ID: 1069764284

View in Genome Browser
Species Human (GRCh38)
Location 10:70841613-70841635
Sequence AGGAAGAGGGAGCCTTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 1, 1: 0, 2: 9, 3: 74, 4: 602}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069764284_1069764299 25 Left 1069764284 10:70841613-70841635 CCCCCCAAAGGCTCCCTCTTCCT 0: 1
1: 0
2: 9
3: 74
4: 602
Right 1069764299 10:70841661-70841683 TTCAACATATGAATTTTTGGGGG 0: 28
1: 372
2: 1349
3: 2634
4: 3546
1069764284_1069764291 -5 Left 1069764284 10:70841613-70841635 CCCCCCAAAGGCTCCCTCTTCCT 0: 1
1: 0
2: 9
3: 74
4: 602
Right 1069764291 10:70841631-70841653 TTCCTCCTACCATCAGCTTGAGG No data
1069764284_1069764298 24 Left 1069764284 10:70841613-70841635 CCCCCCAAAGGCTCCCTCTTCCT 0: 1
1: 0
2: 9
3: 74
4: 602
Right 1069764298 10:70841660-70841682 TTTCAACATATGAATTTTTGGGG 0: 28
1: 444
2: 1606
3: 3278
4: 4796
1069764284_1069764292 -4 Left 1069764284 10:70841613-70841635 CCCCCCAAAGGCTCCCTCTTCCT 0: 1
1: 0
2: 9
3: 74
4: 602
Right 1069764292 10:70841632-70841654 TCCTCCTACCATCAGCTTGAGGG No data
1069764284_1069764296 22 Left 1069764284 10:70841613-70841635 CCCCCCAAAGGCTCCCTCTTCCT 0: 1
1: 0
2: 9
3: 74
4: 602
Right 1069764296 10:70841658-70841680 GATTTCAACATATGAATTTTTGG 0: 182
1: 925
2: 2225
3: 3438
4: 4626
1069764284_1069764297 23 Left 1069764284 10:70841613-70841635 CCCCCCAAAGGCTCCCTCTTCCT 0: 1
1: 0
2: 9
3: 74
4: 602
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069764284 Original CRISPR AGGAAGAGGGAGCCTTTGGG GGG (reversed) Intronic
900490889 1:2948616-2948638 GGGAAGAGGGAACCCTGGGGAGG + Intergenic
900592683 1:3467037-3467059 TGGGAGAGGGAGGCTTTGGGAGG - Intronic
900605739 1:3522842-3522864 TGGAAGAGGCAGCTCTTGGGGGG - Intronic
900736901 1:4304882-4304904 AAGAAGAGGAAGCCGTGGGGTGG - Intergenic
900960774 1:5917899-5917921 AGGAAGGGGAGGCCTTGGGGAGG - Intronic
901291377 1:8126827-8126849 AGGAGGTGGGGGCCTTTGGGAGG + Intergenic
901397258 1:8990254-8990276 AGGAAGAGGGAGCCATACTGGGG + Intergenic
901770845 1:11529650-11529672 ACGAAGAAGAAGCCTTTGGTAGG - Exonic
902565954 1:17311505-17311527 AAGAAGAAGGAGACTTTGGGAGG - Intronic
903082794 1:20825169-20825191 AGAAAGTGGGAGCCTTATGGAGG - Exonic
903163152 1:21503477-21503499 AGGGAGAGGGAGACCGTGGGGGG + Intergenic
903336473 1:22627693-22627715 ATGATGTGGGAGCCATTGGGGGG + Intergenic
903874856 1:26466886-26466908 AGTAAGAGAGAGCCTTAGAGAGG + Intronic
904133214 1:28290680-28290702 AGGAAGATGGATCCTCTGGGTGG - Intergenic
904420855 1:30390281-30390303 AGGGAGAGGGAGCATTGGGGAGG + Intergenic
904677789 1:32208971-32208993 AGGCAGAGGGAGACTGTGGCAGG - Intergenic
904745619 1:32708977-32708999 AGACAGAGGGACCCCTTGGGTGG - Intergenic
905137844 1:35813817-35813839 AAGAAGAGAGACACTTTGGGAGG + Intronic
905397387 1:37675587-37675609 GATAACAGGGAGCCTTTGGGAGG + Intergenic
905460720 1:38121231-38121253 AGGCAGTGGGGGCCCTTGGGAGG + Intergenic
906625696 1:47323562-47323584 AAGTAGCTGGAGCCTTTGGGAGG + Intergenic
906672419 1:47666043-47666065 AGGAAGAGGGAGTGTCTGGAGGG - Intergenic
907039882 1:51249466-51249488 GGCAGGAGGGAGCCTTTTGGGGG - Intronic
907350650 1:53827613-53827635 TGGAAGAGGTAGCATTTGGTTGG - Intronic
907477048 1:54712787-54712809 AGGAGGTGGGGGCCTTTGAGAGG + Intronic
907703281 1:56810522-56810544 AGAAAAAGGTAGCCTCTGGGAGG - Intronic
907964928 1:59319757-59319779 AGGCAGAGGGAGCCTGTGGAGGG + Intronic
907999970 1:59670209-59670231 AGGAAGAGGGCAGCTTTGGCTGG - Intronic
908238877 1:62172470-62172492 AGGAAGAGAGTGAGTTTGGGAGG - Intergenic
908345306 1:63226396-63226418 AGGAAGTGGGGGCCTTTGGGAGG + Intergenic
908462210 1:64356821-64356843 AGGAAGAGGGAGCGTTCCTGGGG + Intergenic
908846388 1:68328784-68328806 AGGAAGTGGGGGCCTTAGGGAGG + Intergenic
909095039 1:71275937-71275959 AAGAACAAGGAACCTTTGGGAGG - Intergenic
910049270 1:82956879-82956901 GGAAAGAAGGAGCATTTGGGAGG - Intergenic
910456969 1:87408151-87408173 TGGGAGGTGGAGCCTTTGGGAGG - Intergenic
911271521 1:95807507-95807529 TGGAACAGGCTGCCTTTGGGGGG - Intergenic
912704912 1:111904629-111904651 AGGATGAGGGAGGCTGGGGGAGG - Intronic
912823515 1:112885796-112885818 AGGAACAGGGAGACTGTGGGTGG + Intergenic
913138840 1:115919700-115919722 AGGAACTGGGGGCCCTTGGGAGG - Intergenic
913219283 1:116646326-116646348 AGGAAGATGGAGAATTGGGGGGG + Intronic
914418695 1:147508632-147508654 AGCAAGAGGGACCATTGGGGTGG - Intergenic
915354421 1:155247647-155247669 AGGGAAAGGGACACTTTGGGGGG + Exonic
915758972 1:158291792-158291814 GTGAAGGGGGAGCCTTTGTGAGG - Intronic
915914308 1:159931830-159931852 AGGAGGAGGGTCCCCTTGGGCGG + Exonic
916376601 1:164161330-164161352 AGGATGTGGGACCATTTGGGAGG - Intergenic
916636842 1:166680041-166680063 AGGAGGAGGGAGGGATTGGGAGG - Intergenic
916984971 1:170181459-170181481 AGGAAGAGGTAGGATGTGGGAGG - Intergenic
918133055 1:181645924-181645946 AGGAAATGGGAGCCTAGGGGAGG + Intronic
918365015 1:183798478-183798500 AGGAAGGAGGAAGCTTTGGGAGG - Intronic
918985585 1:191621371-191621393 AGGAAGTGGGACCTTTTGAGAGG + Intergenic
919234585 1:194824327-194824349 AGTAATAGGTAGCCTTTAGGAGG + Intergenic
920068693 1:203287401-203287423 AGGAGGAGGGAGCCTGTGGGCGG + Intergenic
920274805 1:204796182-204796204 ATGGAGAGGGACCCTTTGAGAGG - Intergenic
920813144 1:209305727-209305749 AGGAGGAGGGAGCCTTTAGCTGG - Intergenic
921148076 1:212378151-212378173 GGGAAGAGGGTTCCTTGGGGAGG + Intronic
922118820 1:222642156-222642178 GGGAATAAGGAGACTTTGGGAGG + Intronic
922349154 1:224721783-224721805 ATGAAGAGGGGGCCTGTGGAAGG + Intronic
922490147 1:226009823-226009845 TAGGAGAGGCAGCCTTTGGGAGG - Intergenic
922778331 1:228228091-228228113 ATTAAGAGGGGGCCTTTGGGAGG + Intronic
922814485 1:228439019-228439041 AGGAGGGGGCATCCTTTGGGTGG - Intergenic
922873349 1:228920635-228920657 TAGAAGAGGGAGGCTTTCGGAGG - Intergenic
922964177 1:229674270-229674292 GGGGAGAGGGAGGCTGTGGGCGG - Intergenic
923024781 1:230195778-230195800 AGGAGGAGGGAGCGCTGGGGAGG + Intronic
923344074 1:233034233-233034255 AAGAAGTTGGGGCCTTTGGGAGG + Intronic
923944313 1:238865213-238865235 AGGAAAAGGCAGCATTTGAGAGG + Intergenic
924274276 1:242369604-242369626 AGGAAGAGAGAGGTTTTGTGAGG + Intronic
1062898866 10:1126473-1126495 GGAAAGAGGGATCCTCTGGGGGG - Intronic
