ID: 1069761834

View in Genome Browser
Species Human (GRCh38)
Location 10:70816321-70816343
Sequence GCGCGGGGCCGCGGTGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1172
Summary {0: 1, 1: 0, 2: 7, 3: 153, 4: 1011}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069761817_1069761834 14 Left 1069761817 10:70816284-70816306 CCAGCCGCTGAGGTCCAAGCAAG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG 0: 1
1: 0
2: 7
3: 153
4: 1011
1069761823_1069761834 0 Left 1069761823 10:70816298-70816320 CCAAGCAAGTGGACGGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG 0: 1
1: 0
2: 7
3: 153
4: 1011
1069761819_1069761834 10 Left 1069761819 10:70816288-70816310 CCGCTGAGGTCCAAGCAAGTGGA 0: 1
1: 0
2: 0
3: 5
4: 160
Right 1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG 0: 1
1: 0
2: 7
3: 153
4: 1011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069761834 Original CRISPR GCGCGGGGCCGCGGTGGGGC GGG Intronic
900000281 1:11049-11071 GCACGGCGCCGGGCTGGGGCGGG + Intergenic
900087441 1:905122-905144 TCCCTGGGACGCGGTGGGGCGGG - Intergenic
900087580 1:905829-905851 GCTCCAGGCCGCGGTGGGGTGGG - Intergenic
900096720 1:942809-942831 TCGCTGGGCCGCGCTGAGGCAGG - Exonic
900113610 1:1019774-1019796 CCGGGGGGCCGCGGCGGGGGAGG + Intergenic
900113644 1:1019863-1019885 GCCCGGCGCGGCCGTGGGGCGGG - Intergenic
900162055 1:1228494-1228516 ACGCGGAGCCGCGGCGGAGCCGG - Exonic
900190075 1:1349510-1349532 GGGCGGGGCCGGGGCGGGGCGGG - Intergenic
900203227 1:1420495-1420517 GCGAGGGGCCCCGGTGGGCGCGG - Exonic
900245158 1:1633134-1633156 GCGCAGGGCCGGGCCGGGGCGGG - Intronic
900256389 1:1700293-1700315 GCGCAGGGCCGGGCCGGGGCGGG - Intronic
900386324 1:2412624-2412646 GGGCGGGGCCGGACTGGGGCTGG + Intronic
900414006 1:2526776-2526798 GCCCGGGGCTGCGGGCGGGCGGG + Intergenic
900427451 1:2587030-2587052 CCGCGGGGCCTGGGCGGGGCTGG + Intronic
900534108 1:3168572-3168594 GCGAGGGGCGGGGGTGGGGCGGG - Intronic
900581717 1:3412835-3412857 GGGCGGGGCCGCGGCGGTGCTGG + Intronic
900582489 1:3415929-3415951 GCTCCGGGCTGCGGAGGGGCTGG + Intronic
900656517 1:3761436-3761458 GCGCTGTGCCCCGCTGGGGCTGG - Intronic
901183665 1:7358542-7358564 GCCCGGGGCAGGGGTGGCGCGGG - Intronic
901242812 1:7704785-7704807 GCGCGGGGCCGGGCTGGGCCGGG + Intronic
901242871 1:7704964-7704986 GCGCGGGGCGGGGGCGGGGCCGG + Intronic
901332768 1:8423730-8423752 GCGCGGGGCCCGGGGGGCGCGGG + Intronic
901433996 1:9235081-9235103 GGCCGGGGCGGCGGCGGGGCCGG - Intronic
901500967 1:9652373-9652395 GAGCGGGGCTGCAGAGGGGCCGG + Intronic
901577247 1:10210805-10210827 GCGCGGGGGCGCGGGGGGCCGGG - Exonic
901659857 1:10792328-10792350 GTGCGGGGCCGGGGGGGGGGGGG - Intronic
901758438 1:11455492-11455514 GCACCGGGCGGTGGTGGGGCAGG + Intergenic
901886937 1:12230079-12230101 GCGCAGCGCCGGGCTGGGGCGGG + Exonic
901930796 1:12595403-12595425 GGGCGGGGCCGCGGGGGTCCCGG + Intronic
902131336 1:14263634-14263656 GAGCGGGGGCAGGGTGGGGCTGG + Intergenic
902336776 1:15758716-15758738 GCGCGGGGCGGCGGGGCGGAGGG + Intronic
902410000 1:16206917-16206939 GCGCGGGGACCCGGCGGGGCGGG - Intronic
902431523 1:16367216-16367238 GCGCGGGGAGGGGGTGGGGGAGG + Exonic
902455941 1:16534292-16534314 GCGAGGGGCGGCAGTGGGGAGGG - Intergenic
902496228 1:16873619-16873641 GCGAGGGGCGGCAGTGGGGAGGG + Intronic
902585736 1:17437959-17437981 GCCCGGGCCCGCGGCGGGGGAGG - Intronic
902823383 1:18956718-18956740 GGGCGGGGCCGCGGCGGGGGCGG - Intergenic
903078097 1:20787317-20787339 GCGCGGGGCCGCGGGTAGGGGGG - Intronic
903115581 1:21176450-21176472 GCCGGGGGCAGCGGGGGGGCGGG + Intronic
903164142 1:21509302-21509324 GGGCGGGGCCGGGGCCGGGCTGG + Intergenic
903233993 1:21937634-21937656 GCGCGGGGAAGCGGGGGAGCCGG - Intergenic
903349749 1:22710703-22710725 GCGCGCGGCCGCCGGGGGCCGGG + Intergenic
903501012 1:23800274-23800296 GCGCGGGGCGGGGGCGGGGGCGG - Intronic
903555032 1:24187162-24187184 GCGCGGGGCCGCGGGAGGGAGGG - Intronic
903596991 1:24502745-24502767 GGGCGGGGGCGCGCGGGGGCCGG - Intronic
903637127 1:24828686-24828708 GGGCGGGGTGGGGGTGGGGCGGG + Intronic
903777123 1:25800291-25800313 GCGCGGCGGCGCGGTGGCGCGGG - Exonic
904080951 1:27872419-27872441 GGGCGGGGCTTCGGCGGGGCGGG + Intergenic
904080976 1:27872485-27872507 GGGCGGGGCATCGGCGGGGCGGG + Intergenic
904181351 1:28668862-28668884 GCGCGGGCGCGGGGTGGGGTGGG + Intronic
904181413 1:28669023-28669045 TCGCGGCGCCGCGGGGGGGTGGG + Intronic
904237366 1:29123938-29123960 AGGCGGGGCCGGGGCGGGGCTGG - Intergenic
904467799 1:30718528-30718550 GGGCGGGGCCGGGGAGGAGCCGG - Intronic
904467824 1:30718598-30718620 GCGCAGGGCAGGGGCGGGGCCGG - Intronic
904563334 1:31413155-31413177 GGGCGGGGCCGGGGCGGGGCCGG + Intronic
904699688 1:32351196-32351218 GCGGGGGCTCGCGGAGGGGCAGG - Intergenic
904775087 1:32901431-32901453 CCGCGGGGGCGCTGCGGGGCCGG - Intronic
904837777 1:33349966-33349988 GGGCGGGGCCGCGGGAGGGGCGG + Intronic
905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG + Exonic
905441086 1:37996956-37996978 CCGCGGGGATGGGGTGGGGCAGG + Exonic
905449372 1:38046903-38046925 GCGCGGGGCGGGGGCCGGGCAGG - Intergenic
905648275 1:39639693-39639715 AGGCGGGGCCGGGGCGGGGCCGG - Exonic
905809611 1:40902509-40902531 CCGAGGGGCCACAGTGGGGCTGG + Intergenic
905863892 1:41366514-41366536 GGGGGCGGCCGCCGTGGGGCCGG - Intronic
906040422 1:42784747-42784769 GCGTGGGCCCGGAGTGGGGCGGG - Intronic
906076908 1:43058624-43058646 GGCAGGGGCCGCGCTGGGGCTGG + Intergenic
906144202 1:43550350-43550372 GCCTGGGGGCGGGGTGGGGCGGG - Intronic
906197133 1:43936244-43936266 GCGAGGGGGCGGGGCGGGGCTGG + Intronic
907277668 1:53326278-53326300 GGGCGGGGCCGGGGCAGGGCAGG + Intronic
907364126 1:53945845-53945867 CCGCGGTGGCGGGGTGGGGCGGG - Exonic
907909726 1:58815415-58815437 GCGCCGGGCCGCGGGGGAGGCGG + Intergenic
909632362 1:77780153-77780175 GCGAGGGGCTGCTGTGGGGTCGG + Intronic
909657387 1:78046360-78046382 GCGCGGCGCGGCGGAGAGGCGGG - Intronic
911176135 1:94820309-94820331 GGGCCGGGCCGGGGAGGGGCGGG - Intergenic
912441770 1:109704439-109704461 GTGAGGGGCTGCGGTGGGGGAGG - Intronic
913047943 1:115089531-115089553 GGGCGGGGCCTCCGGGGGGCGGG + Intergenic
914009748 1:143766458-143766480 GCGCCGGGCTGCGGGCGGGCAGG + Intergenic
914803073 1:150974508-150974530 TCGCGGGGCCGCGGAGGGGTCGG - Intronic
915463193 1:156081742-156081764 GCGGGCGGCGGCGGCGGGGCCGG + Exonic
915543685 1:156583856-156583878 GCGCTTGGCCCAGGTGGGGCTGG + Exonic
915932752 1:160070176-160070198 GGCCGGGGCCGGGGTCGGGCCGG + Exonic
915937727 1:160098853-160098875 GGGCGGGGCCGGGGCGGGGCTGG - Intronic
915937768 1:160098942-160098964 GGGCGGGGCGGGGGAGGGGCCGG - Intronic
915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG + Intronic
916484809 1:165249369-165249391 GGGCAGGGCTGCGGTGGGGTGGG - Intronic
916535378 1:165698605-165698627 GGGCGGGGCCGCGGGAGGGGCGG + Exonic
916651770 1:166839902-166839924 GGGCGCGGCGGCGGTGGCGCAGG + Intronic
917141620 1:171841405-171841427 GGGCGGGGCAGCCGCGGGGCGGG + Intergenic
917291567 1:173477159-173477181 GGGCCGGGCCGGGCTGGGGCCGG - Intergenic
917291573 1:173477174-173477196 GCGCGGGGCGGGGCTGGGCCGGG - Intergenic
917817670 1:178726038-178726060 GCGCGGGCCGGGTGTGGGGCAGG + Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
918511396 1:185317387-185317409 GGGCGGGGCCGCGGGTGGGGCGG - Intergenic
919735592 1:200948254-200948276 GAGGGGGGCCGGGGTGGGGAAGG + Intergenic
919809474 1:201399573-201399595 GCCCGGGGCCGGCGTGGGGCTGG + Exonic
919826481 1:201506969-201506991 CCCCGGGGCTGCGGCGGGGCTGG + Intronic
920886826 1:209937983-209938005 GCGCGGTGGGGCGGTGGGGTGGG + Intergenic
921029786 1:211327036-211327058 GCGCGAGGCGGCGGCTGGGCCGG + Intronic
921177824 1:212609020-212609042 GCGCGGATCCGGGGTGGGTCAGG - Intronic
921189874 1:212699785-212699807 GCGCGCGGGCGGGGCGGGGCGGG - Exonic
921291787 1:213664191-213664213 GCGGGGGGGCGGGGTGGGGAGGG + Intergenic
921604761 1:217139715-217139737 GCGCGGGCCCGCGCAGAGGCCGG + Intergenic
922416478 1:225427579-225427601 GAGCCAGGCTGCGGTGGGGCAGG + Intronic
922440530 1:225652654-225652676 GCGCGGGGCGGGGGCCGGGCGGG - Intronic
922464880 1:225839795-225839817 GAGAGGGGCCGGGGTGAGGCTGG - Intronic
922571058 1:226634933-226634955 GCCCCGGGCCGCAGTGGGGAGGG - Intronic
922917659 1:229271409-229271431 GCGGGGGGCGTCGGTGGCGCGGG + Intronic
922925128 1:229342153-229342175 GCGCGGGGCCCCGGAGGAGCAGG - Exonic
923086285 1:230705802-230705824 GGGCAGGGCCGCGGTGGCACGGG - Intronic
923401573 1:233619921-233619943 GGGCGGGGGGGCGGGGGGGCAGG + Intronic
923490417 1:234478940-234478962 GCGCGCGGCAGCGGGGGCGCAGG - Exonic
923506459 1:234609773-234609795 GCGCGGCGCGGCGGGGCGGCGGG + Intergenic
923631158 1:235650106-235650128 GCGCGGGCCCGGGCTGGGGCGGG - Intronic
1062857516 10:786651-786673 GTGCGGGGGCGGGGTGGGGCGGG + Intergenic
1062874048 10:931372-931394 GCGCGGGTCCGAGCTGGGCCGGG + Intronic
1062874158 10:931730-931752 GCGCGGGTCCGCGCGGGGGCGGG - Intergenic
1062932675 10:1363280-1363302 GCCCGGGGCCGCGGGGGTGGCGG + Exonic
1063298055 10:4826286-4826308 GTGCGGGGCGGCGGGGCGGCGGG + Exonic
1063326476 10:5108300-5108322 TTGGGGGGCCGTGGTGGGGCAGG + Intronic
1063458310 10:6200675-6200697 GCGGGGGGTGGTGGTGGGGCGGG + Intronic
1064290606 10:14030893-14030915 GCCAGGGACTGCGGTGGGGCTGG - Intronic
1064410098 10:15097416-15097438 GCGCGGGGCCCACGTAGGGCAGG + Exonic
1065034248 10:21621607-21621629 GGGCGGGGGCGGGGTGGGGGGGG - Intronic
1065100366 10:22325572-22325594 GCGCGGGGGCGGGGTGGGTGCGG - Intronic
1065100396 10:22325634-22325656 GTGCGGGGCGGCGGGCGGGCGGG - Intronic
1065521604 10:26579373-26579395 GGGCAGGGCCGCTGTGGGGGCGG + Intergenic
1065528105 10:26642971-26642993 GGGCGGGGCTGCCGTGGGGGCGG + Intergenic
1065528113 10:26642988-26643010 GGGCGGGGTCGCTGTGGGGGCGG + Intergenic
1067116178 10:43437088-43437110 GGGCGGGGCCGCCGAGGGGCGGG - Intronic
1068637399 10:59362684-59362706 GCGGGGCGCGGCGGCGGGGCTGG + Intronic
1068933897 10:62617729-62617751 GGGCGGGGCGGGGGTGGGGGTGG - Intronic
1069582046 10:69572933-69572955 GGGCGGGGCGGACGTGGGGCAGG + Exonic
1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG + Intronic
1070162602 10:73874747-73874769 GCGCGGGGCAGCCGAGGGGAGGG + Intergenic
1070570739 10:77637998-77638020 GCGCGGAGCCGGGGCGGGCCCGG - Intronic
1070610147 10:77927040-77927062 CCGCGGGGCCCCGGTGAGCCGGG - Intergenic
1070835623 10:79445456-79445478 GCGGGCGGCCGGGGAGGGGCCGG - Exonic
