ID: 1069761182

View in Genome Browser
Species Human (GRCh38)
Location 10:70812659-70812681
Sequence GGCATTTGGTCCCTGCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069761172_1069761182 7 Left 1069761172 10:70812629-70812651 CCCCTTGCTCACTCCAGTTGGCA No data
Right 1069761182 10:70812659-70812681 GGCATTTGGTCCCTGCTGTGGGG No data
1069761178_1069761182 -6 Left 1069761178 10:70812642-70812664 CCAGTTGGCAATGTCGGGGCATT No data
Right 1069761182 10:70812659-70812681 GGCATTTGGTCCCTGCTGTGGGG No data
1069761174_1069761182 5 Left 1069761174 10:70812631-70812653 CCTTGCTCACTCCAGTTGGCAAT No data
Right 1069761182 10:70812659-70812681 GGCATTTGGTCCCTGCTGTGGGG No data
1069761173_1069761182 6 Left 1069761173 10:70812630-70812652 CCCTTGCTCACTCCAGTTGGCAA No data
Right 1069761182 10:70812659-70812681 GGCATTTGGTCCCTGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069761182 Original CRISPR GGCATTTGGTCCCTGCTGTG GGG Intergenic
No off target data available for this crispr