1063503080 10:6572121-6572143 AGGAAGAGGGAGCGATGGGAAGG - Intronic
1063666397 10:8063202-8063224 AGGAAAAGGGAAGGTTTGGGAGG - Intronic
1063670428 10:8095583-8095605 AGGATGGTGGAGCCCTTGGGTGG + Intergenic
1065178097 10:23097887-23097909 AGAGAGAGGGAGACATTGGGAGG + Intronic
1065933147 10:30496930-30496952 TTGAAGATGGGGCCTTTGGGAGG + Intergenic
1066597276 10:37064768-37064790 AAGAAGAGAGAGTCTCTGGGAGG + Intergenic
1067131918 10:43573364-43573386 AGGAAAAGGCAGGCTTTGAGAGG + Intronic
1067458763 10:46441804-46441826 AGGCAGAGGGAGCCTTTAGTGGG - Intergenic
1067628431 10:47942832-47942854 AGGCAGAGGGAGCCTTTAGTGGG + Intergenic
1067733606 10:48831934-48831956 AAGAAGTGGGACCTTTTGGGAGG - Intronic
1068501527 10:57844846-57844868 AGAAAGAAGGAGCCTTCGAGGGG - Intergenic
1068863698 10:61872257-61872279 AGGAGGTGGGGGCTTTTGGGAGG - Intergenic
1068945865 10:62728248-62728270 TAGAAGAGGGGGCCTTTGGGAGG - Intergenic
1069764284 10:70841613-70841635 AGGAAGAGGGAGCCTTTGGGGGG - Intronic
1070249678 10:74763216-74763238 AAGAAGATGGAGTCTTTGGGAGG - Intergenic
1070660832 10:78304206-78304228 ATGGGGAGGGGGCCTTTGGGTGG - Intergenic
1070668182 10:78359987-78360009 AGCAGGAGGGAGCCTGGGGGCGG + Intergenic
1070743594 10:78919150-78919172 AAGGAGAGGGAGGCTCTGGGAGG - Intergenic
1071600019 10:86954471-86954493 AGGGAGAGGGAGCCTGTGGGAGG + Intronic
1072572836 10:96673501-96673523 AGAAAGAGGAAGCCTTTCGGGGG - Intronic
1073038819 10:100584751-100584773 AGGAAGTGGGAGCCCTGTGGTGG - Intergenic
1073324655 10:102635203-102635225 AGGACGAGGGAAACTTTGAGGGG + Intergenic
1073455628 10:103635284-103635306 AGGAAGCAGGATCTTTTGGGAGG + Intronic
1073577667 10:104639786-104639808 AGGAAGAAGGAGACTTCAGGTGG - Intergenic
1074351574 10:112742645-112742667 AGGAAAATGCAGCCTTTGGTTGG + Intronic
1074845517 10:117393999-117394021 GAGGAGAGGGAGCCTATGGGTGG - Intergenic
1074873828 10:117598738-117598760 AGGAAGAGGGAGTCTTTTGGAGG + Intergenic
1075007067 10:118838954-118838976 TTGGAGAAGGAGCCTTTGGGTGG - Intergenic
1075222352 10:120596168-120596190 AAGAGGTGGGGGCCTTTGGGAGG - Intergenic
1075309672 10:121403092-121403114 AGGAGGGTGGGGCCTTTGGGAGG - Intergenic
1075428603 10:122362463-122362485 AGGAAGAGGGAGTCTGGAGGTGG - Intergenic
1076626573 10:131824688-131824710 AGGAGGAGGGAGCCTGAGGAGGG + Intergenic
1076657620 10:132035551-132035573 AGGGAGTGGGTGCCTTTGGAGGG - Intergenic
1076746584 10:132517660-132517682 AGGAAGAAGGGGCGTGTGGGTGG - Intergenic
1076800457 10:132825426-132825448 GGGCAGGAGGAGCCTTTGGGAGG + Intronic
1077480586 11:2812686-2812708 GGGAAGAGGGAGGCCATGGGGGG - Intronic
1077538556 11:3135812-3135834 AGGAAGTGGGAGCCATGAGGAGG - Intronic
1077677396 11:4207133-4207155 AGGATTTGGGAGGCTTTGGGAGG + Intergenic
1077932346 11:6746751-6746773 TAGAAGATGGAGCTTTTGGGAGG - Intergenic
1078183071 11:9028705-9028727 AGGAAGGGGGAGCCATGGGGCGG + Intronic
1078230335 11:9435791-9435813 AGGAAGAGGCAGCCTGTTGAGGG - Intronic
1078390590 11:10932218-10932240 AGGAGGAGGCAGCCTTGTGGAGG + Intergenic
1079626755 11:22625589-22625611 GGCAAGAGGGCGGCTTTGGGCGG - Exonic
1079723040 11:23843491-23843513 AGGAAGAGGGGCCTTGTGGGAGG - Intergenic
1079956972 11:26878310-26878332 AGGAGGAGGGACCTTGTGGGAGG - Intergenic
1080114020 11:28601683-28601705 AGGAAGTGGGGGCCTTGGGGAGG - Intergenic
1081042527 11:38229259-38229281 AGGAAGTGGGACCTTTTAGGAGG + Intergenic
1081370426 11:42293896-42293918 AACAACAGGGAGCTTTTGGGTGG - Intergenic
1081788987 11:45769425-45769447 AGGAAGATGGTGCCCTCGGGGGG + Intergenic
1082288105 11:50338402-50338424 TAGGAGATGGAGCCTTTGGGAGG + Intergenic
1082706044 11:56496547-56496569 AGGAAGAGGGAGACCGTGGAGGG - Intergenic
1083398379 11:62406830-62406852 AGGAAGAGGGAGTCTTTTCCTGG + Intronic
1083702166 11:64486746-64486768 AGGAACAGGAAGTCATTGGGAGG - Intergenic
1083719642 11:64598025-64598047 AGGAAGATGCAGCCATGGGGTGG + Intronic
1083803963 11:65062803-65062825 AGGAAGAGGAAGCCTGAGGGAGG - Intergenic
1084236452 11:67790935-67790957 TTGAAGAGGGAGCCTTAAGGGGG - Intergenic
1084381905 11:68817950-68817972 AGGCAGAGGCAGCCGGTGGGAGG + Intronic
1084484317 11:69439057-69439079 GGGGAGATGGAGCCTTGGGGTGG - Intergenic
1084700496 11:70783679-70783701 AGGCAGAGGGGGCGTCTGGGTGG + Intronic
1084709410 11:70834867-70834889 AGGGAGAGAGACCCTGTGGGAGG - Intronic
1084710446 11:70840699-70840721 AGGAAGTGGGAGCCTGGGGAGGG + Intronic
1084851282 11:71943037-71943059 AGGTGGAGGGAACCTTTAGGAGG - Intronic
1085050569 11:73377956-73377978 AGGACCAGGAAGCCTTTGGGTGG - Intronic
1085892331 11:80595772-80595794 AAGAAGAGAGAGTCTCTGGGAGG - Intergenic
1087702193 11:101447848-101447870 TTGAAGATGGGGCCTTTGGGAGG + Intergenic
1087711267 11:101555377-101555399 AGGAAAAGGAAGCCTTTTGGTGG - Intronic
1088580653 11:111312573-111312595 AGGAGGAGGGAGCCATGAGGGGG - Intergenic
1088915212 11:114222486-114222508 AGGACGAGGGATCCTTTGTCCGG + Intronic
1089420552 11:118330188-118330210 AAGAAGGTGGAGGCTTTGGGAGG - Intergenic
1089731961 11:120524866-120524888 AGGAAGAGGTCGCCTTTGTGTGG + Intronic
1089751384 11:120653824-120653846 AGGAAGAGGCAGGCTCTGAGGGG + Intronic
1089780416 11:120869740-120869762 AGGAAGAGGGGGCCTGGGGAGGG + Intronic
1089969095 11:122678134-122678156 TTGAAGATGGGGCCTTTGGGAGG - Intronic
1090661665 11:128886610-128886632 AGGAAGAAAGAGCCTTGGGACGG - Intergenic
1091868214 12:3861288-3861310 ATGAAAATGGGGCCTTTGGGAGG + Intronic
1092292147 12:7166898-7166920 TAGAAGGTGGAGCCTTTGGGAGG - Intergenic
1094536487 12:31326090-31326112 AGGAGGAGGGAGCGCTTGAGGGG - Exonic
1095241183 12:39860673-39860695 AGGAGGAAGGAGTCTTTGGTTGG - Intronic
1096522734 12:52193305-52193327 AGGAAGAGAGAGCCCCTGAGCGG + Intergenic
1096573997 12:52541275-52541297 TGCAAGAGGGAGCCTGGGGGCGG - Intergenic
1096660514 12:53121221-53121243 AGGCAGAGGGAGCAGTGGGGAGG + Intronic
1096671271 12:53199572-53199594 TTGGAGATGGAGCCTTTGGGAGG + Intronic
1097186032 12:57196955-57196977 AGGCACAGGGAGCCTTGGGCTGG - Intronic
1097533842 12:60839815-60839837 GGGAGGTGGGAGCCTATGGGAGG + Intergenic
1097897493 12:64840194-64840216 AGCAAGAGGTAGCTATTGGGGGG - Intronic
1099810857 12:87580435-87580457 TTGAAGATGGGGCCTTTGGGAGG - Intergenic
1100499547 12:95160613-95160635 AGGAACATGGAGACTATGGGTGG - Intronic
1102187766 12:110963179-110963201 AGGAAGAGGGAGCCCAGGGCAGG - Intergenic
