ID: 1069761180

View in Genome Browser
Species Human (GRCh38)
Location 10:70812657-70812679
Sequence GGGGCATTTGGTCCCTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069761169_1069761180 30 Left 1069761169 10:70812604-70812626 CCCATGATAACTCGGTGACTTGC No data
Right 1069761180 10:70812657-70812679 GGGGCATTTGGTCCCTGCTGTGG No data
1069761172_1069761180 5 Left 1069761172 10:70812629-70812651 CCCCTTGCTCACTCCAGTTGGCA No data
Right 1069761180 10:70812657-70812679 GGGGCATTTGGTCCCTGCTGTGG No data
1069761170_1069761180 29 Left 1069761170 10:70812605-70812627 CCATGATAACTCGGTGACTTGCT No data
Right 1069761180 10:70812657-70812679 GGGGCATTTGGTCCCTGCTGTGG No data
1069761178_1069761180 -8 Left 1069761178 10:70812642-70812664 CCAGTTGGCAATGTCGGGGCATT No data
Right 1069761180 10:70812657-70812679 GGGGCATTTGGTCCCTGCTGTGG No data
1069761173_1069761180 4 Left 1069761173 10:70812630-70812652 CCCTTGCTCACTCCAGTTGGCAA No data
Right 1069761180 10:70812657-70812679 GGGGCATTTGGTCCCTGCTGTGG No data
1069761174_1069761180 3 Left 1069761174 10:70812631-70812653 CCTTGCTCACTCCAGTTGGCAAT No data
Right 1069761180 10:70812657-70812679 GGGGCATTTGGTCCCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069761180 Original CRISPR GGGGCATTTGGTCCCTGCTG TGG Intergenic
No off target data available for this crispr