1070954264 10:80454232-80454254 GCGGAGGGGCGCGGAGGGGCGGG - Exonic
1071309369 10:84328532-84328554 GCACGGGCCCGCGGCGGGGCGGG + Intergenic
1071579260 10:86755705-86755727 GCGTGAGCCCGCGGTGGAGCTGG + Intergenic
1071997535 10:91162930-91162952 GCGCGGGGCGGGGGCTGGGCCGG - Intergenic
1072059748 10:91798484-91798506 CCGCGGGGCAGCCGGGGGGCAGG + Exonic
1072654217 10:97319369-97319391 GCGGTGGGCCGCGGCGGAGCGGG - Exonic
1072656780 10:97335065-97335087 GCGCGGGGCGGGAGTCGGGCGGG - Intergenic
1073249842 10:102114673-102114695 GCGGGGGGCCGCGGGGAGTCCGG + Intronic
1073306045 10:102504181-102504203 GGCCGGGGGCGCGGTGGGGCCGG - Exonic
1074618309 10:115092943-115092965 GCGCGGGGTGCGGGTGGGGCCGG + Intergenic
1074780404 10:116798175-116798197 GCGGTGGGGCGGGGTGGGGCAGG + Intergenic
1075519765 10:123136491-123136513 GCGCGGGGCGGGGACGGGGCGGG - Intronic
1075956584 10:126528617-126528639 GTGCTGGGCCGTGGTGGAGCTGG - Intronic
1076035639 10:127196597-127196619 CCGCGGGGCGGAGGTGGGGCGGG + Intronic
1076035651 10:127196624-127196646 GCGCGGGGCCGGGCCGGGCCGGG + Intronic
1076319134 10:129565115-129565137 CGGCGGGGCCGGGGTGTGGCAGG + Intronic
1076605917 10:131689784-131689806 GTGCGGGGCTGAGCTGGGGCTGG - Intergenic
1076683517 10:132186876-132186898 GGGCGGAGCCGGGGTGGGGGCGG + Intergenic
1076685582 10:132197110-132197132 GGGCAGGGCTGCCGTGGGGCAGG + Intronic
1076722206 10:132397567-132397589 GCGCCGGGCCGGGGCGGGCCGGG + Intronic
1076861512 10:133140256-133140278 GGGCGGGGCAGGGGCGGGGCAGG - Intergenic
1076887443 10:133269157-133269179 GCCCCGGGCCGAGGAGGGGCTGG + Intronic
1077035836 11:494137-494159 GCGCTGGGCCGCGCTGGGCTGGG + Intergenic
1077065538 11:639563-639585 GCGCGGGGGCGCCGGGGCGCGGG - Intronic
1077076906 11:706153-706175 GGGCCGGGCCGGGGCGGGGCCGG - Exonic
1077094032 11:791863-791885 GGGCAGGGCCGGTGTGGGGCTGG - Exonic
1077103663 11:832895-832917 GGGCGGGGCCGGGGCGGGGCGGG + Exonic
1077121515 11:910964-910986 GGGCGGGGCCGCGCCGGGGGCGG + Intronic
1077143521 11:1035107-1035129 GGCCTGGGCCGCGGTGGGCCGGG - Intronic
1077216632 11:1397830-1397852 GAGCTGGGCTGGGGTGGGGCTGG + Intronic
1077385882 11:2269317-2269339 GCTCGGAGCCGCGGTGAGTCAGG + Intronic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1077495762 11:2885908-2885930 GGGCCGGGCCGCGGCGGGGCGGG - Intergenic
1077923161 11:6656003-6656025 GCGCGGCGCGGCGCTGGGGCCGG - Intergenic
1078090718 11:8263029-8263051 CCGCGGGGCCGCGCGGAGGCTGG - Intronic
1079035184 11:17014411-17014433 GCGCGGAGCCGCCGCGGGGTGGG + Exonic
1079101446 11:17544461-17544483 GGGCGGGGCCGCTGCGAGGCTGG + Intergenic
1080384825 11:31805140-31805162 GCGCGGGGTCGCGGGCCGGCCGG - Intronic
1080646269 11:34190243-34190265 CAGCGGGGCAGGGGTGGGGCAGG - Intronic
1081773741 11:45664662-45664684 GAGCTGGGCCCCTGTGGGGCCGG - Intronic
1081863617 11:46347823-46347845 GAGCGGGGCGGCGGCGGGGCAGG + Intronic
1082810471 11:57476451-57476473 GCGCGCGGCCGCTCTGGGCCTGG + Exonic
1083048256 11:59755385-59755407 GCGCGAGGCGCCGGTGGGGGCGG + Exonic
1083225420 11:61281630-61281652 GGGCGGGGCCGGGGTAGGGCGGG + Intronic
1083323925 11:61863791-61863813 GCGCGGGGCTGCGGGGAGGCGGG + Intronic
1083419948 11:62546890-62546912 GGGCGGGGCCGGAGCGGGGCTGG + Intronic
1083430800 11:62612786-62612808 GGGCGGGCCCGAGGGGGGGCCGG + Exonic
1083432546 11:62621836-62621858 GGGCGGGGCGGGGGTGCGGCGGG - Intronic
1083572656 11:63768636-63768658 GAGCGGGGCCCCGGGGCGGCGGG + Exonic
1083572668 11:63768659-63768681 GCGCGGGGCCGCGGGGCCGGCGG + Exonic
1083668070 11:64285958-64285980 GAGCGTGGACGCGGTGGGGGAGG + Intronic
1083688622 11:64392696-64392718 GCGGGGGGCCCTGTTGGGGCTGG + Intergenic
1083743508 11:64723084-64723106 GGGCGGGGACGCGGCGGGGAGGG - Exonic
1083772944 11:64878524-64878546 GTGCGGAGCCGAGGCGGGGCCGG + Exonic
1083966161 11:66045262-66045284 GGGCGGGGCCCCAGGGGGGCCGG - Intronic
1084028396 11:66466922-66466944 GCGCGGAGCCGCCGCGGGCCGGG + Exonic
1084070068 11:66728165-66728187 GCGCGGAGCCGCGGCCGGGCGGG + Intronic
1084176379 11:67424498-67424520 GAGACGGGCCTCGGTGGGGCTGG - Exonic
1084193342 11:67508872-67508894 GCGCGGGGCCTTGGGGGTGCGGG - Intergenic
1084194708 11:67517867-67517889 GCTGGGGGTGGCGGTGGGGCGGG + Intergenic
1084213406 11:67634162-67634184 GGCCGGGGCCACGGTGGGGACGG - Intronic
1084295763 11:68212956-68212978 GGGCGGGGCTGCGGCCGGGCCGG - Intronic
1084332869 11:68439922-68439944 GGGCGGGGCCGGGGAGGGGCGGG + Intronic
1084385804 11:68841978-68842000 GCCCGGGGCCTCGGCGGGGCGGG + Intronic
1084387733 11:68854744-68854766 GCGCAGGACCGCAGAGGGGCTGG + Intergenic
1084412151 11:69011326-69011348 GCGCGGGGCCGAGGGGAGCCAGG - Intronic
1084951709 11:72670018-72670040 GCCCTGGGCCGTGGTGGAGCAGG - Intronic
1085073691 11:73571885-73571907 GGGCGGTGGGGCGGTGGGGCAGG - Intronic
1085666176 11:78417524-78417546 GCCCGGAGCCGCGGGGGGCCGGG - Intronic
1085724379 11:78941587-78941609 GCGCCGGGGCGGGGTGGGGTTGG + Intronic
1086455446 11:86955426-86955448 TCGCGGCGCGGCGGCGGGGCGGG + Intergenic
1087761745 11:102110376-102110398 AGGCGGGGCCGCGGCGGCGCGGG + Intergenic
1088522263 11:110712465-110712487 GGGCGGGCCCGAGGCGGGGCGGG - Intronic
1088604476 11:111514722-111514744 GGGCGGGGCAGGGGCGGGGCGGG + Intergenic
1088821191 11:113458892-113458914 GCTGGGGGCAGCGATGGGGCAGG + Intronic
1089273330 11:117316063-117316085 GCGCGGGCTCCCGGCGGGGCTGG + Exonic
1089347063 11:117797289-117797311 CCGGGGTGCCGCGGGGGGGCGGG - Intronic
1089533844 11:119149203-119149225 GGGCGGGGCCGGGGCGGGGCAGG - Exonic
1089543564 11:119205989-119206011 GGGCGGGGCCAGGCTGGGGCGGG - Intergenic
1089557230 11:119321170-119321192 GCGCGGGCTCGCGCTGGGTCGGG - Intronic
1090056857 11:123431079-123431101 GCGCGGGGACGCGCTGGGTGTGG - Exonic
1090799240 11:130160204-130160226 GTGCCGGGCCGCGGGCGGGCGGG + Intronic
1091220597 11:133927998-133928020 GGGCGGGGCCGAGGTTGGGGAGG - Intronic
1091286756 11:134412281-134412303 GCTCGGGGCGGGGGCGGGGCGGG - Intergenic
1091328572 11:134712612-134712634 GGGCGGGGCTGCGGAAGGGCGGG - Intergenic
1091616202 12:2052926-2052948 GGGCGCGGGCGCGGCGGGGCTGG + Intronic
1091688993 12:2583141-2583163 GCGCGGCGCCGCTGCGGGCCCGG - Intronic
1091730591 12:2877323-2877345 CCGTGGGGCCGGGGAGGGGCCGG + Intronic
1092108889 12:5945233-5945255 GCGCGCGGCCGCGGGCCGGCGGG - Exonic
1092229994 12:6770846-6770868 GCGCCAGGCCGGGGTGGGGCCGG + Exonic
1092256137 12:6927832-6927854 GCGCGGGGCTGCGGACGGGCTGG - Intronic
1092487435 12:8914636-8914658 GCGGGGAGCCGCGGTCGCGCCGG + Exonic
1092743250 12:11649917-11649939 GCGCGGGGCGGCGGGGGCGTGGG - Exonic
1092861775 12:12725000-12725022 GCGGGCGGCCGCAGAGGGGCTGG - Intergenic
1093435326 12:19129675-19129697 GCGCGGGGGCGCGCCGGGCCGGG + Intergenic
1093958677 12:25250559-25250581 GCGCGCGGACGCGGCGGCGCGGG - Intronic
1094025941 12:25959288-25959310 GCGGGAGCCCGCGGCGGGGCAGG - Intronic
1094293831 12:28881412-28881434 GCGGGGGGCAGCGCAGGGGCCGG - Intergenic
1094536084 12:31324167-31324189 GCGCCGGGCCGGGCTGGCGCGGG - Intronic
1094837574 12:34329326-34329348 GCGCGGGGCTGCGGTGATCCTGG - Intergenic
1096106486 12:48999293-48999315 GTGGGGGGCCGGGGTGGGGTGGG - Exonic
1096242711 12:49967856-49967878 GTCTGGGCCCGCGGTGGGGCCGG - Intronic
1096259327 12:50081202-50081224 GCACGGGGCCACGTGGGGGCGGG + Intronic
1096435874 12:51591009-51591031 CCGCGGGGGCGCGGGCGGGCGGG + Intronic
1096466127 12:51848517-51848539 GTACGGGGCCGCGGGCGGGCCGG - Intergenic
1096466287 12:51848933-51848955 GGGCGGGGGCGAGGTGGGGGAGG - Intergenic
1096647635 12:53047332-53047354 GGGCGGGGGCGCGGCGGGGCGGG - Intronic
1096717448 12:53499791-53499813 GCGCGGGGCCCAGGCGGGCCAGG - Intronic
1096946737 12:55415005-55415027 GCGGGGAGCCGCGGTCGCGCCGG - Intergenic
1097793997 12:63843736-63843758 GCGCGGGGCCGGGCTGCGGTTGG + Intergenic
1100078900 12:90824110-90824132 GCGCGGGTTCCGGGTGGGGCGGG + Intergenic
1100260660 12:92929342-92929364 GCCCGCGGCCGCCGGGGGGCGGG + Intergenic
1100404702 12:94263189-94263211 GGGCGGGGAGGCGGTGGGGGAGG - Intronic
1100444649 12:94649997-94650019 ACGCGGGGCCGCGGGTGGCCGGG + Intronic
1101493949 12:105236119-105236141 GCGCGGGGCCGCCGCGGGCACGG - Intronic
1101606115 12:106248308-106248330 GGACGCGGCCGAGGTGGGGCTGG + Intronic
1101940865 12:109098126-109098148 ACGTGGGGACGCGGTGGGGCGGG + Intronic
1101970720 12:109310084-109310106 GGGCGGGGCAGCGGCGGCGCGGG - Intergenic
1102375715 12:112419290-112419312 GGGTGGGGGCGCGGTGGGGCCGG - Intronic
1102501818 12:113358525-113358547 GGGCGGGGCCGAGGGCGGGCGGG - Intronic
1102789168 12:115629920-115629942 GCGGGGGGCCGGGGAGGGGAGGG - Intergenic
1102884043 12:116508419-116508441 GGGCGGGGCCGTGCAGGGGCTGG + Intergenic
1103010731 12:117456317-117456339 GCAGGGGGCCTCGGTGTGGCAGG + Exonic
1103828182 12:123757031-123757053 GGGCGGGGCAGTGGGGGGGCGGG - Intronic
1103954240 12:124567564-124567586 GCGCGGAGCCGCGGGCAGGCCGG - Intronic
1104355885 12:128086933-128086955 GCAAGGGGCAGCGGCGGGGCGGG + Intergenic
1104623752 12:130337435-130337457 GGGCGGGGCCTGGGTGGGGCTGG + Intergenic
1104697093 12:130872005-130872027 GGGCGGGGCCGGCGCGGGGCGGG - Exonic
1104733292 12:131120940-131120962 GAGCGGGGCTGGGGAGGGGCAGG + Intronic
1104929322 12:132329696-132329718 CCGGGGGGGCGCGGTGGGGGGGG - Intergenic
1104989677 12:132618662-132618684 GGGCGGGGCCGGGGCGAGGCGGG + Intergenic
1105000561 12:132687546-132687568 GCTGCGGGCCGCGGTGGGGCCGG + Intergenic
1107133530 13:36920368-36920390 GCGCGGGCCCGGCGGGGGGCGGG + Intronic
1107605234 13:42049209-42049231 GCGCTGGACCGCGGTGCTGCGGG + Intronic
1112092015 13:96091629-96091651 GCGCGGGGTCGCTCTGGGTCAGG - Intronic
1112652643 13:101416120-101416142 GCGCGGGGGAGGGGTGGGGAGGG - Intronic
1112692812 13:101916338-101916360 GGCCGGGGCCGGGGTGGGCCGGG + Intronic
1112752563 13:102597228-102597250 GCGCGGGGGCGCGGGCGGCCGGG + Intronic
1113082466 13:106534167-106534189 GCGGGAGGCCGAGGTGCGGCGGG + Intronic
1113082873 13:106535728-106535750 GCGCGCGGCCGCGGAGCCGCGGG - Intergenic
1113379219 13:109787022-109787044 GGGCGGGGCCGCGGCTGGGCGGG + Intergenic
1113541970 13:111115808-111115830 GCGCGGAGCGGCGGCGCGGCCGG + Intronic
1113803070 13:113096436-113096458 GAGCGGGGACGTGGTGGAGCTGG + Exonic
1113914873 13:113864097-113864119 GCGCGGGGAGGCGGCGGGGGCGG + Intergenic
1114063034 14:19037657-19037679 GCGCGGGGTGGGGGTGGGGTGGG + Intergenic