1102196457 12:111028882-111028904 AGGAAGAGGGAGCAGTTGCTGGG + Intergenic
1102561835 12:113767675-113767697 TGGAAGAGGCAGCCTATGAGTGG - Intergenic
1102781967 12:115573206-115573228 CGGGAGAGGGAGCCTGCGGGAGG - Intergenic
1102929050 12:116848770-116848792 AGGAACAGGGAGGGCTTGGGCGG - Intronic
1103137227 12:118518153-118518175 AGCAAGAGGGGGCCTCTTGGAGG - Intergenic
1104064819 12:125297795-125297817 ATGAAGGGGGAGCCCTGGGGTGG + Intronic
1104217441 12:126748029-126748051 TGGAAGAACGAGCCTTGGGGCGG - Intergenic
1105957712 13:25300333-25300355 TTGGAGATGGAGCCTTTGGGAGG - Intergenic
1106091407 13:26598521-26598543 AGGAAGAGCAAGCCTTTTGCCGG - Intronic
1106387468 13:29302012-29302034 TGGAAGGTGGGGCCTTTGGGAGG - Intronic
1106457990 13:29944303-29944325 AGGGAGAGGGTGCCCTTGGCTGG + Intergenic
1106679889 13:31999017-31999039 TGTCAGATGGAGCCTTTGGGAGG - Intergenic
1106930674 13:34660776-34660798 AGGAGGTGGGACCTTTTGGGAGG - Intergenic
1107315701 13:39129338-39129360 AGGCAGAGGGAGCGTTTGGGAGG + Intergenic
1107806458 13:44158130-44158152 AGGGAAAGGGAGGCTTTGAGAGG - Intronic
1108108710 13:47043795-47043817 AGGAATAGGGACCTGTTGGGTGG - Intergenic
1108421340 13:50252848-50252870 AGGAAGAGAGAGCTTTGAGGAGG + Intronic
1109227785 13:59717468-59717490 AGGAAGAGTGGGCTGTTGGGTGG - Intronic
1109314081 13:60729285-60729307 AGGAAGTGGGTGCCTCTGTGTGG - Intergenic
1109478109 13:62911607-62911629 TAGAAGATGGAACCTTTGGGAGG - Intergenic
1109687572 13:65841999-65842021 TGGAGGATGGGGCCTTTGGGAGG + Intergenic
1110734258 13:78916725-78916747 ATGAAGAGGTGGCCTTTGGGAGG - Intergenic
1111563101 13:89978329-89978351 TAGAAGGTGGAGCCTTTGGGAGG + Intergenic
1112487249 13:99831080-99831102 AGGAAGAGGCAGGGGTTGGGTGG + Intronic
1113601976 13:111575958-111575980 TTGAAGATGGGGCCTTTGGGAGG - Intergenic
1114197722 14:20493793-20493815 AGGAAGAGTGAGCCCTAGGGAGG - Intergenic
1114491458 14:23104773-23104795 AGGAAGAGCGAGATTTTGAGGGG + Intergenic
1114643878 14:24242667-24242689 GGTAAGAGGGAGCCAATGGGCGG + Exonic
1115479687 14:33849323-33849345 AGGATGTGGGAACCCTTGGGAGG + Intergenic
1116868363 14:50049508-50049530 AGGAAGAGGGAGGCTGGGGAAGG - Intergenic
1117192271 14:53304858-53304880 AGAGAGAGGGTGCCTTTGGGAGG - Intergenic
1118309441 14:64681855-64681877 AGGAAGAGGGAGGCTGGGGGAGG + Intergenic
1118857790 14:69637520-69637542 AGAAAGAGAGAGCCTTAGGCAGG - Intronic
1119422486 14:74515854-74515876 ACCAAGAGGGAGGCATTGGGAGG + Intronic
1119558267 14:75569835-75569857 AGCAAAGGGGAGCCGTTGGGAGG - Intergenic
1119938583 14:78616362-78616384 AGTACGAGTTAGCCTTTGGGAGG - Intronic
1120290466 14:82563640-82563662 AGGAAGAGGGAGACAGCGGGAGG + Intergenic
1120443008 14:84562321-84562343 AGGAAGTGGGATCCTTAAGGTGG + Intergenic
1120443271 14:84564161-84564183 AGGAAGTGGGATCCTTAAGGTGG + Intergenic
1121006424 14:90493445-90493467 AGGAGGTGGGAGCCTTGGGGAGG + Intergenic
1121044709 14:90779176-90779198 AGGAAGAGGGACACTTTGAATGG - Intronic
1121156218 14:91687331-91687353 AGGGAGGTGGGGCCTTTGGGAGG + Intronic
1123012788 14:105357392-105357414 AGGGCGAGGGAGCCTTGGGGTGG - Intronic
1123450860 15:20358145-20358167 AGGAAGGGAGAGGCTCTGGGAGG - Intergenic
1123672247 15:22670896-22670918 TTGAAGATGGGGCCTTTGGGAGG - Intergenic
1124179272 15:27457390-27457412 AGGAACAGGTAGCCTTTGGATGG - Intronic
1124324294 15:28744187-28744209 TTGAAGATGGGGCCTTTGGGAGG - Intergenic
1124528179 15:30477228-30477250 TTGAAGATGGGGCCTTTGGGAGG - Intergenic
1124555292 15:30719529-30719551 AGGAAGAGGGAGACGCAGGGAGG - Intronic
1124770478 15:32530476-32530498 TTGAAGATGGGGCCTTTGGGAGG + Intergenic
1124818221 15:33018124-33018146 TAGGAGATGGAGCCTTTGGGAGG + Intronic
1125416652 15:39460881-39460903 AGAGAGAGAGAGCCTTTGTGGGG - Intergenic
1125493039 15:40162699-40162721 AGAAAGAGGAAGACTGTGGGAGG + Intronic
1125610158 15:40964198-40964220 AGGACGGGGGAGCCCATGGGTGG + Intergenic
1126044423 15:44625491-44625513 AGGAAGAGAGAGCAGTGGGGAGG - Intronic
1126227652 15:46289861-46289883 GGGAAGAGGGAGGGTGTGGGTGG + Intergenic
1126349439 15:47729412-47729434 AGGAACAAGGAGCATTTTGGGGG + Intronic
1126667701 15:51090116-51090138 AGGAAGAGGCAGCGTCTGTGGGG + Intronic
1126675560 15:51156969-51156991 TTGGAGATGGAGCCTTTGGGAGG + Intergenic
1127542087 15:59950896-59950918 AGACAGTGGGAGGCTTTGGGAGG + Intergenic
1127542331 15:59952995-59953017 AGGAGGTGGGACCTTTTGGGGGG - Intergenic
1128669428 15:69563386-69563408 AGGAAGTTGGTGTCTTTGGGAGG + Intergenic
1128860750 15:71069694-71069716 AGGAGGTAGGGGCCTTTGGGGGG - Intergenic
1129132773 15:73515542-73515564 TGGAAGTGGGGGCCTTTGGGAGG + Intronic
1129323445 15:74787289-74787311 AGGGAGAGGCTGGCTTTGGGTGG + Intronic
1130078484 15:80710377-80710399 AGGAAATGGGAGCCATTGGAGGG + Intronic
1130098838 15:80876570-80876592 AGGCAGAGGGAGCCTAGAGGAGG + Intronic
1130309257 15:82738721-82738743 ATGAAGATGAAACCTTTGGGAGG - Intergenic
1130318323 15:82816150-82816172 TTGAAGATGGGGCCTTTGGGGGG - Intronic
1131047259 15:89324027-89324049 GGGAAGGGGCAGCCTTTGGGTGG - Intronic
1131695868 15:94876900-94876922 AGTAAGAGGGAGCCATTGTCCGG + Intergenic
1131852367 15:96556730-96556752 AGGCAGAGGCTGCCTGTGGGTGG - Intergenic
1132248852 15:100318370-100318392 TGGAAGGTGAAGCCTTTGGGAGG + Intronic
1133198930 16:4190500-4190522 GGGAAGAAGCAGCCTTTGGATGG - Exonic
1133813122 16:9176767-9176789 TGGAAGGTGGGGCCTTTGGGAGG - Intergenic
1133841663 16:9415768-9415790 AGGCAGAGGGAGCCAGAGGGAGG - Intergenic
1134022025 16:10927957-10927979 AGGAAGAGTGACCATTTGGAAGG - Exonic
1134309726 16:13064887-13064909 TGGAAGAGGGTGCTTTGGGGAGG + Intronic
1134333481 16:13271754-13271776 AGGATGAGGGATCTTATGGGGGG + Intergenic
1134410274 16:13998208-13998230 ATGCAGAGGAAGCCTTTGGCAGG + Intergenic
1134902751 16:17953442-17953464 AGGAGGTGGGGGCATTTGGGAGG - Intergenic
1135854466 16:25994110-25994132 TTGGAGATGGAGCCTTTGGGAGG - Intronic
1135972175 16:27080453-27080475 AGCAAGAGTGAGCTTGTGGGAGG - Intergenic
1136111736 16:28067722-28067744 AGGCGGTGGGAGCATTTGGGGGG - Intergenic
1136459389 16:30400280-30400302 AGGAAGAGGGGGCGTGTGGGGGG + Intergenic
1137068200 16:35873118-35873140 TTGGAGATGGAGCCTTTGGGAGG - Intergenic
1137351992 16:47721429-47721451 TGGAAGAGGAAGGCTTTGGGAGG - Intergenic
1137605449 16:49783713-49783735 AGGCACTGGGAGCCTTTGGAAGG + Intronic
