGAAACTGGAGAAGGGGACAGG + Intronic
1062154178 9:135037183-135037205 TTGGGAGTGGAGAAGAAGTCTGG + Intergenic
1203628035 Un_KI270750v1:43805-43827 CTGAAATTGGAGGTGAAGTTTGG + Intergenic
1187598652 X:20802289-20802311 CTGAAACTGGAAATGCAGACAGG + Intergenic
1188650130 X:32622142-32622164 CTGTAAGTGGAGGTGAAGTCAGG - Intronic
1189874897 X:45425866-45425888 CTGAAACTTGTGAAGAAGTATGG + Intergenic
1191119759 X:56891055-56891077 AGGAATCTGGAGAGGAAGTCTGG - Intergenic
1192244350 X:69360450-69360472 ATGAAACTGGAGAGGTAGGCTGG + Intergenic
1192860873 X:75069137-75069159 CTGAAATTGGAGATGAAGAAAGG + Intronic
1192924196 X:75738240-75738262 CTATAACTGGAGCAGAAGTAGGG + Intergenic
1192947688 X:75983667-75983689 CTCTAACTGGAGCAGAAGTGGGG + Intergenic
1193137507 X:77988572-77988594 GGGACACTGGAGAAAAAGTCAGG + Exonic
1194205112 X:91002841-91002863 CTGAAATTGGAGAAGGTGCCCGG + Intergenic
1194673540 X:96765764-96765786 ATGAAACTAGAGAAGCAGGCAGG - Intronic
1195211680 X:102656297-102656319 CTGAGACTAGAGAAGAAGACAGG + Exonic
1196050094 X:111295859-111295881 ATGAAAATGGAGAAGAAGAAAGG + Exonic
1196808853 X:119612598-119612620 TTGAAAATGGAGAAGAGATCAGG + Intergenic
1196883252 X:120219678-120219700 CTGAAACTGGATAGGGAGTATGG - Intergenic
1197770496 X:130086351-130086373 CTGTAACTGGGGAAGAACCCTGG - Intronic
1198006518 X:132500014-132500036 CTGAAACTGGATATGAAGCAGGG - Intergenic
1198131802 X:133703411-133703433 CTGAAACATAAGAAGAAGGCAGG + Intronic
1198508797 X:137328252-137328274 CTGGAACTAGAGAAGTAGCCAGG + Intergenic
1199235351 X:145486626-145486648 TTGAAATGGGAGTAGAAGTCAGG - Intergenic
1199442484 X:147884233-147884255 CTCAAACTGAAGAAGAAGAAAGG - Intergenic
1199539342 X:148941672-148941694 CTGAAGCTGAAGAAGGAGTTGGG + Intronic
1199830714 X:151546487-151546509 CGGAATCTAGAGAAGCAGTCTGG - Intergenic
1200550932 Y:4577962-4577984 CTGAAATTGGAGAAGGTGCCCGG + Intergenic