1114099225 14:19362338-19362360 GCGCGGGGTGGGGGTGGGGTGGG - Intergenic
1114516169 14:23301623-23301645 GCGCGCGGCGGGGGCGGGGCCGG + Exonic
1115591990 14:34874147-34874169 GCGTGTGGCCGCGGCGGGGAGGG + Intronic
1115592078 14:34874453-34874475 GTGCGGGGCCGCGGGGGGTGTGG - Intronic
1116916779 14:50532728-50532750 GCGCGGTGGCGCGGTCGGGAGGG - Intronic
1116928702 14:50668394-50668416 GCCTGGAGCCGCGGTGGGGGAGG - Intergenic
1117135291 14:52729940-52729962 AGGCGGGGCTGCGGTGGGACAGG - Intergenic
1117875775 14:60249206-60249228 GCGCGGGGCCGCGCTAGAGGCGG + Intronic
1118285259 14:64465367-64465389 GCGCGGGGCGGCGCGGGCGCCGG - Intronic
1119004121 14:70908304-70908326 GCGGGGGGCCCCGGCGGGGACGG - Intronic
1119418697 14:74493506-74493528 GGGCGGGGCGGAGGTGGGTCCGG - Exonic
1119773934 14:77237121-77237143 GGGCGGGGCAGCAGAGGGGCAGG - Intronic
1120730143 14:87992800-87992822 GGGCGGGCCCGCTGCGGGGCTGG - Intronic
1121127593 14:91417924-91417946 GCCCAGGGCCGCCGAGGGGCGGG - Intergenic
1121252158 14:92507268-92507290 GCTGGGTGCCGGGGTGGGGCAGG - Intergenic
1121342933 14:93115862-93115884 GCGCGGGGCGGCGGCGGGCAGGG - Intronic
1121528137 14:94633599-94633621 GCACGGGGGCGGGGCGGGGCGGG - Intergenic
1121645865 14:95516680-95516702 GGGCGGGGCAGGGCTGGGGCGGG + Intronic
1122183299 14:99971331-99971353 GGGCGTGGCCGGGGTGGGGGCGG - Intergenic
1122208390 14:100159683-100159705 GGGCGGGGTCCCGGCGGGGCGGG + Exonic
1122262646 14:100531928-100531950 GTGTGGGGCATCGGTGGGGCCGG - Intergenic
1122418358 14:101560928-101560950 GCCCGCGTCCTCGGTGGGGCGGG + Intergenic
1122470848 14:101964948-101964970 GTGCGGGGCCGCGGAGGGCAGGG + Intronic
1122550144 14:102545049-102545071 GAGCCGGGACGCGGTGGGGAGGG - Intergenic
1122558231 14:102592788-102592810 GCGCGGGGCCGGCGCGGGGCCGG - Exonic
1122621072 14:103057770-103057792 GCGCGGGGTGGGGGTGGGGGGGG + Intergenic
1122688779 14:103522000-103522022 GTGCGGGGCTGCGGGCGGGCCGG - Intronic
1122779706 14:104138519-104138541 GGGCGGGGCCGGGGAAGGGCGGG - Intergenic
1122840772 14:104461617-104461639 GGGCGGGGCGGGGGCGGGGCGGG + Intergenic
1122904549 14:104795765-104795787 GCGCGGGGCGGGCGCGGGGCGGG - Intergenic
1122975011 14:105167528-105167550 GAGCGGGGTCGCGGCGGGGGCGG - Intronic
1122975293 14:105168441-105168463 GCGGGCGGCGGCGGCGGGGCCGG - Exonic
1123053292 14:105557918-105557940 CCGCGGGGCTGCGCTCGGGCTGG + Intergenic
1123077868 14:105678332-105678354 CCGCGGGGCTGCGCTCGGGCTGG + Intergenic
1123505894 15:20941264-20941286 GGGCGGGGCAGCGGTGGGTGCGG + Intergenic
1123563126 15:21514970-21514992 GGGCGGGGCAGCGGTGGGTGCGG + Intergenic
1123599375 15:21952253-21952275 GGGCGGGGCAGCGGTGGGTGCGG + Intergenic
1123671567 15:22664525-22664547 GCGAGGGGCCCGGCTGGGGCTGG + Intergenic
1123787471 15:23687420-23687442 GCGCGGGGCCCCGACGGGGAGGG + Intergenic
1123963996 15:25438217-25438239 GAGCGGGCCCGGGGCGGGGCGGG - Intronic
1124022721 15:25939026-25939048 GGGGGGGGCGGCGGGGGGGCAGG - Intergenic
1124453872 15:29822554-29822576 GGGCGGGGCCGCGGCGGGGGAGG + Intronic
1124696753 15:31870328-31870350 GCGCGGGGACGCGGGGGGCGCGG - Intronic
1124743132 15:32315373-32315395 CCTCGGGGCCGCGCCGGGGCCGG - Intergenic
1126113222 15:45187556-45187578 GCGCGGGGGCGGCGTGGGTCCGG + Intronic
1126406928 15:48331641-48331663 GCGCGGCGCGGCCGAGGGGCGGG - Exonic
1126823748 15:52529261-52529283 GCGCGAGGCGGCGGCGGGGCCGG - Intergenic
1127789891 15:62390444-62390466 GCGCGGCGCCGCGGCCGGACCGG + Intergenic
1128078309 15:64841817-64841839 GGGCGGGGCCGGGGAGGGGGCGG - Intergenic
1128161051 15:65422993-65423015 GCCCGGGCCCGAGCTGGGGCCGG + Exonic
1128999450 15:72320055-72320077 GGGCGGGGCCGGGGCGGGGCGGG + Exonic
1129082336 15:73052234-73052256 GCGCGGAGCCGAGGGGGTGCGGG + Intronic
1129278011 15:74460240-74460262 CTGGGGGGCCGGGGTGGGGCAGG - Intronic
1129468501 15:75737692-75737714 GGGCGGGGGCGGGGTGGGGGTGG + Intergenic
1129503246 15:76059912-76059934 CGGCGGGGCCGCGAGGGGGCGGG + Exonic
1129644827 15:77420188-77420210 GCGCGGGGCCGAGAGGAGGCGGG - Intergenic
1129780141 15:78264595-78264617 GCGCGGGGCGGGGGGCGGGCGGG + Intronic
1130411726 15:83653838-83653860 GCGCGGGGCCGCGGCGACGGCGG - Intergenic
1131061573 15:89407790-89407812 GCCCGCGGCCGCCGTGGAGCTGG - Intergenic
1131517636 15:93089396-93089418 GGGTGGGGCCGCGGCGGGGCGGG - Intergenic
1131828849 15:96341697-96341719 GAGCTGGGGCGCGGTGGGGAGGG + Intergenic
1131977567 15:97961206-97961228 CTGCGGGGCCGGGGAGGGGCTGG + Intronic
1132453226 15:101979896-101979918 GCACGGCGCCGGGCTGGGGCGGG - Intergenic
1202971478 15_KI270727v1_random:242104-242126 GGGCGGGGCAGCGGTGGGTGCGG + Intergenic
1132480578 16:164715-164737 GGGCGGGGCCGCGGGGCGGGCGG + Intronic
1132499895 16:280613-280635 GAGCGGGGCGGCGGCGGGGCGGG + Exonic
1132522462 16:397819-397841 GGGCCGGGCAGCGGCGGGGCCGG - Intronic
1132555322 16:569668-569690 GGGCGGGACCGGGCTGGGGCTGG + Intronic
1132557503 16:579012-579034 GGGCGGGGGCGGGGCGGGGCGGG + Intronic
1132572150 16:648895-648917 GCGGGCGCCCGCGGAGGGGCTGG - Intronic
1132588106 16:715016-715038 GCGCGGGGCGGAGCGGGGGCGGG - Intronic
1132642668 16:984909-984931 GGGCGGGGCCGCCCAGGGGCAGG - Exonic
1132683293 16:1152620-1152642 GCCCGGGTCGGCGGAGGGGCGGG - Intergenic
1132685562 16:1160636-1160658 TCGCGGGGCGGAGGTGGGCCCGG + Intronic
1132741338 16:1414768-1414790 GGGCGGGGCCGCGGGGGGCGTGG - Intergenic
1132741356 16:1414805-1414827 GCGCGGGGCTGGGGCGGGGCCGG - Intergenic
1132757694 16:1493909-1493931 GCGTGGGGCCGCGCTGTGCCCGG + Intronic
1132804983 16:1771240-1771262 GAGCGGGGGCGCGGTGTGGGGGG - Intronic
1132930629 16:2457343-2457365 GCACGGGGCTCTGGTGGGGCTGG - Exonic
1132947125 16:2537941-2537963 GCCCGGCGCCGCGCGGGGGCGGG + Intergenic
1132947131 16:2537951-2537973 GCGCGGGGGCGGGGCGGCGCCGG + Exonic
1133040606 16:3058347-3058369 GCGGCGGGGCGCGCTGGGGCCGG + Intronic
1133042067 16:3066078-3066100 GCCCGGGGCAGGGGTGGGGCAGG + Intronic
1133304863 16:4802497-4802519 GCGCGGGCCAGCGGGCGGGCCGG - Intronic
1133328721 16:4958196-4958218 GGGCGGGGCCAGAGTGGGGCGGG + Intronic
1134121342 16:11586854-11586876 GCGCGGGGACGCCGGGGCGCGGG - Intronic
1134615787 16:15650309-15650331 GCGCGGGGCTGGGGTCGGGGTGG + Intronic
1134696989 16:16232539-16232561 GCTGGCGGCGGCGGTGGGGCGGG + Exonic
1136261809 16:29082336-29082358 ACTCGGGGCCGCGGCGGGCCGGG + Intergenic
1136279499 16:29199685-29199707 CGGCGGGGCCGGGCTGGGGCAGG - Intergenic
1136390616 16:29962068-29962090 GAGCGGGGCCGCGAGGGGGCGGG - Intronic
1136398480 16:30005456-30005478 GGGCGGGGCCGTGGTGGGCATGG - Exonic
1136625323 16:31458760-31458782 GGGCGGGGCGGCGGGGGAGCGGG - Intronic
1136628718 16:31477065-31477087 GGGCGGGGCCTTGGAGGGGCGGG + Intronic
1136628737 16:31477106-31477128 GGGCGGGCCCTCGGGGGGGCGGG + Intronic
1137244692 16:46692869-46692891 GGGCGGGGCGGCGGTGGCGGTGG + Intronic
1137268112 16:46884967-46884989 GCGCTGGGCCCCGGGGAGGCTGG + Intronic
1137988760 16:53131404-53131426 TCCCGGGGCCGGGGTCGGGCGGG + Intronic
1137988770 16:53131424-53131446 GGGCGGGCCCGCGGGGAGGCCGG + Intronic
1138575902 16:57907200-57907222 GAGCAGGGCAGGGGTGGGGCAGG - Intronic
1138591115 16:58000311-58000333 GCGCGGGGGGGCGGCCGGGCCGG + Intronic
1138619259 16:58198228-58198250 GGGCGGGGCCGGGGCGGGGCCGG - Intergenic
1139364862 16:66427117-66427139 GGGCGGGGCTGCGGCAGGGCAGG + Intergenic
1139364902 16:66427238-66427260 GCGCAGGGGCGGGGCGGGGCGGG - Intergenic
1139393555 16:66621881-66621903 GGGCGGGTCCGCGGTGGAGTTGG - Intronic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1139489593 16:67279298-67279320 GCCCGGGGGTGCGGCGGGGCGGG + Exonic
1139528575 16:67530539-67530561 GGGCGGCCCCGGGGTGGGGCGGG + Intronic
1139580531 16:67871009-67871031 GAGCAGGGCCGCGGTGGGAGTGG + Exonic
1139750405 16:69106355-69106377 GCGCGGGGCTGCGCCGAGGCCGG + Intronic
1140223120 16:73058206-73058228 GCGCGGGGCCGGGGAGGAGGGGG + Intronic
1141120279 16:81349186-81349208 GGACGGGGTCGGGGTGGGGCAGG - Intronic
1141464242 16:84195965-84195987 ACGCTGGGCCGTGCTGGGGCTGG + Exonic
1141620501 16:85234734-85234756 GGGCGGAGCCGGGGCGGGGCCGG - Intergenic
1141709412 16:85689164-85689186 GGGCGGGGCCGGGGTGGGGGCGG - Intronic
1141800399 16:86304119-86304141 GTGAGGGGCTGCGCTGGGGCTGG + Intergenic
1141840127 16:86568574-86568596 GCCCGGGGCCGCCGCGGCGCAGG + Exonic
1142083890 16:88165786-88165808 CGGCGGGGCCGGGCTGGGGCAGG - Intergenic
1142103039 16:88285674-88285696 GCTCAGGGCCTCCGTGGGGCCGG + Intergenic
1142147826 16:88499871-88499893 GCATGGGGCCGAGGAGGGGCCGG - Intronic
1142177293 16:88651079-88651101 GGGCGGGGCCTGGGCGGGGCGGG - Exonic
1142221385 16:88856714-88856736 GGGCAGGGCCGGGGTGGGGCGGG - Intronic
1142240686 16:88943474-88943496 AGGAGGGGCTGCGGTGGGGCAGG - Intronic
1142248961 16:88982527-88982549 CCAGGGGGCGGCGGTGGGGCTGG - Intergenic
1142285869 16:89171358-89171380 GGGTGGGGCCGGGGTGGGGCCGG - Intergenic
1142367564 16:89657994-89658016 GCGCGGGCCCAGGGCGGGGCTGG + Intronic
1142419917 16:89963912-89963934 GTGCGGGGATGCGGTGTGGCTGG + Intronic
1142434489 16:90047801-90047823 GGGCGGGGCCGCGGTGAGAAGGG + Intergenic
1142434510 16:90047850-90047872 GGGCGGGGCCGCGGTGAGATGGG + Intergenic
1142434528 16:90047890-90047912 GGGCGGGGCCGCGGTGAGAGGGG + Intergenic
1142509775 17:386111-386133 GCGCGGCTCAGCGGCGGGGCCGG - Intronic
1142611042 17:1109334-1109356 GCGCTGGGCTGCTGTGCGGCGGG - Intronic
1142688592 17:1591710-1591732 CCGCGGGGACGGGGTGGGGGGGG + Intronic
1142704232 17:1684426-1684448 GCGCGGGCCGGAGGCGGGGCGGG - Intronic
1142811944 17:2399640-2399662 GGGCGGGGCCTGGGCGGGGCTGG - Intronic
1142848129 17:2691926-2691948 GGGCGGGGCCGCGGGGGCACGGG - Intronic
1142848140 17:2691948-2691970 GGGCGGGGGCGTGGCGGGGCGGG - Intronic
1142860094 17:2755937-2755959 GCGCGGGGACGCGGGGTGGTGGG - Intergenic
1143202688 17:5123158-5123180 GCGCGGGGGCGTCATGGGGCAGG + Intronic
1143376442 17:6470320-6470342 GGGCAGGGCCACGGTGGGGAAGG + Exonic
1143521542 17:7446972-7446994 GCGCGGGGCCTCGGGGGGCGGGG + Intronic
1143548541 17:7614661-7614683 TGGCAGGGCCGCCGTGGGGCCGG - Exonic
1143597605 17:7924574-7924596 GCCTGGGGCCTTGGTGGGGCAGG - Intronic
1144109970 17:12021361-12021383 GCTCGGGGCTGCGGCGGAGCGGG + Intronic
1144586834 17:16492221-16492243 GAGCCGGGCCGGGGCGGGGCCGG - Intergenic
1144695888 17:17303613-17303635 GCGCGGGGCGGCGGGCGGGCTGG + Exonic
1144784370 17:17823677-17823699 GGGCGGGGCTGGGGCGGGGCTGG - Intronic