1137606415 16:49789618-49789640 AGGAAGAAGGAACATTTGTGGGG + Intronic
1137803594 16:51283547-51283569 AGCAACAGGGAGCCTTTGAGGGG + Intergenic
1138646462 16:58429035-58429057 AGGAAGTGGGGTGCTTTGGGAGG - Intergenic
1138863243 16:60785386-60785408 AGGCAGAGGGAGCTTTAGGAAGG - Intergenic
1139231667 16:65289045-65289067 TTGAAGGTGGAGCCTTTGGGAGG + Intergenic
1139318988 16:66097679-66097701 GGGAAGAGGCAGCCTGTTGGAGG - Intergenic
1139392449 16:66613393-66613415 AGGAAGAAGGAGGGTTTGGCTGG - Exonic
1139674759 16:68515838-68515860 AGGAGGTGGGAGTCTTCGGGAGG - Intergenic
1140588658 16:76324876-76324898 TTGGAGAGGGGGCCTTTGGGAGG - Intronic
1141102219 16:81206111-81206133 AGGAAGATGGACTATTTGGGTGG + Intergenic
1141957907 16:87384479-87384501 AGGAACAGGCGCCCTTTGGGCGG - Intronic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142127534 16:88417590-88417612 AGGAAGAGGGACCATGTGCGGGG - Intergenic
1142130771 16:88430579-88430601 AGGAAGAGGAAGGCTCGGGGCGG + Exonic
1142716674 17:1750878-1750900 AGGAAAGGGGAGCCTCGGGGAGG - Intronic
1142880638 17:2880180-2880202 AGGAAGACGAAGGCTTGGGGGGG + Intronic
1142894276 17:2964160-2964182 AGGTTGAGGGAGGCTGTGGGAGG + Intronic
1143498356 17:7325111-7325133 AGGCAGAGGGAGCCTGGCGGGGG - Intronic
1143583185 17:7838275-7838297 AGGAGGAGGGAGCCTGCTGGTGG + Intergenic
1143851145 17:9813021-9813043 AGGAGGTGGGGGCCTTTGCGTGG - Intronic
1143914065 17:10275882-10275904 GGGACCAGGGACCCTTTGGGAGG + Intergenic
1144253559 17:13443453-13443475 TAGGAGATGGAGCCTTTGGGAGG + Intergenic
1144258604 17:13495613-13495635 AGGAAAACTGAGTCTTTGGGAGG - Intergenic
1145903914 17:28506144-28506166 AGGAGGAGGGAGGGGTTGGGGGG + Intronic
1145985999 17:29046689-29046711 AGGGAGAGGGATCCTTGGGTAGG + Intronic
1146759108 17:35460643-35460665 AGGAAGAGGGAGCCAGAGGCCGG + Intergenic
1147113965 17:38284939-38284961 AGAGAGAGGGAGCCATAGGGAGG - Intergenic
1148415639 17:47504252-47504274 AGAGAGAGGGAGCCATAGGGAGG + Intergenic
1148444793 17:47731037-47731059 AGGAAGAGGAAGGCTGGGGGTGG - Intergenic
1148787702 17:50153387-50153409 AGGAACAAGGAGGGTTTGGGAGG + Intergenic
1149144371 17:53472281-53472303 TAGAAGATGGTGCCTTTGGGAGG - Intergenic
1149239225 17:54629516-54629538 TGGGAGGTGGAGCCTTTGGGAGG - Intergenic
1149574394 17:57701333-57701355 ACGAAGGTGGGGCCTTTGGGAGG + Intergenic
1150433769 17:65139010-65139032 TGGAGGAGGGAGAGTTTGGGTGG - Intronic
1150640960 17:66949045-66949067 AGGAAGGGGGAAGCCTTGGGGGG + Intergenic
1151388989 17:73772929-73772951 AGGATGAGGGTGCCTTTGGAAGG - Intergenic
1152100773 17:78300730-78300752 AGGAGGAGGTGGCCTTAGGGAGG - Intergenic
1152408013 17:80108437-80108459 GGGAGGAGGGAGCCTTGGGGCGG - Intergenic
1203168175 17_GL000205v2_random:118425-118447 AGGAAGTGGGGGACTATGGGAGG + Intergenic
1152962704 18:89298-89320 AGGAGCAGGGAGCATGTGGGTGG - Intergenic
1153646378 18:7199669-7199691 AGGAGGTGGGGTCCTTTGGGGGG - Intergenic
1154125032 18:11684414-11684436 GTGGAGATGGAGCCTTTGGGAGG - Intergenic
1154996271 18:21643195-21643217 AGAAAAAGAGAGCCTTTGGGAGG + Intergenic
1155805686 18:30168430-30168452 AGTGAGAGGGATCCGTTGGGAGG + Intergenic
1155959908 18:31985510-31985532 CCGAAGACAGAGCCTTTGGGAGG + Intergenic
1156299384 18:35822609-35822631 AGTTAGAGAGAGGCTTTGGGAGG - Intergenic
1156466239 18:37349304-37349326 AAGAAGAGGGACACGTTGGGGGG + Intronic
1156504931 18:37584379-37584401 GGGTAGAGGGAATCTTTGGGAGG + Intergenic
1156640971 18:39098269-39098291 AGGAGGTGGGACCTTTTGGGAGG - Intergenic
1157147271 18:45176646-45176668 AGGAAGAGGGGGCTTCTGGAAGG - Intergenic
1157319703 18:46624544-46624566 AGGAAGAGGAAACCTTTTGGGGG - Intronic
1157466772 18:47954107-47954129 TGGAAAGGGCAGCCTTTGGGGGG - Intergenic
1157581305 18:48775745-48775767 AGGAAGAGGCAGGATCTGGGTGG + Intronic
1159118974 18:64147752-64147774 AGGTAGAGGGAGTCTGGGGGAGG + Intergenic
1159376350 18:67598409-67598431 TGGGAGATGGGGCCTTTGGGAGG - Intergenic
1159560453 18:69987151-69987173 TAGAAGAGGAAGCCTTTAGGAGG - Intergenic
1159957489 18:74530124-74530146 AGGAAGTGGGGGCTTCTGGGTGG - Intergenic
1160117993 18:76100019-76100041 AGGAGGCGGGGACCTTTGGGAGG + Intergenic
1160179562 18:76622238-76622260 AGGAGCAGGGGGCTTTTGGGAGG - Intergenic
1160355112 18:78221192-78221214 ATGAGGAGGGAGCGATTGGGTGG + Intergenic
1160381640 18:78461579-78461601 AGGAAGAGGGAGGCAGCGGGAGG - Intergenic
1160741776 19:689558-689580 AGGAGGTGGGAGCCACTGGGGGG + Intronic
1161338154 19:3725745-3725767 AAGCAGAAGGAGCCTTGGGGAGG - Intronic
1161574572 19:5048520-5048542 AGGAGGACGGAGCCTTTGCCTGG + Intronic
1162159416 19:8700254-8700276 GGGGAGAGGGTGCATTTGGGAGG + Intergenic
1163200199 19:15761184-15761206 AGGAAGAGGGGTCCTTCAGGGGG - Intergenic
1163695539 19:18761598-18761620 TGGAAGAAGGAGCTTTTGGGAGG + Intronic
1165735703 19:38174101-38174123 AGGAAGAGGGAGCCAGGAGGAGG + Intronic
1165822002 19:38682682-38682704 AAGAAGAGGAAGCCTTTGGAGGG - Intronic
1165859133 19:38898150-38898172 AGGAAGAAGGAAAGTTTGGGAGG + Intronic
1166275787 19:41752956-41752978 AGGAAGAGGGTGCTTGAGGGAGG - Intronic
1166944224 19:46387303-46387325 AGGAAGTTGGGGCCTGTGGGTGG + Intronic
1167072239 19:47227977-47227999 AGGAAGACGGAGGCTGGGGGTGG - Intronic
1167976524 19:53231282-53231304 TAGAGGTGGGAGCCTTTGGGAGG - Intergenic
1168132969 19:54332522-54332544 ATGGAGAAGGAGCCTATGGGTGG + Intergenic
1168236977 19:55069591-55069613 AGGCAGAGGAAACCTTAGGGAGG - Intronic
1168464915 19:56594735-56594757 AAGAAGAGGGAGCGGGTGGGAGG - Intergenic
1168474488 19:56666045-56666067 GTGGAGATGGAGCCTTTGGGAGG + Intronic
1168682516 19:58326550-58326572 AGGCTGAGGGTGGCTTTGGGAGG - Intergenic
925147912 2:1593395-1593417 AGGAGCTGGGGGCCTTTGGGAGG + Intergenic
925220359 2:2134551-2134573 ATGAAGATGGAGCCTTTAGATGG + Intronic
925909887 2:8566800-8566822 AGGATGGGGAAGCCTTTGTGTGG - Intergenic
926627690 2:15106769-15106791 AGGTAGAGGGAGCATTAGGAGGG + Intergenic
926924708 2:17975866-17975888 TAGGAGATGGAGCCTTTGGGAGG + Intronic
926925134 2:17979878-17979900 AGGCAGAGTCAGCCTCTGGGAGG + Intronic
927151518 2:20198961-20198983 AGGGAGAGGGTGCCTCTGAGGGG - Intergenic
927442215 2:23127290-23127312 TAGGAGATGGAGCCTTTGGGAGG - Intergenic
928603104 2:32920512-32920534 AGGGAGAGGGGGCTTTGGGGAGG + Intergenic
