ID: 1069757693

View in Genome Browser
Species Human (GRCh38)
Location 10:70783140-70783162
Sequence GAGGGGCAAAGCCCACTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069757682_1069757693 25 Left 1069757682 10:70783092-70783114 CCTTTGCTCAGTGCTTCTGGCAC No data
Right 1069757693 10:70783140-70783162 GAGGGGCAAAGCCCACTACCTGG 0: 1
1: 0
2: 0
3: 9
4: 107
1069757684_1069757693 2 Left 1069757684 10:70783115-70783137 CCGCTCAAGTCTTTTCCCTGCCC No data
Right 1069757693 10:70783140-70783162 GAGGGGCAAAGCCCACTACCTGG 0: 1
1: 0
2: 0
3: 9
4: 107
1069757683_1069757693 3 Left 1069757683 10:70783114-70783136 CCCGCTCAAGTCTTTTCCCTGCC No data
Right 1069757693 10:70783140-70783162 GAGGGGCAAAGCCCACTACCTGG 0: 1
1: 0
2: 0
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069757693 Original CRISPR GAGGGGCAAAGCCCACTACC TGG Intronic