1144840483 17:18183030-18183052 GCGTGGGGGCGCGCTGGGGTTGG - Intergenic
1144874519 17:18390458-18390480 GTGAGGGGCAGGGGTGGGGCGGG - Intergenic
1145077509 17:19867855-19867877 GCGCGGGGCCGCGGCGGTGCGGG - Exonic
1145157712 17:20553963-20553985 GTGAGGGGCAGGGGTGGGGCGGG + Intergenic
1145878141 17:28335343-28335365 GCGCGCTGCCGCCGCGGGGCCGG - Exonic
1146058692 17:29593535-29593557 GCCCGGGGCCGCGGGGCGGGGGG - Exonic
1146322630 17:31858906-31858928 CCGCGGGGCCGCGGGGCTGCGGG - Intronic
1146794293 17:35770268-35770290 GCGCTTCGCCGCGGCGGGGCAGG + Exonic
1147178860 17:38672924-38672946 GTGCGGGGCTGTGGTGGGGGTGG - Exonic
1147393131 17:40122219-40122241 GCGGGGGGCCGGGGCGGGGAAGG + Intergenic
1147637262 17:41971809-41971831 GCGCTGGGCCTCGGTGGTCCTGG + Intronic
1147644857 17:42027527-42027549 TGGGGGGGCTGCGGTGGGGCAGG - Intronic
1147742110 17:42675581-42675603 GCTCGGTGCCCGGGTGGGGCGGG - Intronic
1147786261 17:42980690-42980712 GCGCTGGGCCCCAGTGGGGGCGG + Exonic
1147947253 17:44086983-44087005 GGGCGGGGGCGGGGTGGGGGCGG + Intronic
1147989742 17:44325380-44325402 GCGCGCGGCCGGGGCGGGGCTGG - Intergenic
1147998581 17:44374973-44374995 GGGGTGGGCCGTGGTGGGGCGGG - Intronic
1148048831 17:44759439-44759461 GGGCAGGGACGCGGTGGGCCCGG - Intronic
1148061288 17:44838350-44838372 AGGGGGGGCAGCGGTGGGGCAGG - Intergenic
1148080883 17:44967316-44967338 AAGCGGGGCCGCTGTGGGGTGGG + Intronic
1148323722 17:46771754-46771776 GCGCGGCGCGGCGCGGGGGCGGG - Intronic
1148491284 17:48025338-48025360 GGGCGGGGCCGGGGTGGAGCCGG + Intergenic
1148562312 17:48613130-48613152 GCGCGCGGCGGCGGCGCGGCCGG + Exonic
1148591159 17:48817435-48817457 GCGCGGGGCTGCGGTGAGGGAGG + Intergenic
1148722534 17:49764023-49764045 GGGCCGGGGCGCGGAGGGGCCGG - Exonic
1148754364 17:49964926-49964948 GCGCGGGGCCGAGCTCAGGCAGG + Intergenic
1148830296 17:50426505-50426527 GCGGGGGGCGGGGGAGGGGCGGG - Intronic
1148906741 17:50917233-50917255 GCGGGGGGCCAGGGCGGGGCGGG - Intergenic
1149296414 17:55265707-55265729 GCGCGGGGCCGGGGCGCCGCGGG - Intronic
1149849312 17:60025986-60026008 GCGCGGGGGCGTCATGGGGCAGG - Intergenic
1149860856 17:60120538-60120560 GCGCGGGGGCGTCATGGGGCAGG + Intergenic
1149994569 17:61399960-61399982 GCGCGGGGCCGGGCTGGGCCGGG - Exonic
1150228729 17:63538360-63538382 GGACGCGGCCGGGGTGGGGCTGG - Intronic
1150373676 17:64662392-64662414 GGGCGGGGCCGGGGCGGGGCCGG + Intergenic
1150830308 17:68512672-68512694 CCGCCGGGCCGGGGAGGGGCAGG - Intronic
1151537777 17:74748569-74748591 GGGCGGGGCCGCGCTGAGGGTGG - Intergenic
1151570637 17:74923766-74923788 GCGCGGGCCGGCGGCGGGGGCGG + Intergenic
1151939029 17:77281368-77281390 GGGCGGGGCGGGGGCGGGGCCGG + Intronic
1151969718 17:77451378-77451400 GCGCGGGGCAGAGGTAGGGAGGG - Intronic
1152049225 17:77959215-77959237 CCGCGGGGCTCCGGTGGCGCGGG - Intergenic
1152096875 17:78277793-78277815 GGGCGGGGCAGCCGTGGGCCTGG - Intergenic
1152103127 17:78314306-78314328 GCCCGGGGAAGCCGTGGGGCGGG + Intergenic
1152175057 17:78782031-78782053 GCGCGGGGCCCTCGCGGGGCGGG - Intronic
1152396260 17:80035645-80035667 CCGCGGGACCGGGGAGGGGCCGG - Intronic
1152468050 17:80476704-80476726 GCCCGGGCCCGCGGCGCGGCGGG + Intronic
1152635842 17:81430209-81430231 GCTGGGGGGCGCGGTGGGGAGGG - Intronic
1152654407 17:81513165-81513187 GGGCGGGGCCGCGCCGGAGCTGG + Intronic
1152711159 17:81871086-81871108 GGGCGGGGCCGGGGCGGGACCGG - Intronic
1152714377 17:81891462-81891484 GGCCGGGGCCGCGGCCGGGCCGG - Exonic
1152734754 17:81991926-81991948 GAGCGGGGCCCCAGCGGGGCGGG + Intronic
1152748509 17:82051983-82052005 GCGCGGGGGCGCGGAGGCCCGGG - Exonic
1152782204 17:82231416-82231438 CCGCTGGGCGGCGGTGGGGTAGG + Intronic
1152808791 17:82371620-82371642 TCGCGGGGCCGCAGCGGGGTCGG - Intergenic
1152817855 17:82418719-82418741 TCGCGGGACCGCGGCGGCGCAGG + Exonic
1152870632 17:82751573-82751595 GGGCGGGGCGGGGGCGGGGCGGG - Intergenic
1152990141 18:355837-355859 GCGCTGGGCAGAGGTGGGGTGGG - Intronic
1153226947 18:2906839-2906861 CCGCTGGGCCTCGGCGGGGCGGG - Exonic
1153636649 18:7118121-7118143 CTGCAGGGCCGCGGCGGGGCGGG - Intergenic
1153855128 18:9137296-9137318 GCGCGGGGCGGGGCGGGGGCCGG + Intronic
1154156531 18:11948137-11948159 GCTCGCGGCCTCGGTGAGGCTGG - Intergenic
1154270318 18:12912528-12912550 GCGCGGGCCCGCAGAGGGGTCGG - Intronic
1154355198 18:13619506-13619528 GGGTGGGGCCGGGGGGGGGCGGG + Intronic
1156219967 18:35041373-35041395 GGGCGGGGCCGCAGGAGGGCGGG + Exonic
1156350428 18:36297653-36297675 GGGCGGGGCGGGGGCGGGGCCGG - Intergenic
1157496665 18:48161716-48161738 GAGCGGGGCGGGGCTGGGGCGGG - Intronic
1157613775 18:48975495-48975517 GTGCGGGACCGCGATGGGGGAGG - Intergenic
1157736617 18:50055222-50055244 GGGCGGGGGTGAGGTGGGGCAGG - Intronic
1159040669 18:63320356-63320378 GCGCGGGGCCGCGGCCGGGGAGG + Intergenic
1159586590 18:70288824-70288846 GCGCGGGGCGGGGCGGGGGCCGG - Intergenic
1159586883 18:70289679-70289701 GCGCGACCTCGCGGTGGGGCGGG - Intronic
1160204514 18:76822317-76822339 GGGCGCGGGCGCGGTGGGGGCGG - Intergenic
1160540290 18:79617308-79617330 GGGCGGGGTCCCGGGGGGGCGGG - Intergenic
1160540301 18:79617324-79617346 GGGCGGGGTCCCGGGGGGGCGGG - Intergenic
1160540340 18:79617389-79617411 GGGCGGGGTCCCGGGGGGGCGGG - Intergenic
1160571146 18:79818406-79818428 GGGAGGGGCCGCCCTGGGGCTGG - Intergenic
1160582028 18:79888377-79888399 TCATGAGGCCGCGGTGGGGCCGG + Intronic
1160582041 18:79888416-79888438 TCATGAGGCCGCGGTGGGGCCGG + Intronic
1160582054 18:79888455-79888477 TCATGAGGCCGCGGTGGGGCCGG + Intronic
1160582067 18:79888494-79888516 TCATGAGGCCGCGGTGGGGCCGG + Intronic
1160582080 18:79888533-79888555 TCATGAGGCCGCGGTGGGGCTGG + Intronic
1160613871 18:80109483-80109505 GCGCGGGCCCGCGCCGGGCCGGG - Intronic
1160631300 18:80247669-80247691 GCGTGGGGGCGTGGTGTGGCGGG - Intergenic
1160738955 19:677217-677239 GCGCAGGGCTGGGGTGGGGTGGG - Intronic
1160838011 19:1133490-1133512 TCGCGGGGCCCCAGTGGGGCTGG - Intronic
1160877311 19:1302735-1302757 GCGCTGGGCAGGGGCGGGGCGGG - Intergenic
1160909869 19:1469467-1469489 GCGGGGGGCCGCTGCCGGGCCGG - Exonic
1160927947 19:1555993-1556015 GCCCGGCGCAGCAGTGGGGCCGG - Exonic
1160930665 19:1568192-1568214 GGGCGGGGCGGCGGCGGCGCGGG + Intergenic
1160930753 19:1568433-1568455 GCGCGGGGCGGGGCCGGGGCGGG + Intergenic
1160930755 19:1568438-1568460 GGGCGGGGCCGGGGCGGGGCCGG + Intergenic
1160935559 19:1592863-1592885 GCGCGGGGCCCCGCGCGGGCGGG - Intergenic
1160991684 19:1862884-1862906 GGGCGGGGCCTCGGTGGGTGGGG - Intronic
1161027203 19:2042209-2042231 GGGCGGGGCCGCGGCGGGGGAGG - Intronic
1161072348 19:2269269-2269291 GGGCGGGGCTGCCGTGGCGCCGG - Intronic
1161101817 19:2425276-2425298 GCCCGGGGCCGCGGTGGTGCGGG + Intronic
1161114612 19:2489461-2489483 GCCTGGGGCCGCGGTGGCACAGG + Intergenic
1161153429 19:2721029-2721051 GGGGTGGGCCTCGGTGGGGCGGG + Intronic
1161250379 19:3276678-3276700 GGGCGGGGCTGCGGTGGGGTGGG + Intronic
1161304080 19:3557394-3557416 GCCCGGCGCCGCGATGGGCCCGG - Exonic
1161400899 19:4065921-4065943 GCGCGGCGCGGCGCGGGGGCGGG - Intronic
1161401286 19:4067111-4067133 GCGGGGGGGCGCGCCGGGGCGGG - Intergenic
1161450643 19:4343633-4343655 GCGCGGGGCTGCAGGGGCGCGGG + Intronic
1161450713 19:4343878-4343900 GCGGGGGGCTGCGGCGGGCCCGG + Exonic
1161471267 19:4457717-4457739 GCGGGGGGCCGCGGGGGCGGGGG + Exonic
1161505076 19:4639503-4639525 GGCCGGGGCCGGGGCGGGGCGGG - Intronic
1161510941 19:4670520-4670542 GGGCGGGGCCGCCGAGGGGGCGG + Intergenic
1161510950 19:4670537-4670559 GGGCGGGGCCGCCGAGGGGGCGG + Intergenic
1161608756 19:5229464-5229486 GCGGGGGGCCGGGGCGGGGCCGG - Intronic
1161793273 19:6373272-6373294 GGGCGGGGCCACGCTGGGGCGGG + Intronic
1161954053 19:7483108-7483130 GGGCGGGGCTCCGATGGGGCGGG - Intronic
1162060485 19:8091691-8091713 GCCAGGGGCTGCAGTGGGGCTGG + Intronic
1162175374 19:8826238-8826260 GCACGGGGCGGCAGTGGGGCTGG + Intronic
1162320704 19:9969545-9969567 GAGCGGGGCAGGGGTGGGACAGG - Intronic
1162421558 19:10568680-10568702 GCGCCGGGCTGGGGCGGGGCGGG - Exonic
1162508970 19:11105605-11105627 GGGCGGGGCCAGGGTGGGGGCGG + Intronic
1162778678 19:12995697-12995719 GCGCGGGGCCGCGGGCCGGGCGG + Exonic
1162808683 19:13151788-13151810 GGGGGGGGGCGCGGAGGGGCGGG - Intronic
1162935242 19:13978708-13978730 GCGGGGGGCAGCGGGCGGGCGGG - Intronic
1162948581 19:14057644-14057666 GGGCGGGGCGGGGGCGGGGCCGG + Intronic
1162951112 19:14072659-14072681 GGGCGGGGCCAGGGCGGGGCGGG + Intronic
1163012166 19:14433256-14433278 GGGCGGGGCCGAGGGGGGACGGG - Intronic
1163102573 19:15107325-15107347 GCGCGGGGCGGGGGGCGGGCGGG + Intergenic
1163282333 19:16325383-16325405 CCGCGGGGGCGCTGTAGGGCGGG - Exonic
1163316303 19:16542647-16542669 GCGCGGCGCCGCGGAAAGGCTGG + Intronic
1163365092 19:16871401-16871423 GAGCCGGGCCGGGGTGGGGCCGG + Intronic
1163523773 19:17807968-17807990 GCACGGGGCCGGGGCTGGGCGGG - Exonic
1163547295 19:17947972-17947994 GGGCGGGGCCGCGGGGCCGCCGG + Intergenic
1163551182 19:17967176-17967198 GCGCGGGGCCCGGGGGCGGCGGG - Intronic
1163595946 19:18221068-18221090 GGGCGGGGCGGGGGCGGGGCCGG - Intronic
1163607266 19:18281981-18282003 GCGTGGGGCCCCGGCCGGGCGGG + Intergenic
1163635834 19:18436941-18436963 GCCCTGGGCCGGGGTGGGGCGGG - Intronic
1163728057 19:18933521-18933543 GCACTGGGCTGCGGTGGCGCTGG - Intronic
1163807081 19:19405926-19405948 GGGCCGGGCGGCGGAGGGGCCGG - Intronic
1164639104 19:29811885-29811907 CCGCGCGGCCGCTGAGGGGCTGG + Exonic
1164648101 19:29873618-29873640 GCGCGGGGCCGGGTCGGAGCGGG - Intergenic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1164986733 19:32653735-32653757 GGGCGGGGACGGGGTGGGGGTGG + Intronic
1165114714 19:33521927-33521949 GGGCGGAGCCCCGATGGGGCGGG + Intergenic
1165227460 19:34365099-34365121 GCGCGGGTCGGGGGCGGGGCCGG + Intronic
1165242860 19:34481709-34481731 GCGCGAGGCCGCGGCGAGGAGGG + Exonic
1165305420 19:35000250-35000272 GCGCCGTGACGCGGCGGGGCGGG + Intronic
1165331041 19:35141330-35141352 GGGCGGGGCCAGGGAGGGGCGGG - Intronic
1165349729 19:35269173-35269195 GCGCGGGGGCACGGCCGGGCCGG - Intronic
1165859388 19:38899411-38899433 AAGGGTGGCCGCGGTGGGGCGGG - Intronic
1165879251 19:39031433-39031455 GGGCGGGGCCTCGGTGGGAAGGG - Intronic
1165879346 19:39031739-39031761 GGGCAGGGCCGCAGTGGGACCGG - Intronic
1165879360 19:39031777-39031799 GGGCGGGGCCGCACTGGGACCGG - Intronic
1165928661 19:39342597-39342619 GCGCGGGGCGGCGGCGAGTCGGG + Intronic