928725001 2:34162196-34162218 TAGAAGGTGGAGCCTTTGGGAGG - Intergenic
929031005 2:37649744-37649766 AGGATGAGTGAGCCTCTGGTTGG - Intronic
929811181 2:45190527-45190549 AGCAAGAGGGAGCCATGCGGAGG + Intergenic
930122331 2:47770107-47770129 GGGAAGTGGGACCTTTTGGGAGG + Intronic
930328335 2:49949214-49949236 AAAAAGAGGGAGCATTTGGTTGG + Intronic
930826568 2:55701563-55701585 TTGGAGATGGAGCCTTTGGGAGG - Intergenic
931628144 2:64275572-64275594 TGCAAGGTGGAGCCTTTGGGAGG - Intergenic
932053857 2:68425276-68425298 ATGAGGAAGGAGCATTTGGGAGG + Intergenic
932177426 2:69615517-69615539 AGGAGGAGGGAGGATTGGGGAGG - Intronic
933044796 2:77521925-77521947 GGGAAAAGGAAGCCGTTGGGGGG + Intronic
933977515 2:87523330-87523352 AGGAAGAGTGATCACTTGGGTGG - Intergenic
934651518 2:96093794-96093816 GGGAGGAGGGGGCCTTTGGATGG + Intergenic
934710181 2:96509287-96509309 AGGACAAGGCTGCCTTTGGGAGG + Intergenic
934770335 2:96903650-96903672 AGGAAGAGGAAGCCACAGGGAGG + Intronic
934955498 2:98614330-98614352 AGGAAGAGGGAGTGGGTGGGAGG + Intronic
935217373 2:100984996-100985018 AGCAAGAGGCAGCCTTGGAGGGG - Intronic
935761284 2:106322943-106322965 TGGGAGTGGGAGCCTTGGGGAGG + Intergenic
936049692 2:109213567-109213589 AGGAAGATGGGGGCATTGGGTGG + Intronic
936316309 2:111427476-111427498 AGGAAGAGTGATCACTTGGGTGG + Intergenic
937145752 2:119642905-119642927 TTGGAGATGGAGCCTTTGGGAGG - Intronic
938178125 2:129155049-129155071 ATAAAGAGGGAAACTTTGGGAGG - Intergenic
938655821 2:133432454-133432476 AGGCACTGGGAGCATTTGGGTGG - Intronic
940127146 2:150339109-150339131 TGGGAGATGGGGCCTTTGGGAGG + Intergenic
940394897 2:153177053-153177075 AGGAATAAGGAGCATTTGGAAGG + Intergenic
940619209 2:156089628-156089650 TGGAAGATGCAGCCTTTGGGAGG + Intergenic
942181250 2:173383277-173383299 AGGCAAAGGGAGCCCTCGGGAGG + Intergenic
944057982 2:195543527-195543549 TGGGAGGTGGAGCCTTTGGGAGG - Intergenic
944217652 2:197271998-197272020 TAGAAGTTGGAGCCTTTGGGAGG + Intronic
944638406 2:201697000-201697022 TTGAAGATGGGGCCTTTGGGAGG + Intronic
944861312 2:203818282-203818304 AAGAAGAGAAAGACTTTGGGAGG + Intergenic
945028232 2:205639583-205639605 AGGAAACGTGAGCCTTAGGGTGG - Intergenic
945139317 2:206667129-206667151 ATGAAGAGGGAGCCCCTGGAGGG - Intronic
945195707 2:207235715-207235737 TGGGAGGTGGAGCCTTTGGGAGG - Intergenic
945392572 2:209281975-209281997 AGTAAGAGGGAACCTTTGTATGG - Intergenic
945649435 2:212539387-212539409 AGGGAAAGGGAGCCTCTTGGTGG + Intergenic
946239795 2:218346533-218346555 TGGAGGAGGGGGCCTTTGAGGGG - Exonic
946563576 2:220939891-220939913 AGGAAAAGGCAGCATTTGAGCGG - Intergenic
947090658 2:226507709-226507731 CGGAAGAGGGAGTGTTGGGGAGG + Intergenic
947375557 2:229491424-229491446 TAGAAGGTGGAGCCTTTGGGAGG - Intronic
947698866 2:232216025-232216047 AGGATGAGGGAGACTTCAGGTGG - Intronic
947779839 2:232749338-232749360 AGGAAGAGTGATTCTTGGGGAGG + Intronic
948259420 2:236591829-236591851 AGGAAGAGGGAAAGCTTGGGTGG - Intergenic
948293941 2:236847263-236847285 AGGCAGAGGGAGCCAGAGGGAGG + Intergenic
948360639 2:237417650-237417672 TGGGAGATGGGGCCTTTGGGAGG + Intergenic
948398237 2:237663344-237663366 AGGAGGTGGGAGCTTTTAGGAGG + Intronic
948915152 2:241030630-241030652 AGCAAGAGGGAGCCCTGGTGCGG - Intronic
1169245275 20:4019939-4019961 AGGAGGAGAGGGCCATTGGGAGG - Intergenic
1169790490 20:9404872-9404894 TTGAAGATGGGGCCTTTGGGAGG - Intronic
1169803512 20:9535791-9535813 AGGAAGAGGTAGCAACTGGGAGG + Intergenic
1170046945 20:12095418-12095440 ACAAAGAGGGATCCTCTGGGAGG + Intergenic
1170816814 20:19720933-19720955 AGGAGGCAGCAGCCTTTGGGGGG - Intronic
1170914956 20:20613767-20613789 GGGAAGGGGGAGCCTTGGGGAGG - Intronic
1170921768 20:20686054-20686076 TGGAAGAGGGTGATTTTGGGTGG - Intronic
1171284068 20:23923463-23923485 AGGAAGAGGAAGCCCCTGGAGGG + Intergenic
1172344921 20:34190627-34190649 AGGAAGAGGAAGCCTTAGTGAGG - Intergenic
1172701424 20:36855788-36855810 AGGAAGACGGAGTCTTGGTGAGG + Intronic
1172884964 20:38224775-38224797 AGGGCGAGGGTGCCTTTCGGTGG - Intronic
1172887693 20:38242036-38242058 AGGATGAGGCAGCATTTAGGAGG + Intronic
1172913099 20:38424722-38424744 AGGCAGAGAGAGCTTCTGGGGGG + Intergenic
1173535037 20:43803004-43803026 AGGTAGAAGGAAGCTTTGGGGGG - Intergenic
1173644622 20:44625762-44625784 AGGAAGAGGAGGCTTTGGGGAGG + Intronic
1173873893 20:46357821-46357843 AGGAAGAGGGAGCCGGTGGGGGG - Intronic
1173880165 20:46406218-46406240 AGAAGGAGGGAGGCGTTGGGTGG - Intronic
1173940531 20:46907408-46907430 AGGAAGCAGCAGCCTGTGGGAGG + Intronic
1174080979 20:47970602-47970624 GGGAAGTGGGAGCCATTGGAGGG - Intergenic
1174148035 20:48465791-48465813 CAGGAGAGGGAGACTTTGGGGGG + Intergenic
1174199247 20:48795475-48795497 AGGAGGAGGGTGCTTTTGGCTGG + Intronic
1174419749 20:50391758-50391780 AGGAGGTGGGCACCTTTGGGGGG - Intergenic
1176172998 20:63704617-63704639 TGGAAGAGGGAGACTTAAGGGGG - Intronic
1176325546 21:5445750-5445772 AGGAAGTGGGGGACTATGGGAGG + Intergenic
1176403582 21:6340712-6340734 AGGAAGTGGGGGACTATGGGAGG - Intergenic
1176433575 21:6648392-6648414 AGGAAGTGGGGGACTATGGGAGG + Intergenic
1177529331 21:22339996-22340018 AGGAAGAGAGAGACAGTGGGAGG + Intergenic
1177620860 21:23591195-23591217 AGGAAGAGGGGCCCAGTGGGAGG + Intergenic
1177669348 21:24206281-24206303 CAGAAGGTGGAGCCTTTGGGAGG + Intergenic
1177921518 21:27158358-27158380 ATTAAGAGGGGGCCTTTGGGAGG - Intergenic
1177930677 21:27279102-27279124 AGGAAGTGGGGACTTTTGGGAGG - Intergenic
1178319516 21:31594721-31594743 TTGGAGATGGAGCCTTTGGGAGG + Intergenic
1178794622 21:35732484-35732506 AGGATGATGGAGCCTCTAGGAGG - Intronic
1179108398 21:38424079-38424101 TAGGAGAGAGAGCCTTTGGGAGG + Intronic
1179509927 21:41865662-41865684 AGGAAGAGTCAGCTTTTTGGGGG - Intronic
1179529226 21:42007486-42007508 GGGAAGAGAGAGATTTTGGGTGG - Intronic
1179533950 21:42039421-42039443 TAGGAGATGGAGCCTTTGGGAGG - Intergenic
1180338198 22:11598352-11598374 AGAAAGACGGAGCCTTGGAGAGG - Intergenic
1180618719 22:17145884-17145906 AGGAAGAGGCGGCCTTGGGGAGG + Intronic
1180636983 22:17269383-17269405 AGGAAGATGGAGCCTCCCGGTGG - Intergenic
1180820571 22:18824382-18824404 AGGAAGATGGAGAATTGGGGTGG + Intergenic
1180935306 22:19621536-19621558 AGGCAGAAGGAGCCTTGGAGAGG + Intergenic
1181206795 22:21258854-21258876 AGGAAGATGGAGAATTGGGGTGG + Intergenic
