ID: 1069761187

View in Genome Browser
Species Human (GRCh38)
Location 10:70812684-70812706
Sequence TCCCATGTCTGTCTGGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069761185_1069761187 -9 Left 1069761185 10:70812670-70812692 CCTGCTGTGGGGGCTCCCATGTC No data
Right 1069761187 10:70812684-70812706 TCCCATGTCTGTCTGGCCCTTGG No data
1069761184_1069761187 -8 Left 1069761184 10:70812669-70812691 CCCTGCTGTGGGGGCTCCCATGT No data
Right 1069761187 10:70812684-70812706 TCCCATGTCTGTCTGGCCCTTGG No data
1069761178_1069761187 19 Left 1069761178 10:70812642-70812664 CCAGTTGGCAATGTCGGGGCATT No data
Right 1069761187 10:70812684-70812706 TCCCATGTCTGTCTGGCCCTTGG No data
1069761174_1069761187 30 Left 1069761174 10:70812631-70812653 CCTTGCTCACTCCAGTTGGCAAT No data
Right 1069761187 10:70812684-70812706 TCCCATGTCTGTCTGGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069761187 Original CRISPR TCCCATGTCTGTCTGGCCCT TGG Intergenic
No off target data available for this crispr