1165994245 19:39833281-39833303 GCGCGGGGCCCACGGGGGGCTGG + Exonic
1166091579 19:40512797-40512819 GCGGGCGGCGGCGGTGCGGCGGG + Exonic
1166094536 19:40530693-40530715 GGGCGGGGCGGCGCGGGGGCGGG + Intronic
1166329265 19:42069307-42069329 GCGCTGGGTGGTGGTGGGGCTGG + Intronic
1166375158 19:42323856-42323878 GCTGGGGGCGGCGGCGGGGCCGG - Intronic
1166529553 19:43534372-43534394 GCGCGGGGCGGGGGTGACGCCGG - Exonic
1166547057 19:43639910-43639932 GGGCGGGGCCGGGGAGGGGAGGG + Intergenic
1166679306 19:44757476-44757498 GGGCGGGGCCAGTGTGGGGCTGG + Intronic
1166807717 19:45497019-45497041 GGGCGGGGCCGAGGTGGGGAAGG + Exonic
1166809911 19:45508647-45508669 GGGAGGGGCCGTGGTGGGGAAGG - Intronic
1166949398 19:46416535-46416557 GGGCGGGGCCGCGGGAGGCCCGG - Intergenic
1166975089 19:46601223-46601245 GCGCGCGGGCCGGGTGGGGCGGG + Exonic
1167037808 19:47004296-47004318 GGGCGCGGCCGCGGTGCGGTCGG + Exonic
1167072723 19:47230401-47230423 GCACGTGGCGGCGGTGGGGGGGG - Intronic
1167072981 19:47231243-47231265 GGGCGGGGGCGGGGCGGGGCGGG - Intronic
1167080791 19:47274978-47275000 GCGAGGGCCCGCGGGGGCGCTGG + Exonic
1167114271 19:47479968-47479990 GGGCGGGACCGGGGTGGGGTTGG - Intronic
1167251110 19:48398860-48398882 GCGCGCGACCGGGGCGGGGCGGG + Intronic
1167310924 19:48737565-48737587 GGGCGGAGCCGCTGAGGGGCCGG - Intronic
1167358512 19:49017935-49017957 GGGCGGGTCTGGGGTGGGGCTGG + Intergenic
1167377577 19:49119915-49119937 GCGCGAGGCGGCGGTGCGCCCGG - Intronic
1167433120 19:49464546-49464568 GCATGGGGCGGCGGGGGGGCTGG - Intronic
1167633490 19:50639820-50639842 GCGCGGGGCTGCGGCGGCGGCGG - Intronic
1167650099 19:50724296-50724318 GGGCGGGGTGGCGGTGGGGGGGG - Intronic
1167889348 19:52527520-52527542 GGGCGGGGCCGGGGCGGGGCCGG - Intergenic
1167940563 19:52942710-52942732 GGGCGGGGCGGGGGCGGGGCCGG + Intronic
1167991578 19:53365567-53365589 GGGCGGGGCTGGGCTGGGGCGGG - Intergenic
1168110543 19:54189411-54189433 GCGCGGGGGCGCGCTGGGCGGGG - Exonic
1168267725 19:55231559-55231581 GCCCAGGGCCGCGGGTGGGCAGG + Intronic
1168315187 19:55481973-55481995 GCGCGGGCGGGCTGTGGGGCTGG - Exonic
1168408063 19:56120998-56121020 GCGCGCGGCCGGGGTGACGCGGG - Intronic
1202706828 1_KI270713v1_random:30648-30670 GCGAGGGGCGGCAGTGGGGAGGG - Intergenic
924977445 2:191439-191461 GCGGGAGCCCACGGTGGGGCGGG + Intergenic
924987844 2:287950-287972 GCGCGGGGCGGGGGAGGGGAGGG + Intronic
925069617 2:956225-956247 GGGCGGGGCAGGGGTGGGGCAGG - Intronic
925069623 2:956236-956258 GCGCAGGGGCGGGGCGGGGCAGG - Intronic
925607492 2:5673553-5673575 CCGCGCGGCCGTGGAGGGGCAGG - Intergenic
925927199 2:8678974-8678996 GGGCCAGGCCGCGGCGGGGCCGG - Exonic
926035105 2:9630458-9630480 GCGCGGGGCCGGGGCCGGGGCGG + Exonic
926077129 2:9951038-9951060 GCGCGCGGCCGCGGTGGGCCAGG + Intergenic
926422933 2:12716835-12716857 GGGCGGGGGCGGGGCGGGGCCGG + Intergenic
927052919 2:19348077-19348099 GGGCGGGGCCGCAGTGGGCGCGG + Intergenic
927213198 2:20651115-20651137 GGGCGGGGACGCGGTGACGCGGG - Intergenic
927679772 2:25131917-25131939 GCGCGGGGCCGGGCCGGGGCGGG + Intronic
927679775 2:25131922-25131944 GGGCCGGGCCGGGGCGGGGCGGG + Intronic
927713876 2:25341060-25341082 GTGCGGGGCGCCGGCGGGGCCGG - Intronic
927713941 2:25341187-25341209 CCGCGGGGCCGAGGAGGGCCGGG + Intronic
927714135 2:25341675-25341697 GCGCCGGGCGCCCGTGGGGCCGG - Intronic
927787307 2:25982588-25982610 GGGCGGGGCCGCGGGGCGGGAGG + Intronic
927937969 2:27086124-27086146 GCGCGGTGCCGCTGCGGGCCCGG - Exonic
927964972 2:27262833-27262855 CCCCGGGACCGCGGTGGCGCCGG - Exonic
927981499 2:27377672-27377694 GTGCATGGCCACGGTGGGGCAGG - Exonic
927997279 2:27495001-27495023 GCGCGGGGCCGAGCTGCGGGCGG + Exonic
928094260 2:28394143-28394165 ACGCGGGGCAGGGGTGGGGGGGG - Intronic
929033674 2:37671711-37671733 GCGCGGGGACTCACTGGGGCGGG + Exonic
929242508 2:39666462-39666484 GCGCGGGGCCGCGGCTGGGAGGG - Intronic
929777686 2:44938956-44938978 GCGCCAGGACCCGGTGGGGCAGG - Intergenic
929787340 2:45002115-45002137 GCGGGGCGCCGGGGTGGGGGTGG + Intergenic
929788844 2:45009713-45009735 GAGAGGGGCCGGGTTGGGGCCGG + Intergenic
929857856 2:45651285-45651307 GCGCAGCGCGGCGGCGGGGCAGG - Intergenic
929936331 2:46297057-46297079 GCGCAGGGCCGAGGGGCGGCCGG - Intronic
930411234 2:51028274-51028296 GCTCGGGGCTGGGGTGCGGCGGG + Exonic
930701097 2:54457697-54457719 GCCCCGGGCCTGGGTGGGGCCGG - Intronic
930817922 2:55617830-55617852 GCGCGGGGTCGCAATTGGGCGGG + Intronic
930872771 2:56184692-56184714 GGGCGGGGCCGCGGACGAGCCGG - Exonic
931321348 2:61177324-61177346 GCGCGGGGACGCGGGGACGCGGG - Intergenic
931515899 2:63050625-63050647 GCGCGCGACCGGGGCGGGGCGGG + Intronic
931727970 2:65129693-65129715 GCGCGGGGGAGGGGTCGGGCCGG - Intronic
932245198 2:70190872-70190894 GACCGGGGCGGCGGTGGGGCAGG - Intronic
932496694 2:72149076-72149098 GCGGGCGGCCGGGGCGGGGCGGG - Intergenic
932702838 2:74002809-74002831 GCGCGGGGCCGGGGATGGCCGGG + Intronic
932765210 2:74464969-74464991 GTCCGGGGCCACGGCGGGGCTGG + Exonic
932812009 2:74833917-74833939 GCGGGGGGCGGGGGAGGGGCGGG - Intergenic
933666845 2:84971249-84971271 GCGCGGGGCGGGAATGGGGCCGG - Exonic
934079177 2:88452667-88452689 GCTCCGGGCCGGGGTCGGGCGGG + Intergenic
934566978 2:95346603-95346625 GCGCGGGGGCGCGGCGGCGGCGG - Intronic
934993178 2:98935847-98935869 GCACCGGGCGGAGGTGGGGCGGG - Intronic
935746510 2:106194084-106194106 CCCCGGCGCCGCGGTGGGCCGGG - Intronic
935971498 2:108534404-108534426 GCGCGGGGGCGCGGGAGGGGGGG - Intronic
936104688 2:109614289-109614311 GCGCGGGGCGGGGGTGCGGGGGG + Intergenic
937869358 2:126776698-126776720 GGGCGGGGCCAGGGCGGGGCCGG - Intergenic
937869370 2:126776720-126776742 GGGCGGGGCCTGGGCGGGGCTGG - Intergenic
938266950 2:129934493-129934515 GCGCGGGGACTCGGGGGGGGGGG - Intergenic
938460314 2:131492402-131492424 GCTAGGGGGCGCGGCGGGGCGGG - Exonic
938934960 2:136119332-136119354 GCGCGGAGACTGGGTGGGGCGGG + Intergenic
939365968 2:141231606-141231628 GGGCGGGGCAGGGGTGGGGGTGG - Intronic
939612967 2:144332390-144332412 GCGCGGGCCAGCGGGGAGGCGGG - Intronic
939990718 2:148875356-148875378 GCGCTGGGCAGGGGCGGGGCAGG + Exonic
940009518 2:149038941-149038963 TCGCGGGGCCGCGGGGCCGCGGG + Intronic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
940145676 2:150542499-150542521 GCGGGGGGCCGGGGAGAGGCGGG + Intergenic
940145759 2:150542643-150542665 GCGGGGGGGCGGGGAGGGGCGGG + Intergenic
940421010 2:153478921-153478943 GCGCAGCGCGGCGGTGCGGCCGG - Intergenic
941111768 2:161424243-161424265 GGTCCGGGCCGCGGCGGGGCCGG - Exonic
942890273 2:180980310-180980332 TCGCGGGGCCGCTGTGCCGCGGG - Intronic
943571608 2:189581079-189581101 TCGGGGGGCGGCCGTGGGGCTGG + Intronic
945404038 2:209423915-209423937 GTGGGCGGCCGCGGCGGGGCTGG - Intergenic
946306528 2:218859752-218859774 GAGCGGGGCCGAGGCGGGGGCGG - Intergenic
946311200 2:218883537-218883559 GCGCGGGGGCGGGGCGGGGCGGG - Intronic
946311272 2:218883740-218883762 GGCCCGGGCGGCGGTGGGGCGGG - Intronic
946326081 2:218985303-218985325 GCCCCGGGCCGCGCGGGGGCCGG - Exonic
946326156 2:218985578-218985600 GCTGGGGTCCGAGGTGGGGCCGG - Exonic
946410187 2:219511749-219511771 GCGCAGGGCCGGGGTGGGGGTGG + Intergenic
946908991 2:224442386-224442408 GTGGAGGGGCGCGGTGGGGCGGG - Intergenic
947353637 2:229271311-229271333 GCGCGCGGCGGCGGCGGGGGCGG + Intergenic
947602674 2:231464259-231464281 GCGCGGCGCCGCGGGGAGGAGGG - Intronic
947623354 2:231604676-231604698 GGGCCGGGCCGGGCTGGGGCTGG - Intergenic
947722530 2:232378594-232378616 GGGCTGGGCCGGGCTGGGGCTGG - Exonic
947860479 2:233354442-233354464 GGGCGGGGCCGAGGGCGGGCCGG - Intergenic
947860493 2:233354471-233354493 GGGCGGGGGCGGGGCGGGGCCGG - Intergenic
948116037 2:235494634-235494656 GCGCGGGGCGGCGGCGGCGGGGG + Exonic
948272848 2:236687535-236687557 GCTGGGGGCTGCTGTGGGGCTGG - Intergenic
948393299 2:237627496-237627518 ACGCGGGGACGCGGGGGGACGGG - Intergenic
948420896 2:237859517-237859539 GCGGGGAGCCGCAGTGGGCCGGG + Intronic
948473645 2:238203144-238203166 GCGGGGGCCCGCGGTGCCGCCGG + Intronic
948609640 2:239158711-239158733 GGGCGGGTGCGCGGTGGGGCGGG - Intronic
948876584 2:240832765-240832787 GCGCTGCACCGCGGTGGGGTTGG + Intergenic
948893092 2:240916468-240916490 GCGCGGGGGCGCGGGGGCACGGG - Intergenic
948945672 2:241217919-241217941 GGGCGGGGGCGCGCAGGGGCGGG + Intronic
948945774 2:241218126-241218148 GAGCGGGGGCGCGCAGGGGCGGG + Intronic
948988714 2:241541256-241541278 GGGCGGGGCCGCGGCGGGGGCGG + Intergenic
949014601 2:241702237-241702259 GCGCGCGGACGGGGCGGGGCAGG + Intronic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079869 2:242088467-242088489 GCGCGGGGGCGCGGGGGGGCGGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1168769769 20:407975-407997 GGGCGGGGCCGGGGTGGGCCGGG - Intronic
1168769803 20:408026-408048 GGGCGGGGCCGGGGCGGGGCCGG - Intronic
1168804455 20:664223-664245 GCTCGCGGCGGCGGCGGGGCGGG - Exonic
1168819001 20:761121-761143 GTGCGGGGCGGCGGTGCAGCTGG - Exonic
1168869792 20:1118608-1118630 GCCCGGGGACGGGGCGGGGCGGG - Exonic
1168965091 20:1894254-1894276 GCGCGGGGGCGCGGGGGGCGGGG - Exonic
1169139846 20:3221587-3221609 GCGCGTGGCCCCGGAGGTGCTGG + Intronic
1169437925 20:5610430-5610452 GCCGGGGGCCGCTGTGGGGCAGG + Intronic
1170204694 20:13785297-13785319 CCGCGGGGCGGCGGGGCGGCGGG + Intronic
1171013565 20:21521724-21521746 TGGCGGGGCCGCGGTGAGGAAGG - Intergenic
1171452815 20:25247986-25248008 GGGCGGGGCCTCGGGAGGGCGGG - Intergenic
1171810638 20:29742744-29742766 GCGCGGGGCCGCCTTGGTGCTGG - Intergenic
1172389889 20:34559284-34559306 GCGCGAGGCGGGGGCGGGGCAGG - Intronic
1172425402 20:34852272-34852294 GCTGGGGGCCGAGGTGGGGTTGG + Exonic
1172599665 20:36175095-36175117 GGGGCGGGCGGCGGTGGGGCAGG + Intronic
1172604930 20:36207801-36207823 GCGGGGAGCAGCGGTGGGGGCGG - Intronic
1172840797 20:37901893-37901915 GCGGGGGGCGGGGGGGGGGCTGG + Intergenic
1173322387 20:41999411-41999433 GCGCGGGGCCGGGCCGGGACGGG + Intergenic
1173750280 20:45470561-45470583 GGGCGGGGCCGCGCTGGGCTGGG + Intronic
1175210488 20:57350931-57350953 GCGCGGGGGGGCGGGGGGGGCGG + Intergenic
1175833753 20:61980836-61980858 CTGCAAGGCCGCGGTGGGGCGGG + Intronic
1175847104 20:62064998-62065020 GGGCGGGGCGGCGGCGGGGGCGG + Exonic
1175847408 20:62065910-62065932 GCGCGCGGCCGGCGGGGGGCGGG + Intergenic
1175856301 20:62122629-62122651 GCGTCGGGCCGCGGTGGGGAAGG - Exonic
1175859542 20:62143079-62143101 GCGCGGGGCAGCGGCGCGGGCGG - Intronic