1181487705 22:23241913-23241935 AGGAAGAGGGTGATTTTGTGGGG - Intronic
1182709249 22:32310402-32310424 AGGCAGAGGAAGCCTTGGGGTGG - Intergenic
1182734922 22:32526378-32526400 TGGAAGAGGAAGCCATTTGGTGG + Intronic
1182904194 22:33921611-33921633 AGGAAGAGGAAGCCTTGGACAGG - Intronic
1183238033 22:36634897-36634919 AGGAAGAAGGTCCCTTTGGTTGG + Intronic
1183363852 22:37396951-37396973 AGGCAGAGGGAGGCTTCCGGAGG + Intronic
1183597603 22:38822041-38822063 AGGAAGAGGGAGGCATGGGTGGG + Exonic
1183706877 22:39479594-39479616 AGAAAGAGTGAGCCTTTGGGTGG - Intronic
1183724529 22:39581080-39581102 GGGTAGAGGGAACCTCTGGGGGG + Intronic
1184118248 22:42434349-42434371 GGGAAGGGGTAGCCTCTGGGAGG + Intergenic
1184396845 22:44247337-44247359 AGGCAGAGGAAGCCTTGAGGTGG - Exonic
1185280181 22:49966600-49966622 AGGAGGAGGGTGCCCTGGGGTGG - Intergenic
1185378631 22:50495716-50495738 ATGAAGAGGGAAGGTTTGGGAGG - Intergenic
1203220129 22_KI270731v1_random:36569-36591 AGGAAGATGGAGAATTGGGGTGG - Intergenic
1203270697 22_KI270734v1_random:50257-50279 AGGAAGATGGAGAATTGGGGTGG + Intergenic
950206060 3:11082062-11082084 AGGCTGAGGGAACCTTTGGAGGG + Intergenic
950626110 3:14248379-14248401 AGGAAGAGCCTGCCTGTGGGAGG + Intergenic
951103941 3:18721100-18721122 TTGGAGAGGGAGTCTTTGGGAGG - Intergenic
951298921 3:20971678-20971700 AGAAAGAAGGAGGATTTGGGAGG + Intergenic
952339070 3:32430198-32430220 AGTACGAGGGATCTTTTGGGGGG - Intronic
952350364 3:32529994-32530016 AGGAAATGGGAACCTTAGGGAGG - Intronic
952582650 3:34852814-34852836 ATGAAGATGGGGCCATTGGGAGG - Intergenic
952925537 3:38316833-38316855 GAGGAGAGGGAGCCTCTGGGAGG - Intronic
953162298 3:40432475-40432497 TTGGAGATGGAGCCTTTGGGAGG - Intergenic
953271643 3:41451239-41451261 AACAAGAGGGGGCCTTTGGGAGG + Intronic
953795164 3:45979591-45979613 AGGAAGTGGGAGTTTATGGGTGG - Intronic
953886989 3:46719706-46719728 AGGGAGAAGCAGCCTCTGGGAGG + Exonic
955252617 3:57299611-57299633 TTGGAGATGGAGCCTTTGGGAGG + Intronic
955480985 3:59389785-59389807 AGCAAGAGGGAGCCATTTGGAGG - Intergenic
955829568 3:62986726-62986748 AGGAAGAGGGATCCGTTTGCAGG - Intergenic
956129070 3:66037970-66037992 AGGCAGGGCGCGCCTTTGGGGGG - Intronic
956541825 3:70348565-70348587 TTGGAGAGTGAGCCTTTGGGAGG - Intergenic
956840205 3:73132716-73132738 AGGAAGTGGAAGGCTTTGAGAGG - Intergenic
958180105 3:90049091-90049113 TAGAAGGTGGAGCCTTTGGGAGG - Intergenic
960123901 3:113976777-113976799 AGGAACAGGGAGGCTTTGAAAGG + Intronic
960274931 3:115717905-115717927 AGAAAGTGGGAGAATTTGGGAGG + Intronic
960593886 3:119390934-119390956 TGGAAGAGGGTGCCCATGGGAGG - Exonic
961170760 3:124796307-124796329 AGTAAAAGGCAGGCTTTGGGAGG + Intronic
963425623 3:145118912-145118934 GGAAAGAAGGGGCCTTTGGGAGG - Intergenic
963713542 3:148776061-148776083 AAGAAGAGGGGCCTTTTGGGAGG + Intergenic
964984261 3:162719600-162719622 TTGAAGATGGAGCCTTTTGGGGG + Intergenic
965794895 3:172429299-172429321 TAGGAGATGGAGCCTTTGGGAGG + Intergenic
965968201 3:174522300-174522322 TAGGAGATGGAGCCTTTGGGAGG + Intronic
966468152 3:180255834-180255856 AAGAGGTGGGGGCCTTTGGGAGG - Intergenic
966633109 3:182100793-182100815 AGGCAGAGGCAGGCTTTGAGAGG - Intergenic
967404159 3:189098316-189098338 AGGAAGGGGGATCCTGTGGTAGG + Intronic
967751744 3:193123152-193123174 AGGAAGTAGGGGCATTTGGGAGG - Intergenic
967770866 3:193332095-193332117 AGTAAGAGGGACCCAGTGGGAGG + Intronic
967855055 3:194111075-194111097 TTGAAGATGGGGCCTTTGGGAGG + Intergenic
968093533 3:195912117-195912139 TGCCAGAGGGAGGCTTTGGGTGG + Intergenic
968192635 3:196681336-196681358 GGGATGAGGCAGCCTTTTGGAGG + Intronic
968273880 3:197425111-197425133 AGGAAGAAGGAGCCTAAGAGAGG + Intergenic
968551108 4:1223716-1223738 AGGGAGGGGGAGCATCTGGGCGG - Intronic
969144794 4:5113128-5113150 AGGAGGTGGGGGCCTTTGAGAGG + Intronic
969149455 4:5156598-5156620 AGGAGGAGGATACCTTTGGGAGG + Intronic
969444745 4:7238276-7238298 AGGTAGAGGGAGTCTGGGGGGGG + Intronic
970702426 4:18757923-18757945 AGGAAGAGGTAGCAAGTGGGGGG + Intergenic
971199616 4:24500105-24500127 AGGTAGGTGGGGCCTTTGGGAGG + Intergenic
972169211 4:36324264-36324286 AGGAGGAGGGAGGCGTTGAGAGG - Intronic
972308905 4:37860985-37861007 AGCAATAGGGAGCCTCCGGGTGG - Intronic
972739013 4:41873592-41873614 AGGAACAGGGAGGCTTTCAGTGG - Intergenic
972949050 4:44295760-44295782 TGGGAGATGGAGCCTCTGGGAGG - Intronic
973691549 4:53438255-53438277 AGGAAGATGGAGGTGTTGGGAGG + Intronic
973914250 4:55617460-55617482 AGGAAGAGGGACCAGGTGGGTGG - Intronic
973958494 4:56086958-56086980 AGGGAGAGAGAGCATTTGTGTGG - Intergenic
975140538 4:70914011-70914033 TAGAAGATAGAGCCTTTGGGTGG + Intronic
975527601 4:75367864-75367886 TTGAAGATGGGGCCTTTGGGAGG + Intergenic
976094134 4:81489460-81489482 AGAAAGTAGGAGACTTTGGGGGG - Intronic
976117733 4:81745831-81745853 ACGAAGAGTTAGCCTATGGGAGG - Intronic
980741168 4:136951191-136951213 TTGAAGATGGGGCCTTTGGGAGG - Intergenic
981355715 4:143786986-143787008 AGCAAGAGGGAGCAAGTGGGTGG - Intergenic
981377041 4:144027874-144027896 AGCAAGAGGGAGCAAGTGGGTGG - Intergenic
981456898 4:144962850-144962872 AGGAATAGGGAGACCTTGGAGGG - Intergenic
982537510 4:156625332-156625354 AGGAAGAGCCAGCTTTTAGGGGG - Intergenic
983021451 4:162681102-162681124 AGGAAGTGGGGCCTTTTGGGAGG - Intergenic
983173310 4:164559565-164559587 AGGAAGAGGGGGCCTGGGAGAGG - Intergenic
984281126 4:177672076-177672098 AGGAAGTGGGGACTTTTGGGAGG - Intergenic
984490144 4:180423957-180423979 GGGGAGAGGGAGCAGTTGGGAGG + Intergenic
984850921 4:184151928-184151950 AGGAAGAGGAAGAGTTTAGGAGG - Intronic
985575385 5:671295-671317 AGGAAGAGGTGGCCCTTGGTGGG + Intronic
985668899 5:1196356-1196378 AGGAATGGGGAGCCCTTGGGAGG - Intergenic
985759482 5:1737751-1737773 AGGAAGAAGGCGCCTTTGTAGGG - Intergenic
985796492 5:1966106-1966128 AGCAAGAGAGAGCATCTGGGTGG - Intergenic
988260949 5:28885594-28885616 TGGAAGAGTGAACCTGTGGGAGG + Intergenic
988982490 5:36585217-36585239 AGGAGGTGGGAGCCTTCGGGAGG - Intergenic
989034398 5:37154887-37154909 AGGAAGAGGGAGCAATTTGGAGG - Intronic
989056528 5:37371160-37371182 GGGAAGAGGAAGCTGTTGGGAGG + Exonic
989070729 5:37508196-37508218 AGGAGGTGGGGGCCTTTGGGAGG + Intronic
989586022 5:43074407-43074429 AGGAAGAGGTAGGGGTTGGGAGG + Intronic
