ID: 1069761182 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:70812659-70812681 |
| Sequence | GGCATTTGGTCCCTGCTGTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1069761172_1069761182 | 7 | Left | 1069761172 | 10:70812629-70812651 | CCCCTTGCTCACTCCAGTTGGCA | No data | ||
| Right | 1069761182 | 10:70812659-70812681 | GGCATTTGGTCCCTGCTGTGGGG | No data | ||||
| 1069761178_1069761182 | -6 | Left | 1069761178 | 10:70812642-70812664 | CCAGTTGGCAATGTCGGGGCATT | No data | ||
| Right | 1069761182 | 10:70812659-70812681 | GGCATTTGGTCCCTGCTGTGGGG | No data | ||||
| 1069761174_1069761182 | 5 | Left | 1069761174 | 10:70812631-70812653 | CCTTGCTCACTCCAGTTGGCAAT | No data | ||
| Right | 1069761182 | 10:70812659-70812681 | GGCATTTGGTCCCTGCTGTGGGG | No data | ||||
| 1069761173_1069761182 | 6 | Left | 1069761173 | 10:70812630-70812652 | CCCTTGCTCACTCCAGTTGGCAA | No data | ||
| Right | 1069761182 | 10:70812659-70812681 | GGCATTTGGTCCCTGCTGTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1069761182 | Original CRISPR | GGCATTTGGTCCCTGCTGTG GGG | Intergenic | ||
| No off target data available for this crispr | |||||