1175862114 20:62156150-62156172 GCACGGGGCCGGGATGGGCCGGG - Intronic
1175967322 20:62666097-62666119 GCGGGGGGGCGGGGCGGGGCGGG - Intronic
1176098935 20:63356275-63356297 GGGCAGGGCCAGGGTGGGGCAGG + Intronic
1176128961 20:63488211-63488233 GCGCGGGGCGGGGGCGGGGCGGG + Exonic
1176131835 20:63499538-63499560 GAGCAGGGCCGGGGAGGGGCCGG - Intergenic
1176188224 20:63793172-63793194 GCCCGGGGCCAGTGTGGGGCGGG - Intronic
1178417090 21:32412738-32412760 GCGGGGGGCCGCGGAGCCGCTGG + Exonic
1178673910 21:34614963-34614985 GCTCGGGGCCGCGGCGGAGGCGG - Exonic
1178872112 21:36385583-36385605 GCGCGGGGCCGGGGGTGGACGGG - Intronic
1178948489 21:36966893-36966915 GCGAGGGGCAGCGCTGGGGCGGG + Intronic
1178992284 21:37366400-37366422 GCGCGGGCGCGGGGCGGGGCGGG + Intronic
1178992603 21:37367637-37367659 GGGCGGGGCCGCGGCCGGGCCGG - Intronic
1179437158 21:41369815-41369837 GCGGGGGGCAGGGGTGCGGCGGG - Intronic
1179511844 21:41878889-41878911 GCGCGGGGCCGCGGGGCTGCCGG - Intronic
1179605680 21:42513930-42513952 GCGCGGGGCCGGGGCCGGACCGG + Exonic
1179874689 21:44261950-44261972 CCGCGGGGGCGGGGAGGGGCGGG + Exonic
1179882650 21:44299997-44300019 GGGCGGGCCCGGGGCGGGGCGGG + Intergenic
1179926008 21:44534236-44534258 GGGCGGGGCTGGTGTGGGGCGGG + Intronic
1179976892 21:44873463-44873485 GGGCGGGGCCGCGAAGGGGGCGG - Intronic
1179981230 21:44897025-44897047 GCGCAGGGCAGGGCTGGGGCCGG - Intronic
1180005571 21:45018999-45019021 GGGCGGGGGCCCGGAGGGGCGGG + Intergenic
1180014763 21:45074803-45074825 GCGCGGGGCCGCGGCGGCTCGGG + Intronic
1180064285 21:45405038-45405060 GGGCGGGGCCGGGCAGGGGCCGG - Intergenic
1180098710 21:45574385-45574407 GAGCCGGGCCGGGGTGGGGCAGG - Intergenic
1180481527 22:15760286-15760308 GCGCGGGGTGGGGGTGGGGTGGG + Intergenic
1180874703 22:19169711-19169733 GCGCGGTACCGCGGCCGGGCAGG + Intergenic
1180891467 22:19291832-19291854 GGGCGGGGCAGAGGCGGGGCAGG - Intergenic
1181026822 22:20131725-20131747 GCTGGGGGCCGCGGCGGGGCGGG - Intronic
1181085498 22:20437725-20437747 GCGCAGGGCCCCGGGGGGCCGGG - Exonic
1181085519 22:20437758-20437780 GCGCGGGGCAGGCGCGGGGCGGG + Exonic
1181483862 22:23218477-23218499 GCACGGGGCCACTGTGGGACCGG + Intronic
1181514370 22:23402681-23402703 GCGCGGGCCCGGGCTGGGGCTGG + Intergenic
1181567920 22:23751013-23751035 GGGCGGGGCCGCAGGCGGGCGGG + Exonic
1181571984 22:23772781-23772803 GGGCGGGGCCGAGGCGGGCCGGG + Intronic
1181592715 22:23894947-23894969 ACGCGGAGTCGCGGAGGGGCGGG + Exonic
1181631891 22:24155969-24155991 GCGGCGGGCCGGGGCGGGGCAGG - Intronic
1182123510 22:27801083-27801105 GCGCGGGGACTCCGGGGGGCGGG - Exonic
1182321376 22:29480227-29480249 GCGCGAGGCCGGGACGGGGCGGG - Exonic
1182401291 22:30080029-30080051 GCGCGGGGCGGCGTAGGGGAGGG - Intergenic
1182445562 22:30387417-30387439 GGGCGGGGCCGCGGCCGGACGGG + Intronic
1182520609 22:30882557-30882579 CCGCGGGCCCACTGTGGGGCAGG - Intronic
1183093744 22:35540451-35540473 GCGGGGCGCCGGGGTGGGGCGGG + Intergenic
1183301818 22:37062470-37062492 GGGAGGGGCGGAGGTGGGGCCGG - Intronic
1183444476 22:37844084-37844106 GCGCTGGGCGGCGGCGGCGCGGG - Exonic
1183535623 22:38398929-38398951 GCGCGGGGGCGGGGTGGGGCGGG - Intergenic
1183553225 22:38505688-38505710 CCGCGGGGCTGGGATGGGGCCGG + Intronic
1183744774 22:39686055-39686077 GAGGAGGGCCGCGGTGGCGCGGG + Exonic
1183824040 22:40370879-40370901 GGCCGGGGACGCGGCGGGGCGGG + Intronic
1183856148 22:40636429-40636451 GGGCGAGGCCGCGGTGGGGGAGG + Intronic
1183856330 22:40637257-40637279 GCGACGGGCCTCGGCGGGGCGGG - Intergenic
1183893741 22:40951269-40951291 GCGCGAGGCGGAGGTGGGGGCGG - Intergenic
1183903347 22:41022188-41022210 GCGCGGGGCGGCGGAGGCGCGGG + Intergenic
1183955991 22:41381308-41381330 GTGCGGGGCTGTGGCGGGGCGGG - Intronic
1184086817 22:42270419-42270441 GCGCGGGGTGGGGGTGGGGGTGG + Intronic
1184086832 22:42270464-42270486 GCCCGGGCCGGCGGCGGGGCGGG + Intronic
1184412168 22:44331703-44331725 GCGCGGCGCGGAGCTGGGGCCGG + Intergenic
1184484221 22:44766217-44766239 GCCCGGGGAGGCTGTGGGGCGGG + Intronic
1184523111 22:45007441-45007463 GGGCGGGGGCGCGCGGGGGCGGG + Intronic
1184552640 22:45212633-45212655 ACGTGGGGCAGGGGTGGGGCGGG - Intronic
1184557461 22:45240970-45240992 GGGCGGGGCCGGGGCGGGGAAGG - Intergenic
1184711169 22:46250301-46250323 TGGCCGGGCCGCGGTGGGGCGGG - Exonic
1184766913 22:46576987-46577009 CCGCGGGGCGGGGGCGGGGCCGG + Intronic
1185055189 22:48575645-48575667 GCCCAGGGGCGCGGTGGGCCCGG + Intronic
1185272694 22:49936094-49936116 GCGCGGGGCCGGGGCGGCGGGGG - Intergenic
1185340785 22:50290116-50290138 GGGCGTGGCCACAGTGGGGCTGG - Exonic
1185369713 22:50455449-50455471 GCGTGGGGCTGGGGTGGGCCAGG - Intronic
1185400438 22:50612885-50612907 GGGCGGGGCCGGGCAGGGGCGGG - Intronic
1185403058 22:50628207-50628229 GGGCGGGGCCGGGGGCGGGCCGG + Intergenic
1185413484 22:50697725-50697747 GCGGGGGGGCGCGGGGGGGCGGG + Intergenic
949171301 3:1000411-1000433 ACGCGGGGCGGGGGTGGGGGTGG + Intergenic
950400963 3:12768915-12768937 GGCCGGGGCCGGGGCGGGGCGGG + Intronic
950433967 3:12967664-12967686 GCGGGCGGCGGCGGAGGGGCGGG - Exonic
950578590 3:13847791-13847813 GCCAGGGGCTGGGGTGGGGCGGG + Intronic
950650208 3:14402534-14402556 GGGCGGGGCCGGGGCGGGGCCGG - Intergenic
950683912 3:14603017-14603039 GGGCGGGGCCGGGGCCGGGCTGG - Intergenic
950773589 3:15331915-15331937 CCGCGGTGCCGCGGCCGGGCAGG + Intronic
950821878 3:15768652-15768674 GCGGGGGGCGGCGGTGGGGCAGG + Intronic
950829526 3:15859962-15859984 GCGCGGGGCCGCGGCTCGGGCGG + Intergenic
950902801 3:16512968-16512990 GCGCGCGGCCTGGGTGGGGCAGG - Intronic
951485209 3:23202977-23202999 GCGCGCGGCCGCGAGGGGGCGGG - Intergenic
951543926 3:23806899-23806921 GCGGGGCGCCACGGCGGGGCAGG - Intronic
951566695 3:24018989-24019011 GCCAGGTGCTGCGGTGGGGCAGG + Intergenic
952451875 3:33440413-33440435 GGGCGGGGTCGGGGCGGGGCCGG - Intronic
952867220 3:37862104-37862126 GCGCGGGGGCGCGGCGCGGGGGG - Intronic
952867230 3:37862126-37862148 GCGCGGGGGCGCGGCGCGGGGGG - Intronic
953518821 3:43622079-43622101 GGGCGGGGCCGCGGCGGGAGAGG + Intronic
953627739 3:44584846-44584868 GCGCGGGGCTTCTGAGGGGCGGG + Intronic
954004020 3:47578319-47578341 GGGCGGGGCCGGGGCGGGGCCGG - Intronic
954223033 3:49166124-49166146 GCGCGGGGTGGGGGTGGGGTGGG + Intronic
954224045 3:49171552-49171574 GCGCGGGGCGGGGCTGGGCCAGG - Intergenic
954238739 3:49277086-49277108 GCGGGAGGCAGCGGCGGGGCGGG - Exonic
954238747 3:49277104-49277126 CCTGGGAGCCGCGGTGGGGCGGG - Exonic
954292274 3:49655937-49655959 GCCCGGGCCCGTGCTGGGGCTGG - Exonic
954374154 3:50185408-50185430 GGGCAGGGCCTCAGTGGGGCTGG - Intronic
954409690 3:50365026-50365048 GCGCGGGGCAGAGGGGGAGCGGG + Intronic
954659347 3:52218699-52218721 GAGCTGGGCCAGGGTGGGGCTGG - Intergenic
954702044 3:52455609-52455631 GCGCCGGGCGGCGGTGGCGGCGG + Exonic
954714170 3:52518902-52518924 GCGCAGGGGCGGGGCGGGGCGGG - Intronic
954782950 3:53074006-53074028 CTGCGGGGCCCCGGTGAGGCAGG + Intronic
955356656 3:58237712-58237734 GCGCGGCGCCGGGTCGGGGCGGG + Exonic
956414619 3:69013363-69013385 GCCCGGGGCCGGGGAGGGCCAGG + Intronic
956740328 3:72270772-72270794 GTGCGGGGCAGAGGTGAGGCTGG + Intergenic
956979034 3:74614823-74614845 GCGCAGGGCCGCGCGGGGTCCGG - Intergenic
958453858 3:94306072-94306094 GGGCGGGGTGGCGGGGGGGCGGG + Intergenic
958692149 3:97481682-97481704 GGGCGGGGCCGGGGCGGTGCGGG - Intronic
959398372 3:105869054-105869076 GGGCGGGGCGGGGGCGGGGCCGG + Intronic
960717941 3:120596131-120596153 GTGGGGAGCGGCGGTGGGGCAGG + Intergenic
961300100 3:125916596-125916618 GGGCGGGGCCGCAGTGTTGCCGG - Intergenic
961359407 3:126357535-126357557 GGGCGGGGCCAGGGCGGGGCGGG - Intergenic
961446216 3:126983002-126983024 GGGCGGGGCGGGGGCGGGGCCGG - Intergenic
961599880 3:128052382-128052404 GCGCGGGGCGGGGCCGGGGCCGG - Exonic
961696603 3:128709641-128709663 GCGCGGGGGCGGGGTGTGGCGGG - Intergenic
961735811 3:129001616-129001638 GCGCGGCGCAGCGATGGAGCCGG + Exonic
961754907 3:129121815-129121837 GGGCGGGGGCGGGCTGGGGCGGG - Intronic
961780044 3:129315967-129315989 GCGAGGGGCCGAGGGGGTGCAGG + Exonic
962305767 3:134284458-134284480 GGGTGGGGCGGGGGTGGGGCAGG + Intergenic
962318557 3:134373659-134373681 GCCCGGGCTCGTGGTGGGGCGGG - Intronic
962804195 3:138915554-138915576 GCCAGGGGGCGCTGTGGGGCGGG - Intergenic
963091398 3:141486928-141486950 GGGCGGGGCCGCGGCGGGCGGGG + Intergenic
963133096 3:141876479-141876501 GGGCGGGGCCGGGGCGGGGTGGG + Intronic
964118816 3:153162097-153162119 CCGCGGGGCCGGGAGGGGGCGGG - Intergenic
964606197 3:158562807-158562829 GGGCGGGGTCGGGGTGGGGGCGG - Intergenic
965590706 3:170357921-170357943 GCGCGGGTCCCGGGTGGGGTCGG + Intronic
966182012 3:177197020-177197042 GCGCTGGGCCGCGGGGGGATGGG - Intronic
967976103 3:195035579-195035601 GCGCTGGGGCGCCGTGGGGTGGG - Intergenic
968010531 3:195271198-195271220 GCGCCGGTGCGCGGAGGGGCGGG + Intergenic
968047352 3:195631725-195631747 GCCCGGGGTGGCGGGGGGGCGGG - Intergenic
968063951 3:195747964-195747986 GGGCGGGGCCGGGCTGGGGCGGG - Intronic
968186053 3:196634259-196634281 GTGCGGGGGTGGGGTGGGGCTGG - Intergenic
968307261 3:197658199-197658221 GCCCGGGGTGGCGGGGGGGCGGG + Intergenic
968434127 4:576251-576273 GCGCGGGGTCGCGGCGGCGGCGG - Intergenic
968434172 4:576365-576387 GCGCGGGGCCGCGGGCGGGGTGG - Intergenic
968514910 4:1011843-1011865 GCCCGGGGGCGCGGGGCGGCGGG + Intronic
968514983 4:1012017-1012039 GGGCGGGGGCGGGGAGGGGCGGG + Intronic
968541651 4:1171236-1171258 GCGCGGGGCCGGCCGGGGGCGGG - Intronic
968556438 4:1248493-1248515 CTGCGGGGCCGGGATGGGGCGGG - Intronic
968556556 4:1248861-1248883 GGGCGGGGGCGGGGCGGGGCGGG - Intronic
968578745 4:1379976-1379998 GAGCGTGGCCACGGTGGTGCAGG - Intronic
968625068 4:1623336-1623358 TCCCGGGGCTGCGGTGGGGGTGG - Intronic
968640446 4:1712052-1712074 GTGCGGGGCCGGGGTGTGGGAGG - Intronic
968652293 4:1765018-1765040 GCGGGGGGCTGCTATGGGGCTGG + Intergenic
968660034 4:1795052-1795074 GCGCGGGGGCGCGGGCGGGGCGG - Intronic
968701795 4:2060962-2060984 GCGCGGGTCAGCGGCGCGGCGGG - Intronic
968908370 4:3464620-3464642 GGTCGGGGCCGTGGTGGGGCAGG + Intronic
968930349 4:3575631-3575653 GCGCTGGGCACCTGTGGGGCGGG - Intergenic
968965548 4:3767494-3767516 GCGCCGGGGCGCGTTGCGGCGGG + Exonic
969239204 4:5888197-5888219 GCGCGGGGCGGCGGGGGCGGGGG + Intronic
969240333 4:5893004-5893026 GCCCAGGGCCGCGGGCGGGCAGG - Exonic
969285698 4:6200659-6200681 GGGCGGGGGCGGGGCGGGGCGGG - Intergenic