989786423 5:45336913-45336935 AAGAGGAAGGGGCCTTTGGGAGG - Intronic
990536966 5:56732666-56732688 AGGAAGAGGGAGGCTGGGGAAGG + Intergenic
990916858 5:60915913-60915935 AGGTAGATGGAGCCTGTGGTAGG - Intronic
990943938 5:61230492-61230514 TGGAAGATGGGGCCTTTGGGAGG + Intergenic
991992609 5:72355977-72355999 AGAAGGAAGAAGCCTTTGGGTGG - Intronic
993399632 5:87432500-87432522 AGGAGGTGGGGCCCTTTGGGAGG + Intergenic
994090449 5:95805361-95805383 AGGAAGTGGGACCTTGTGGGAGG - Intronic
994834588 5:104833004-104833026 TGGAAGATTGAGCCTTTGGAAGG + Intergenic
995058263 5:107786512-107786534 AAGGAAATGGAGCCTTTGGGAGG + Intergenic
995153848 5:108885692-108885714 AGGAGGTGGGGGCCTTTGGAAGG - Intronic
996788153 5:127263292-127263314 AGGAAGAGGGATTCTCGGGGGGG + Intergenic
997083748 5:130771747-130771769 AGGTAGTGGGAGACTGTGGGGGG + Intergenic
997321806 5:132983928-132983950 AGGGAGAGGGAGACCGTGGGGGG + Intergenic
997472328 5:134123889-134123911 AGGGAGAGGTAGGCTTTGGGTGG + Intronic
997496035 5:134327029-134327051 AGGAAGAGGGAGCCCTAGAGTGG - Intronic
997852579 5:137346073-137346095 AGGAAGACAGGGGCTTTGGGTGG - Intronic
998549502 5:143063732-143063754 AGAATGAGGTAGCCTTTGGCAGG - Intronic
999150736 5:149424375-149424397 AGTAGGAGGGAGCCTTTGGTGGG + Intergenic
999230164 5:150057186-150057208 AGGAAACGGGAGCCTGTGAGGGG - Intronic
999633246 5:153593299-153593321 TAGAAGATGGAGTCTTTGGGGGG - Intronic
1000262130 5:159598079-159598101 GTGAAGGGGGAGCCTATGGGAGG + Intergenic
1000282597 5:159794936-159794958 AGGACAGGGGAGCCTTTGGAAGG - Intergenic
1001436840 5:171705752-171705774 AGGAAGAGGGAGACGGTGGTGGG - Intergenic
1002187701 5:177462210-177462232 AGTATGTGGGAGCCTTGGGGTGG - Intronic
1002269835 5:178063873-178063895 AGGGAGAGGATGCATTTGGGAGG + Intergenic
1002525798 5:179815601-179815623 TGGAAGCAGGAGCCTTGGGGAGG - Intronic
1002782630 6:379273-379295 AGGAGGAGGGAGCCTCGAGGGGG - Intergenic
1003425590 6:5996365-5996387 AGGAAGAGGCAGGCTAAGGGCGG - Intergenic
1003944901 6:11065838-11065860 TGGAGGGTGGAGCCTTTGGGAGG + Intergenic
1003970003 6:11290307-11290329 AGGTGGAGACAGCCTTTGGGGGG - Intronic
1004079372 6:12376319-12376341 AGGAAGAGGGTCCAGTTGGGAGG - Intergenic
1004349683 6:14880266-14880288 AGGACCAGGGAGCCCTTGGCTGG + Intergenic
1004496569 6:16168963-16168985 TGGAAGAGGGAACTCTTGGGAGG + Intergenic
1005824193 6:29622733-29622755 GGGAAGAGGGAGATTTGGGGAGG - Intronic
1006945921 6:37784458-37784480 AGGGAGAGGGAGGCGGTGGGGGG + Intergenic
1007115336 6:39339335-39339357 AGTGAGAGGGAGGCTTGGGGAGG + Intronic
1007272878 6:40651488-40651510 AGCAAGAGGGAGGCATTGTGGGG + Intergenic
1007274041 6:40660644-40660666 AGGAAGAGGGAGTCTTGCTGGGG + Intergenic
1007369767 6:41418813-41418835 AGGAAGAGGGTGCCCTTGAGAGG - Intergenic
1007947835 6:45841605-45841627 AGGAAGAGGAAGCCTTCCGAGGG - Intergenic
1008515186 6:52312192-52312214 ATGGAGATGGGGCCTTTGGGAGG + Intergenic
1009832196 6:68952132-68952154 GAGAACAGGGAGGCTTTGGGGGG - Intronic
1010376479 6:75176350-75176372 AGGGAGAGGGATGCTGTGGGAGG + Intronic
1011763796 6:90596431-90596453 AGGGAGAGGGAGCCAAAGGGAGG - Intergenic
1011907114 6:92385611-92385633 AGGAAGTGGCAGCATTTGGTTGG - Intergenic
1012248603 6:96955134-96955156 TGGGAGGTGGAGCCTTTGGGAGG - Intronic
1013070802 6:106727468-106727490 TTGAAGATGGGGCCTTTGGGAGG - Intergenic
1013739943 6:113270880-113270902 AGGAAGAGAGAGCCATTTTGGGG + Intergenic
1014294862 6:119605783-119605805 AGGAAGGTGGGGACTTTGGGAGG - Intergenic
1015343229 6:132126498-132126520 TAGGAGAGGGAGCCTTTGGTAGG - Intergenic
1016349996 6:143156652-143156674 AGAAGGAGGCAGCCCTTGGGAGG + Intronic
1016439810 6:144071286-144071308 AGGAAGTGGGGGCCTTTGGGAGG + Intergenic
1016726622 6:147377720-147377742 CAGAAGTGGGGGCCTTTGGGAGG - Intronic
1016987724 6:149907617-149907639 AGGAAAAGGGTGCGTTTGGAGGG + Intergenic
1018197235 6:161366072-161366094 TGGAAGGTGGGGCCTTTGGGAGG + Intronic
1018425239 6:163673952-163673974 AGGAAGAGCGAGGGTTGGGGAGG + Intergenic
1018484063 6:164222451-164222473 TGGAAAATGGTGCCTTTGGGGGG + Intergenic
1018553878 6:165030600-165030622 AGGAAGTGGGGGTCTTTGGGAGG + Intergenic
1018689100 6:166329292-166329314 AGGAATAGCCAGCCTTTGTGGGG - Intronic
1019001978 6:168761516-168761538 AGGAATGGGCAGCCTTTGAGGGG + Intergenic
1019309418 7:353010-353032 AAGAGGAGGGGGCCCTTGGGAGG + Intergenic
1019357937 7:590706-590728 AGAAAGAGGGGACCTTGGGGAGG - Intronic
1019738634 7:2662289-2662311 AGGAGGGGTGAGCCTGTGGGTGG - Exonic
1019779599 7:2931496-2931518 TGGAAAAGGGAGCCTTTTGGTGG - Intronic
1020243024 7:6410129-6410151 AGGAGGAGGGCGCCTCGGGGCGG - Exonic
1020654924 7:10917573-10917595 ATTAAGATGGAGCATTTGGGGGG + Intergenic
1020835281 7:13141990-13142012 TGGGAGATGGAGCCTTTGGGAGG + Intergenic
1020850709 7:13348900-13348922 AGGAAGAGGGAGACTTGCGATGG + Intergenic
1021101914 7:16594052-16594074 TTGGAGATGGAGCCTTTGGGAGG + Intergenic
1021525237 7:21579061-21579083 GGGAAGAGGGAGCAGTTTGGAGG - Intronic
1021817692 7:24464282-24464304 TTGGAGATGGAGCCTTTGGGAGG - Intergenic
1021978487 7:26031577-26031599 TGGAGCAGGAAGCCTTTGGGAGG + Intergenic
1022138037 7:27467453-27467475 AGAAACAGGGAGCCCTTGAGAGG - Intergenic
1023861699 7:44220766-44220788 AGGATGTGGGACCCTTGGGGGGG - Intronic
1025819134 7:64946913-64946935 AGGAGGAGGCAGCTTCTGGGAGG + Intergenic
1026302396 7:69109184-69109206 AGACAGAGGGAGCCTTAGAGAGG + Intergenic
1027052551 7:75029180-75029202 AGGAGGAGGGGGCCAGTGGGAGG - Intronic
1028073915 7:86486788-86486810 AGGAAGAGAGAGGCATTGGAAGG - Intergenic
1029363696 7:100104066-100104088 AGAAAGAGAGAGAATTTGGGTGG - Intronic
1029514998 7:101018510-101018532 AGGAAGAGGGAGCCCTGGCGGGG - Intronic
1030044311 7:105481301-105481323 AGAAAGAAAGAGCCCTTGGGAGG - Intronic
1030126977 7:106163087-106163109 AAGAGGTGGGAGTCTTTGGGAGG - Intergenic
1031063455 7:117077256-117077278 AGGAAAAGGGAACATTTGAGTGG + Intronic
1031685733 7:124730586-124730608 GGGAAGAAGGAGGATTTGGGAGG - Intergenic
1031865971 7:127039546-127039568 ATGAGGAGGGAGCCTGTGGAGGG + Intronic
1031925329 7:127633176-127633198 AGGAAGAAGGAGCATGTGGGAGG + Intergenic
1032478727 7:132229732-132229754 ATGGGGAGGGAGCCTTGGGGAGG + Intronic
1032674763 7:134119403-134119425 AAGAGGTGGGGGCCTTTGGGAGG + Intergenic
1032928399 7:136636748-136636770 ATGAAGAGGGAGGGTGTGGGAGG + Intergenic
