ID: 1069761174

View in Genome Browser
Species Human (GRCh38)
Location 10:70812631-70812653
Sequence ATTGCCAACTGGAGTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069761174_1069761183 6 Left 1069761174 10:70812631-70812653 CCTTGCTCACTCCAGTTGGCAAT No data
Right 1069761183 10:70812660-70812682 GCATTTGGTCCCTGCTGTGGGGG No data
1069761174_1069761186 23 Left 1069761174 10:70812631-70812653 CCTTGCTCACTCCAGTTGGCAAT No data
Right 1069761186 10:70812677-70812699 TGGGGGCTCCCATGTCTGTCTGG No data
1069761174_1069761179 -9 Left 1069761174 10:70812631-70812653 CCTTGCTCACTCCAGTTGGCAAT No data
Right 1069761179 10:70812645-70812667 GTTGGCAATGTCGGGGCATTTGG No data
1069761174_1069761180 3 Left 1069761174 10:70812631-70812653 CCTTGCTCACTCCAGTTGGCAAT No data
Right 1069761180 10:70812657-70812679 GGGGCATTTGGTCCCTGCTGTGG No data
1069761174_1069761181 4 Left 1069761174 10:70812631-70812653 CCTTGCTCACTCCAGTTGGCAAT No data
Right 1069761181 10:70812658-70812680 GGGCATTTGGTCCCTGCTGTGGG No data
1069761174_1069761182 5 Left 1069761174 10:70812631-70812653 CCTTGCTCACTCCAGTTGGCAAT No data
Right 1069761182 10:70812659-70812681 GGCATTTGGTCCCTGCTGTGGGG No data
1069761174_1069761187 30 Left 1069761174 10:70812631-70812653 CCTTGCTCACTCCAGTTGGCAAT No data
Right 1069761187 10:70812684-70812706 TCCCATGTCTGTCTGGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069761174 Original CRISPR ATTGCCAACTGGAGTGAGCA AGG (reversed) Intergenic
No off target data available for this crispr