969295658 4:6269587-6269609 GGGCGGGGCGGGGGCGGGGCCGG + Intergenic
969714399 4:8861299-8861321 ACGCGGGGCCTGGGAGGGGCGGG + Intronic
971294591 4:25377235-25377257 GCGCGCGACAGCGGCGGGGCGGG + Intronic
971351815 4:25862618-25862640 GCGCGGGGCCCCGGGGACGCGGG - Intronic
971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG + Intronic
972396570 4:38663866-38663888 GCGCGGCGCGGCCGTGGGGCTGG - Intergenic
972414311 4:38823826-38823848 GTGCAGGGCCGCTGTGGGGCGGG + Exonic
973532291 4:51844797-51844819 GCGCCCGGCCGCGGTTGGGTTGG + Intronic
973820619 4:54658735-54658757 GCGTGGGGCTGTTGTGGGGCCGG + Intronic
975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG + Intronic
975986050 4:80202423-80202445 GCGGAGGGCGGCGGTGGCGCTGG + Exonic
977607223 4:98995553-98995575 GCGCGGGGCGGGGGCGGGGCCGG + Intergenic
977809712 4:101346096-101346118 GCGCGGGGCGGGGGCGGGGGCGG - Intronic
977908278 4:102501633-102501655 GAGCGGGAGCGCGGCGGGGCCGG - Exonic
978777060 4:112515292-112515314 GCGCGGGGCTGAGGCCGGGCAGG - Exonic
978795712 4:112705900-112705922 ACTCGGGGCCGCGGCGGGCCGGG - Intergenic
979540082 4:121870667-121870689 GCCCTGGGCCGCGGTGAGGGTGG - Intergenic
980913756 4:139015951-139015973 GCGAGGGGCCGTGGTGGCGGCGG + Exonic
980990492 4:139735062-139735084 GGCGGGGGCCGCGGAGGGGCGGG - Intronic
981550542 4:145937557-145937579 GCGCCGGGGCGCGGGGCGGCCGG - Intronic
981713563 4:147732026-147732048 GCGCGGGGGCCGGGCGGGGCGGG + Intergenic
984715038 4:182917388-182917410 AGGCGGGGCCGCCGCGGGGCCGG + Intronic
984928381 4:184826092-184826114 GGGCGGGGCCGCGGGAGGGCGGG - Intronic
985537569 5:473587-473609 GCGGGGGGACGTGGCGGGGCCGG - Intronic
985577318 5:679383-679405 GGGCTGGGCCGCGTGGGGGCAGG + Intronic
985580896 5:694544-694566 GCGCGGGACCACCGTGGGGTGGG - Intergenic
985595521 5:785876-785898 GCGCGGGACCACCGTGGGGTGGG - Intergenic
985616573 5:926606-926628 GCGAGGGGCCCAGGAGGGGCGGG - Intergenic
986330621 5:6713928-6713950 GGGCGGGGCCGCGTCGGGGCGGG + Intergenic
986449490 5:7850759-7850781 GCGGGCGGCCGCGGAGGGGCGGG - Intronic
986608616 5:9546162-9546184 GGGCGGGGCAGGGGCGGGGCGGG - Intergenic
987035159 5:14011846-14011868 GCGCCGCGCCGCGCTGGGGGCGG - Intergenic
987373993 5:17217756-17217778 GCGCGGTGCCGCCGAGAGGCCGG - Exonic
989103441 5:37840094-37840116 GCGCGGGGCCCCGGGAGGGAGGG + Intergenic
990042313 5:51389577-51389599 GCGCGCGACCGCGGGCGGGCCGG + Intronic
990165471 5:52989217-52989239 CCGCAGGGCCGGGGTGGGGCGGG + Intergenic
990499684 5:56383903-56383925 GGGCGGGGCCGCGGGGGTGGGGG - Intergenic
994197415 5:96935879-96935901 GGGCGGGGCCTAGGCGGGGCCGG - Exonic
994202415 5:96992776-96992798 AAGCGGGGCGGGGGTGGGGCGGG + Intronic
995787081 5:115841865-115841887 GGGCGGGGCCTGGGCGGGGCAGG - Exonic
996738306 5:126777066-126777088 GCGGGGGGCGGAGGTGGCGCGGG - Intronic
997265169 5:132490981-132491003 GGGCGGGCCCGCGGTGGCCCCGG - Intergenic
997377627 5:133408574-133408596 GAGCGGGGGCGGGGTGGGGTAGG + Intronic
997521385 5:134526340-134526362 GCGAGGGGGCGCGGGCGGGCGGG + Intronic
998166671 5:139848284-139848306 GCGCGCGGCCGCGGCGGCGGCGG + Exonic
998184666 5:139968955-139968977 GCGCGGGTCCGCGTTCAGGCAGG + Intronic
999294895 5:150453055-150453077 GCGCAGGGGTGCGGTGGGGTGGG - Intergenic
999300378 5:150486598-150486620 GCGCGGGGCCGGGGGCAGGCTGG + Intronic
1001495975 5:172188043-172188065 GGCCGGGGGCGCGGTGGCGCCGG + Exonic
1001773418 5:174312027-174312049 GCGCGGGGGCGCGGGGGCTCGGG + Intergenic
1002021228 5:176365602-176365624 GGGCGGCGCCGCGGCGGTGCTGG + Exonic
1002021858 5:176368686-176368708 GCGGGGGCCCGGGGTGGGGTGGG + Intronic
1002021876 5:176368724-176368746 GCGGGGGCCCGGGGTGGGGTGGG + Intronic
1002093517 5:176817939-176817961 GCGGGCGGCCGCGGGCGGGCTGG - Intronic
1002170326 5:177371060-177371082 GGGCGGGGCCGGGCCGGGGCCGG + Intronic
1002180961 5:177431000-177431022 GCGAGGGGCCCTGCTGGGGCCGG + Intronic
1002280304 5:178125831-178125853 GCCAGGGGCTGGGGTGGGGCGGG - Exonic
1002497070 5:179622959-179622981 GCGGGCGGCCGGGCTGGGGCGGG - Intronic
1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG + Intronic
1003178510 6:3771872-3771894 GCGGGAGCCCGCGGCGGGGCGGG - Intergenic
1003290677 6:4776282-4776304 GGGCGGGGCGGCGGCGGGGCGGG - Intronic
1003427457 6:6007241-6007263 GCGCAGGGAGGCGGCGGGGCTGG - Intronic
1003569661 6:7247619-7247641 GCCCCAGGCCGCTGTGGGGCAGG + Intronic
1003911491 6:10747768-10747790 CCCCGGGGCCGCGGCAGGGCGGG - Exonic
1004193999 6:13487769-13487791 GGGCGGGGCCGGGGAGGAGCCGG - Intergenic
1006369219 6:33633823-33633845 GCGCGGGGCGGGCGCGGGGCGGG + Intronic
1006414061 6:33893048-33893070 GAGAGGGGCCGGGGCGGGGCCGG + Intergenic
1006642453 6:35496381-35496403 GCGCGGTGCCGCGGCTGCGCTGG - Intronic
1006677956 6:35777289-35777311 CTGAGGGGCCGGGGTGGGGCTGG + Intronic
1006694727 6:35921157-35921179 TCGTGGGGCGGGGGTGGGGCGGG - Exonic
1006717527 6:36130256-36130278 GCGCGGGCCAGCGGCGGGGCTGG - Intronic
1007478310 6:42133820-42133842 GGGCGGGGGCGGGGCGGGGCGGG + Intronic
1007479026 6:42137813-42137835 GGGCGGGGGCGGGGCGGGGCGGG + Intronic
1007479858 6:42142663-42142685 GAGCTGGGCGGCGGCGGGGCGGG - Intergenic
1007625383 6:43243620-43243642 CCCCGGGGCCGGGGCGGGGCGGG - Intergenic
1008109507 6:47477702-47477724 GCGACGGGGCGGGGTGGGGCGGG + Intergenic
1010032911 6:71288897-71288919 GCGCGGGGCTGCGGGGCTGCGGG - Exonic
1010083066 6:71886626-71886648 GCGCGGGGCGGGGGCGGGGCTGG - Intergenic
1010428285 6:75749580-75749602 GCCCTGGGCAGCAGTGGGGCCGG + Intronic
1011448958 6:87472949-87472971 GCGCGGGGGCGCGGAGGGGGCGG + Intronic
1012410123 6:98947635-98947657 GCGCGGGGGCGCGGGGCCGCGGG + Intronic
1012410127 6:98947643-98947665 GCGCGGGGCCGCGGGCGGGGAGG + Intronic
1012476697 6:99621513-99621535 GCAGGGGGCAGAGGTGGGGCTGG + Intergenic
1014137592 6:117907393-117907415 GCGCGGGGGCGCGGAGCTGCCGG - Intergenic
1015786101 6:136922571-136922593 GCTCAGCGCCGCGGTGGAGCTGG - Exonic
1015910053 6:138161388-138161410 GCGGTGGGCTGCGGTGGGGCTGG - Intergenic
1016328223 6:142927001-142927023 GCGCGGCGGCGCGGCGGCGCGGG + Intronic
1016340913 6:143060806-143060828 GCGCGGGCGCGGGGCGGGGCGGG - Intronic
1016778864 6:147936435-147936457 GCGAGGGGCAGTGGTGGGGGAGG + Intergenic
1017002409 6:150005397-150005419 CCGCGGGGCCGAGGTGGAGGGGG - Intergenic
1017717508 6:157222898-157222920 GCTCGGAGCTGGGGTGGGGCTGG + Intergenic
1018020895 6:159761823-159761845 GCGCGGGGCGGAAGTGAGGCCGG - Exonic
1018020907 6:159761854-159761876 GCGCGGGGCGGAAGTGAGGCCGG - Exonic
1018400064 6:163413790-163413812 CTGCGGGGCGGAGGTGGGGCGGG - Intergenic
1018400615 6:163415546-163415568 GCGCGGGGTCCCGGCCGGGCAGG - Intronic
1018613268 6:165662818-165662840 TCCCCGGGCCGCGGAGGGGCAGG + Intronic
1018876699 6:167827381-167827403 GCCGGGGCCCGCGGTGGGCCTGG - Intronic
1019028597 6:168991901-168991923 ACACGGGGCCGCTGTGGGCCTGG + Intergenic
1019190674 6:170249037-170249059 CCTGGGGGCCGGGGTGGGGCTGG - Intergenic
1019202845 6:170333151-170333173 GGGCGGGGGGGCGGTGGGGTGGG - Intronic
1019437153 7:1028179-1028201 CCGCGGGGCGGGGCTGGGGCAGG + Intronic
1019443524 7:1059491-1059513 GGGCGGGTCCGTAGTGGGGCGGG + Intronic
1019473410 7:1232992-1233014 GCGCGGGGGGCCGGCGGGGCCGG - Exonic
1019486102 7:1290053-1290075 GGCGGGGGGCGCGGTGGGGCTGG - Intergenic
1019491583 7:1316270-1316292 GGGGGGGCACGCGGTGGGGCTGG + Intergenic
1019938218 7:4269984-4270006 AGGAGGGGCCGGGGTGGGGCCGG + Intergenic
1020006292 7:4785248-4785270 GCGAGGGGCCCAGGTGGGACAGG - Intronic
1020204746 7:6105461-6105483 GCGGGGGGCGGCGGGCGGGCCGG - Intronic
1020256055 7:6503714-6503736 GGGCGGGGCCGGAGCGGGGCCGG + Intronic
1020274381 7:6615709-6615731 GGGCCGGGCCGCGCGGGGGCCGG - Exonic
1020278333 7:6637573-6637595 CCGCGGGGAGGCGGCGGGGCCGG + Intronic
1020283656 7:6664142-6664164 GCCTGGGGCGGAGGTGGGGCGGG + Intergenic
1020756604 7:12211292-12211314 GCGCGCGGCCGCCGTAGAGCTGG - Exonic
1021558538 7:21945853-21945875 GCGCCGGGCCGTGGTGAGTCCGG - Exonic
1021814366 7:24432989-24433011 GCACGGCGCCGCGAGGGGGCGGG + Intergenic
1021845304 7:24757460-24757482 GCGCTGGGCCGGCGGGGGGCGGG + Intronic
1021868390 7:24980255-24980277 GGGCGGGGCCCCGAGGGGGCGGG + Intronic
1021998363 7:26201701-26201723 GCGCGGGGCCGCCGGGGGGAGGG - Intronic
1022018619 7:26376819-26376841 GCGAGCGGACGCGGTGGGGCCGG + Intergenic
1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG + Intergenic
1023177636 7:37448773-37448795 GCGTGGGGCCGCGGCGGCGTGGG + Exonic
1023773585 7:43582978-43583000 GCGCGGGGCGGACGTGGGGAGGG + Intronic
1023881836 7:44325256-44325278 GCGCGGGCCCGCAGTGCGCCTGG + Intronic
1024612696 7:51081084-51081106 GCGCGGGGCAGGAGCGGGGCAGG + Intronic
1024965459 7:55019425-55019447 GCGCCGGTGCGCGGTTGGGCGGG - Intronic
1025211169 7:57020329-57020351 GAGCGGGGCTGGGGCGGGGCAGG - Intergenic
1025261633 7:57424437-57424459 GCGCGGCCCCGTGGCGGGGCCGG - Intergenic
1025660786 7:63556518-63556540 GAGCGGGGCTGGGGCGGGGCAGG + Intergenic
1025850506 7:65239786-65239808 GCGCGAGGGCGGGGCGGGGCGGG + Intergenic
1025916786 7:65872966-65872988 GGGCGGGGCAGGGGTGGGGAGGG - Intergenic
1026979549 7:74518339-74518361 GCCCGGGGCTGGGCTGGGGCTGG + Intronic
1027774093 7:82443598-82443620 GCGCGGAGCCGCGCGGGGGACGG + Exonic
1028985652 7:97006511-97006533 GCGCGGGGCCGCCTGGGGGAGGG - Intronic
1029068129 7:97872506-97872528 GGGCGGGGCCGCGGGGTGTCCGG + Exonic
1029098416 7:98107283-98107305 GAGCGGGCCCGCGGCGGGGACGG + Intronic
1029110553 7:98211372-98211394 GGGCGGGGCCGGGGCGGGGCCGG - Intergenic
1029238828 7:99144142-99144164 GCGCGGGGGCGCGCAGGGCCGGG - Intergenic
1029436853 7:100568489-100568511 GGGCGGGGGGGCCGTGGGGCGGG - Intergenic
1029708333 7:102286817-102286839 GGGCGGGGGCGGGGCGGGGCCGG + Intronic
1030033463 7:105388976-105388998 GGGCGGGGCGGGGGCGGGGCCGG - Intronic
1030330826 7:108268605-108268627 GAGCGGGGCGGGGGTGGGGGTGG + Intronic
1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG + Intergenic
1031317294 7:120273423-120273445 GTGCGGGGCTGCGGGGCGGCGGG - Intergenic
1032068904 7:128791860-128791882 GCGCGGGGCGAGGGTGGGGTGGG + Intronic
1032525707 7:132577099-132577121 GCGCGGGGCTGCGGCGGTGGTGG + Exonic
1033230790 7:139595897-139595919 GCGCTGGGCCTGGGAGGGGCAGG + Intronic
1033253240 7:139777929-139777951 GAGCGGATCCGCGGAGGGGCGGG + Intronic
1033281566 7:140009841-140009863 GTGTGGGGCGGCTGTGGGGCGGG - Intronic
