ID: 1069760285

View in Genome Browser
Species Human (GRCh38)
Location 10:70805835-70805857
Sequence CTTTGTAAGCTTTCCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069760280_1069760285 -2 Left 1069760280 10:70805814-70805836 CCTTCTGTTCCCAACTAGAAACT No data
Right 1069760285 10:70805835-70805857 CTTTGTAAGCTTTCCCTGGAGGG No data
1069760278_1069760285 7 Left 1069760278 10:70805805-70805827 CCCAAAGGGCCTTCTGTTCCCAA No data
Right 1069760285 10:70805835-70805857 CTTTGTAAGCTTTCCCTGGAGGG No data
1069760275_1069760285 29 Left 1069760275 10:70805783-70805805 CCTGAGACAACATTGGGCAAGTC No data
Right 1069760285 10:70805835-70805857 CTTTGTAAGCTTTCCCTGGAGGG No data
1069760279_1069760285 6 Left 1069760279 10:70805806-70805828 CCAAAGGGCCTTCTGTTCCCAAC No data
Right 1069760285 10:70805835-70805857 CTTTGTAAGCTTTCCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069760285 Original CRISPR CTTTGTAAGCTTTCCCTGGA GGG Intergenic
No off target data available for this crispr