1033596325 7:142862216-142862238 TAGAAGATGGGGCCTTTGGGAGG - Intronic
1033600932 7:142888019-142888041 TGGGGGAGGGAGGCTTTGGGAGG + Intergenic
1034036634 7:147830420-147830442 AGGAAGTGGGGCCTTTTGGGGGG - Intronic
1034274017 7:149816247-149816269 AGGCTGTGGGAGCCTGTGGGAGG + Intergenic
1034807047 7:154098117-154098139 TGGAGGAGGGACCCTGTGGGAGG + Intronic
1034955173 7:155329426-155329448 AGGATGTGGGTGTCTTTGGGGGG - Intergenic
1035146976 7:156828862-156828884 AGGAAAAGGGAAAATTTGGGTGG - Intronic
1035249861 7:157589885-157589907 ATGAAGAGGGAGCTTGTGGGTGG + Intronic
1035680713 8:1485689-1485711 AGGAAAAGGGAACCTTTGAAAGG + Intergenic
1036001318 8:4608131-4608153 AGGAAGAGGGAGGCATTAGAGGG + Intronic
1036101945 8:5796293-5796315 AGGATGTGGGAGCGTTTTGGTGG - Intergenic
1037463878 8:19139989-19140011 TAGGAGATGGAGCCTTTGGGAGG - Intergenic
1037582184 8:20252329-20252351 AGTAAGAGGGACCCTATTGGTGG - Intronic
1037907144 8:22722207-22722229 AGGAAGAGGGAGCTCTGGGTTGG - Intronic
1038044172 8:23752209-23752231 AGGAAAAAGGTGGCTTTGGGAGG + Intergenic
1038165597 8:25082483-25082505 AGGGAGATGGGGCCTCTGGGAGG + Intergenic
1039806741 8:41006420-41006442 TAGGAGAGGGAGCCTTTGGGAGG + Intergenic
1039901904 8:41758685-41758707 AGGAAGAATCAGCCTTTGAGGGG + Intronic
1040534964 8:48301186-48301208 AGGATGTGGGGGCCTCTGGGAGG + Intergenic
1040569315 8:48593682-48593704 AGGCAGAGGGAGCCTTGGAGCGG + Intergenic
1041381780 8:57259648-57259670 TGGAAGAGCGAGCCCTAGGGCGG + Intergenic
1041538978 8:58961741-58961763 AGGCTGAGGCAGGCTTTGGGAGG - Intronic
1041655864 8:60350031-60350053 AGGAGGTGGGGGCCCTTGGGAGG - Intergenic
1042590496 8:70393458-70393480 GAAAAGAGGGAGCCTTTGGTAGG - Intronic
1043835479 8:85040467-85040489 ACGAATAGGGAGTCTTTGGAGGG + Intergenic
1044872745 8:96635910-96635932 AGTATGAGGGAGACTTTGGGGGG + Intergenic
1045778786 8:105838993-105839015 AGGAAATGGGACCATTTGGGAGG + Intergenic
1046430234 8:114114719-114114741 AGGAAGAAAGAGCCCTTGGTAGG + Intergenic
1046778243 8:118186844-118186866 AGGAAGCAGCTGCCTTTGGGTGG + Intergenic
1047157908 8:122342125-122342147 AATAAGAGGGTGACTTTGGGTGG + Intergenic
1047818738 8:128494837-128494859 TAGAAGATGGAGGCTTTGGGAGG - Intergenic
1048096580 8:131301675-131301697 AGCAAGAGGGAGAGTTGGGGGGG + Intergenic
1048476718 8:134749535-134749557 TGGAAGATGGGGCCTTTGGGAGG - Intergenic
1048580805 8:135728653-135728675 AGCAGGAGGGAGCCCTTGGGGGG - Intergenic
1048997157 8:139801215-139801237 AGGAAGAGGAAGGCATTGTGTGG - Intronic
1052221746 9:26032445-26032467 TTGGAGATGGAGCCTTTGGGAGG - Intergenic
1052270574 9:26624281-26624303 AGGAAGCAGTGGCCTTTGGGAGG - Intergenic
1054759692 9:68993225-68993247 AGGAAGAGGGAGACCCAGGGAGG - Intronic
1055147630 9:72955845-72955867 TAGGAGATGGAGCCTTTGGGAGG + Intronic
1056222134 9:84460391-84460413 TGGTAGAGGGAGGCTTTGGGGGG - Intergenic
1056761106 9:89415502-89415524 CTGGAGAGGGAGCCTTTGGGAGG + Intronic
1056923437 9:90812360-90812382 ATGAAGAGCGAGGCTTTGAGAGG + Intronic
1057274250 9:93667877-93667899 AGGAAGATGGAGCCTGTGCTTGG + Intronic
1057490758 9:95517593-95517615 AGTAGGTGGGAGCATTTGGGTGG - Intergenic
1059366588 9:113791109-113791131 AGGAAGAGAGAGGCCTGGGGTGG + Intergenic
1060267961 9:122123173-122123195 AGGCAGGGGGCGCCTCTGGGTGG - Intergenic
1060341979 9:122785604-122785626 TTGGAGAAGGAGCCTTTGGGAGG + Intergenic
1060396134 9:123318294-123318316 AGGCAGAGGGAGATTTAGGGAGG - Intergenic
1060416889 9:123437061-123437083 ATGAAGAGGGAGCCTCTGGGGGG + Intronic
1061248738 9:129414421-129414443 GGGATGAGGGAGCCTGCGGGCGG - Intergenic
1061372915 9:130207854-130207876 AGGAAGCTGGAGGCTTTGAGAGG + Intronic
1061817540 9:133205897-133205919 AGGGTGAGTGAGCCTTTAGGAGG - Exonic
1061896791 9:133652410-133652432 AGGGGGAGGGTGCCTGTGGGTGG + Intronic
1062204675 9:135329449-135329471 AGAAGTTGGGAGCCTTTGGGTGG + Intergenic
1062233907 9:135499025-135499047 AGGCAGAGGGACCCTCTGGGTGG - Intronic
1062242865 9:135549329-135549351 AGGGTGAGTGAGCCTTTAGGAGG + Exonic
1062543355 9:137051247-137051269 AGGAAGAGGGGGTGTTTGGCTGG - Exonic
1062735435 9:138134820-138134842 AGGAGCAGGGAGCATGTGGGTGG + Intergenic
1203437961 Un_GL000195v1:160278-160300 AGGAAGTGGGGGACTATGGGAGG - Intergenic
1185856962 X:3544701-3544723 TGGAAGGTGGGGCCTTTGGGAGG + Intergenic
1186078909 X:5909136-5909158 AGAATGTGGGAGCCTTTGGCGGG - Exonic
1186095985 X:6102343-6102365 AGGAGGTGGGCGCCTTTTGGAGG + Intronic
1186115515 X:6301447-6301469 TTGGAGATGGAGCCTTTGGGAGG - Intergenic
1186268956 X:7864371-7864393 TGGAGGTGGGGGCCTTTGGGAGG + Intergenic
1186729939 X:12399046-12399068 AGGAAAAGGGATCCTCTGAGAGG - Intronic
1186919495 X:14262500-14262522 AGGAAGAGGGAGATTTTGAAGGG - Intergenic
1187021455 X:15387000-15387022 AGGACGTGGGAGGCTTTGGATGG + Intronic
1187768792 X:22672190-22672212 TAGAAGATGGGGCCTTTGGGAGG + Intergenic
1187850086 X:23583117-23583139 AGGAAGAGGGAGATTTTGGAGGG + Intergenic
1188283113 X:28294932-28294954 AGGAGATAGGAGCCTTTGGGAGG - Intergenic
1189576008 X:42354293-42354315 TAGGAGATGGAGCCTTTGGGAGG - Intergenic
1189699380 X:43701281-43701303 AGGAAGAAGGAGCCTCTGAGAGG - Intronic
1190298348 X:49041885-49041907 AGGAAGACAGATCCTTGGGGAGG - Intronic
1190688829 X:52897138-52897160 CGGAAGACGGAGCGGTTGGGTGG - Intronic
1190697154 X:52958654-52958676 CGGAAGACGGAGCGGTTGGGTGG + Intronic
1192547012 X:72022628-72022650 GGGGAGATGGGGCCTTTGGGAGG - Intergenic
1194307614 X:92267972-92267994 TGGAAGATGGGGCCTTTTGGGGG - Intronic
1195459685 X:105110263-105110285 AGGGAGAACGACCCTTTGGGAGG + Intronic
1195998017 X:110750770-110750792 CAGAAGAGGCAGCCTTTGGGTGG + Intronic
1196078257 X:111601472-111601494 AGGAAGCGGGGGCCTGTGGGGGG + Intergenic
1197532796 X:127651079-127651101 AGGAAATGGGGGCCTTTGCGAGG - Intergenic
1197662271 X:129187035-129187057 AGGAACAGGGAGCCATTAGAGGG + Intergenic
1198286880 X:135199858-135199880 AGGGAGGTGGGGCCTTTGGGAGG - Intergenic
1198528850 X:137529339-137529361 TAGAAGATGGAGACTTTGGGAGG + Intergenic
1198791563 X:140352455-140352477 AGGAAGGGGGAGCATTTTAGAGG + Intergenic
1200123540 X:153802606-153802628 GGGAACGGGGAGCCTCTGGGGGG - Exonic
1200211476 X:154348640-154348662 GGGCAGAGGGAGCCATTTGGTGG - Exonic
1200807272 Y:7445761-7445783 TGGAAGGTGGGGCCTTTGGGAGG - Intergenic