1033281593 7:140009923-140009945 GTGCGGGGCAGGTGTGGGGCAGG - Intronic
1033281601 7:140009945-140009967 GTGCGGGGCAGGTGTGGGGCAGG - Intronic
1033299848 7:140176435-140176457 GCGAGGGGACGCGGCCGGGCGGG - Intronic
1034228031 7:149497851-149497873 GGGCGGGGCCGCGGGCAGGCGGG - Intergenic
1034418723 7:150978182-150978204 GCGCGGGGACGCGGCGGAGCGGG - Exonic
1034440491 7:151083376-151083398 GCCCAGGGCCCCGGTCGGGCCGG - Intronic
1034440516 7:151083446-151083468 CCGAGGGGCCGCGATGGAGCTGG - Intronic
1034659902 7:152759950-152759972 GAGCGGGGCCGCGGAGGAGCGGG - Intronic
1034976865 7:155454082-155454104 GCGGGGAGCAGGGGTGGGGCGGG - Intergenic
1035021687 7:155804277-155804299 GCGTGGGCCTGCGGAGGGGCGGG + Intronic
1035153401 7:156893211-156893233 GGGCGGGGCGGGGGCGGGGCAGG + Exonic
1035167597 7:157000586-157000608 GGGCGGGGGCGGGGTGGGGGAGG + Intronic
1035404254 7:158587829-158587851 GGGCGGGGCCGGGGCGGGGCCGG - Intergenic
1035573344 8:688289-688311 GGGCGGGGCGGCGGAAGGGCCGG - Intronic
1035724025 8:1813728-1813750 GAGTGGGGCCCGGGTGGGGCGGG - Intergenic
1035747927 8:1974606-1974628 GAGCCGCGGCGCGGTGGGGCGGG - Intronic
1036454189 8:8893375-8893397 GCGCGGCGCCTCGGGGGGCCCGG + Exonic
1036643165 8:10596649-10596671 GCACAGGGCCGGGGTGGGGAGGG - Intergenic
1036910569 8:12754671-12754693 GCGCGGGGATGCGGCGGGGCCGG - Intronic
1037765362 8:21769239-21769261 GGGCGGGGCTGGGGCGGGGCTGG - Intronic
1037825304 8:22156829-22156851 GCGCGGGGCGGCGCGGGGCCTGG + Exonic
1038304170 8:26383643-26383665 GCGCGGGAGCGGGGCGGGGCGGG + Intronic
1038540502 8:28386333-28386355 GTGCGGGGGCGCGGAGGCGCGGG - Intronic
1038726059 8:30083255-30083277 GCGTGGCGCCGCGGTGTGGGCGG + Intergenic
1038734403 8:30156268-30156290 GGGCGGAGCCGGGGTGGGGCGGG - Intronic
1039212698 8:35235365-35235387 GGGCGGGGCCGCGGGAGGGGCGG - Intergenic
1039518456 8:38152088-38152110 GCGGGGGGGCGGGGGGGGGCGGG + Intergenic
1039549535 8:38432895-38432917 GGGGGGGGGCGCGGTGGGGAGGG - Intronic
1039592007 8:38757243-38757265 GGGCGGGGAGGCGGTGGGGCGGG - Intronic
1039618285 8:38974395-38974417 GCGCGGGGCAGCGCGTGGGCTGG - Exonic
1040038880 8:42896880-42896902 GGGCGGGGACGCGGGGCGGCGGG + Intronic
1040415212 8:47189100-47189122 GCGCGGGGCGGAGGTCGGGTGGG + Intergenic
1041281079 8:56211540-56211562 GCTGGGGGGCGCGGTGGGGCGGG + Intergenic
1041552600 8:59118800-59118822 TGGCCGGGCCGCGGCGGGGCCGG - Intronic
1041919875 8:63169089-63169111 GCGCGGTGCCGCGGCGGGTGGGG + Intronic
1043954227 8:86342698-86342720 GCGCGTGGACGGGGTGGGGGTGG + Intergenic
1045277636 8:100721854-100721876 CTGCGGGGCCGCGGGCGGGCGGG + Exonic
1045663970 8:104466631-104466653 GGGCGGGGGCGCGGCGGGGCGGG + Intronic
1045847815 8:106658142-106658164 GCGCCGGGGGCCGGTGGGGCGGG - Intronic
1047495032 8:125403259-125403281 GCGGGGGGCGGCAGTGGGGTGGG + Intergenic
1047998628 8:130358744-130358766 GAGCGGGGGCGGGGCGGGGCGGG - Intronic
1048570852 8:135654722-135654744 GGGCTGGCCCGTGGTGGGGCAGG + Intronic
1048886516 8:138914072-138914094 GCGCGGGGCTGGGGAGGAGCTGG + Intergenic
1049162064 8:141103925-141103947 CCGCGGGGCCTCGGGGAGGCCGG + Intergenic
1049249572 8:141580968-141580990 ACACAGAGCCGCGGTGGGGCTGG + Intergenic
1049380977 8:142315612-142315634 GCACGGAGCCGGGGTGGGGCTGG + Intronic
1049380986 8:142315639-142315661 GCACGGAGCCGGGGTGGGGCTGG + Intronic
1049621066 8:143598548-143598570 GGGCCGGGGCGCGGTCGGGCAGG - Exonic
1049639359 8:143707631-143707653 GCCCGCGGCCGGGGTGAGGCGGG - Intronic
1049671103 8:143870268-143870290 GCGCAGGGGTGTGGTGGGGCCGG - Exonic
1049671201 8:143870664-143870686 GCGCGAGGTCACGCTGGGGCAGG - Exonic
1049693680 8:143973567-143973589 GGGCGGGGCGGGGGCGGGGCGGG - Intronic
1049752315 8:144291198-144291220 GCACGTGGCCGCGCTGGGGCGGG - Intronic
1049756578 8:144313683-144313705 GCGCGGGGAGGCGGGGAGGCGGG - Intronic
1049766662 8:144358272-144358294 GCGCGGGGCCGGGCGGGGCCGGG + Exonic
1049896135 9:113529-113551 GCGCGGGGCGGCGCGGGGCCCGG + Intergenic
1051170627 9:14315513-14315535 GGGCGGGGCCGCGGCGCGCCCGG + Intronic
1051665644 9:19464972-19464994 GCGCAGGGCTGCGGCGGGGGCGG + Intergenic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1053163531 9:35829424-35829446 GCCCGGGGCGGGGGCGGGGCCGG - Intronic
1053230100 9:36400901-36400923 GCGGCGGGGCGCGGCGGGGCGGG - Intronic
1053230146 9:36401065-36401087 GCGAGGGGACGGGGTGGGACGGG - Intronic
1055301410 9:74887179-74887201 GGGCGGCGCCGCGTTGGGGAAGG + Intronic
1055447142 9:76394545-76394567 GGGCGGGGCCATGATGGGGCGGG - Intergenic
1055447148 9:76394561-76394583 GGGCGAGGCAGCGGCGGGGCGGG - Intergenic
1057298092 9:93860973-93860995 GGGCGGGGCCGCTGGGGGGCAGG + Intergenic
1057337434 9:94166612-94166634 CCGCGTGGCCGCCGCGGGGCCGG + Intergenic
1057432163 9:95004731-95004753 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057432187 9:95004783-95004805 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057488542 9:95505855-95505877 GCGCGGGGCTGCGGAGGCGGCGG - Intronic
1057547260 9:96027609-96027631 GCGCTGGGCGGCGGCGGCGCCGG - Intergenic
1057665184 9:97039187-97039209 GCGCGGGAAGGCGGTGGGGGCGG - Intronic
1057773098 9:97984228-97984250 GCGCGGAGCGGGGGAGGGGCGGG + Intronic
1057773347 9:97985069-97985091 GCGCCGGTCCGCGGCGGGGGGGG - Intronic
1057781921 9:98056989-98057011 GGGCGGGGCCGCGGGGAGCCAGG + Intronic
1057832687 9:98419095-98419117 GCCCGGGGGGGCGGTGGAGCAGG + Intronic
1058058769 9:100473984-100474006 GTGTGGGGAGGCGGTGGGGCCGG + Intronic
1058412493 9:104748389-104748411 GCCCAGGGTCCCGGTGGGGCTGG + Intronic
1058778151 9:108305843-108305865 GGGCGGGGTCGGGGGGGGGCGGG - Intergenic
1059102534 9:111484051-111484073 GCGCGGCGGCGCGGTTAGGCCGG - Exonic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1059230678 9:112718307-112718329 GCCCGGGGCGGGGGAGGGGCGGG + Intergenic
1059309116 9:113376593-113376615 GCCGGGGGGCGGGGTGGGGCGGG - Intronic
1059320263 9:113463585-113463607 GAGCTGGGCCGGGGTGGGGGAGG - Intronic
1060106526 9:120876585-120876607 GCGCGGGGCCGGGCGGGGGCAGG + Intronic
1060147907 9:121268113-121268135 GCGCGCGGCCGGGGTGGGCAGGG - Intronic
1060485125 9:124041604-124041626 GGGTGGGGCTGCGGTGGGGCTGG + Intergenic
1060514566 9:124257896-124257918 GCGCGGCCCCGCGGCGGGGAGGG + Intronic
1060544832 9:124453683-124453705 GGGTGGGGCCGGGGCGGGGCGGG - Intronic
1061050493 9:128191894-128191916 GCGCGGGGCTGCGGTGAGAGGGG + Intronic
1061084918 9:128393113-128393135 GCGCGGGGCTGGGCGGGGGCGGG - Intergenic
1061128218 9:128689759-128689781 GCGGGGGGGCGCGGCGCGGCCGG + Intronic
1061293597 9:129665841-129665863 GCGAGCGGCCCCGGGGGGGCCGG - Exonic
1061348215 9:130043283-130043305 GGGCCGGGCCGGGGTGGGGCGGG - Intergenic
1061472159 9:130835313-130835335 GCGCGGGGCGGCGGTGAGGGCGG + Intronic
1061799046 9:133104232-133104254 GCCCAAGGCCGCGGAGGGGCAGG - Intronic
1061961926 9:133992847-133992869 GGGCGGGGCAGGGGCGGGGCCGG + Intergenic
1062022580 9:134326397-134326419 GCGCGCGGCGGCGGGGGCGCGGG + Intronic
1062022726 9:134326844-134326866 TCGCGGGGCCGGGGCGGGGCTGG + Intronic
1062110751 9:134780879-134780901 GCGTGAGGCCACGGTGGGGAGGG - Intronic
1062162469 9:135087829-135087851 GCGCGGGGCGGCGGCGGCGGCGG + Exonic
1062230616 9:135479837-135479859 GCGCGGGGAGGCGGGGAGGCGGG + Exonic
1062341423 9:136095325-136095347 GGGCGGGGCGGCGGCGGGGGAGG + Intergenic
1062377158 9:136267336-136267358 GGGCGGGGCTACGGCGGGGCGGG + Intergenic
1062479494 9:136744788-136744810 GGGAGGGGCCGGGGAGGGGCTGG + Intronic
1062483521 9:136763254-136763276 GCGCGGGGCGGCAGGCGGGCGGG + Intronic
1062489963 9:136800228-136800250 GGGCGGGGCCACCGGGGGGCGGG + Intronic
1062547572 9:137070504-137070526 GCGCGGCCCCACGGAGGGGCCGG + Exonic
1062562524 9:137147976-137147998 GCTGGGGGCCGGGGTGGAGCTGG - Intronic
1062584188 9:137241595-137241617 GCGCGGGGCGGGGGAGGGGCGGG + Intronic
1062627405 9:137449540-137449562 CTGCGGGGCCACGGTGGGGTGGG - Intronic
1186084537 X:5972758-5972780 GGGCGGGGGCGGGGTGGGGGCGG + Intronic
1186466218 X:9786319-9786341 GGGCGGGGCCGACGGGGGGCGGG - Intergenic
1187507276 X:19887771-19887793 GGGCGGGGCCGGAGAGGGGCGGG + Intergenic
1187507289 X:19887799-19887821 GGCCGGGGCCGCGTCGGGGCAGG + Intergenic
1187518199 X:19991086-19991108 GGGCGGGGCCGGGGTGGGGGCGG - Intergenic
1188242642 X:27809480-27809502 GGGCGGGGCGGGGGGGGGGCCGG - Intronic
1189002790 X:36963740-36963762 GCCCGCGGCGGAGGTGGGGCCGG - Intergenic
1189252775 X:39614018-39614040 GCGGGGGGGAGCGGGGGGGCGGG - Intergenic
1189310627 X:40014932-40014954 GCGCGGGGCGGGGGCGGGGGCGG - Intergenic
1189717618 X:43882165-43882187 GCGGGGGGCGGCCGTGGGGCAGG - Intronic
1190008130 X:46759169-46759191 GCCCGGGGCCGCGCGGGGGAGGG + Intronic
1190114826 X:47619619-47619641 GCACCGGGCGGCGGTGGGGGCGG + Exonic
1190984410 X:55488503-55488525 GCCCTGGGCCGCGGTGCGGGTGG + Exonic
1192630953 X:72777481-72777503 GCGGGGGGCGGCGGGGGCGCGGG - Intronic
1192650756 X:72943320-72943342 GCGGGGGGCGGCGGGGGCGCGGG + Intronic
1193601231 X:83509949-83509971 ACGTGGGGGCGGGGTGGGGCGGG + Intergenic
1194977731 X:100410392-100410414 GCGGGGGGTAGCGGGGGGGCGGG + Intergenic
1195269484 X:103215598-103215620 GGGCGGGGCGGGGGAGGGGCCGG + Intronic
1195285291 X:103377113-103377135 GCGAGGGACGGTGGTGGGGCGGG + Intronic
1195701688 X:107710564-107710586 GGGCGGGGCCGGGGGGGGGGCGG - Intergenic
1196819661 X:119692858-119692880 GCGGGGGGCGGCAGGGGGGCAGG - Intronic
1197655147 X:129108658-129108680 GCGCGGCGGGGCGGTGGGGTGGG + Intergenic
1198215289 X:134549712-134549734 GAGCGGGGCCACCGGGGGGCGGG - Intergenic
1198438117 X:136636574-136636596 GGGCGGGGCAGCGGTTGGGTGGG + Intergenic
1198750570 X:139933095-139933117 GGGAGGGGCCTGGGTGGGGCGGG - Intronic
1199771141 X:150976081-150976103 GAGCAGGGACGCGGTGGCGCTGG + Intergenic
1199942155 X:152637683-152637705 GGGCGGGGCCGGGCTGGGGGAGG - Intergenic
1199976529 X:152897888-152897910 GGGCGGGGCCGAGAAGGGGCGGG + Intergenic
1200061198 X:153484564-153484586 GGGTGGGGCCGCAGTGGGGAGGG + Intronic
1200117672 X:153776485-153776507 GGGCGGGGCTGGGGCGGGGCAGG + Intronic
1200117725 X:153776599-153776621 GGGCGGGGCTGGGGTGGGGAGGG + Intronic
1200217529 X:154374674-154374696 GCGCGGGGCGGGCGCGGGGCGGG - Intergenic
1200231115 X:154444382-154444404 GCGCGGGGCCGCCGGGGACCTGG - Intronic
1200240502 X:154490670-154490692 GGGAGGGGCTTCGGTGGGGCGGG - Exonic
1201867837 Y:18673570-18673592 GCGCGGGGGTGGGGGGGGGCAGG - Intergenic