ID: 1069764285

View in Genome Browser
Species Human (GRCh38)
Location 10:70841614-70841636
Sequence GAGGAAGAGGGAGCCTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 6, 3: 66, 4: 631}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069764285_1069764299 24 Left 1069764285 10:70841614-70841636 CCCCCAAAGGCTCCCTCTTCCTC 0: 1
1: 0
2: 6
3: 66
4: 631
Right 1069764299 10:70841661-70841683 TTCAACATATGAATTTTTGGGGG 0: 28
1: 372
2: 1349
3: 2634
4: 3546
1069764285_1069764296 21 Left 1069764285 10:70841614-70841636 CCCCCAAAGGCTCCCTCTTCCTC 0: 1
1: 0
2: 6
3: 66
4: 631
Right 1069764296 10:70841658-70841680 GATTTCAACATATGAATTTTTGG 0: 182
1: 925
2: 2225
3: 3438
4: 4626
1069764285_1069764297 22 Left 1069764285 10:70841614-70841636 CCCCCAAAGGCTCCCTCTTCCTC 0: 1
1: 0
2: 6
3: 66
4: 631
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764285_1069764298 23 Left 1069764285 10:70841614-70841636 CCCCCAAAGGCTCCCTCTTCCTC 0: 1
1: 0
2: 6
3: 66
4: 631
Right 1069764298 10:70841660-70841682 TTTCAACATATGAATTTTTGGGG 0: 28
1: 444
2: 1606
3: 3278
4: 4796
1069764285_1069764292 -5 Left 1069764285 10:70841614-70841636 CCCCCAAAGGCTCCCTCTTCCTC 0: 1
1: 0
2: 6
3: 66
4: 631
Right 1069764292 10:70841632-70841654 TCCTCCTACCATCAGCTTGAGGG No data
1069764285_1069764291 -6 Left 1069764285 10:70841614-70841636 CCCCCAAAGGCTCCCTCTTCCTC 0: 1
1: 0
2: 6
3: 66
4: 631
Right 1069764291 10:70841631-70841653 TTCCTCCTACCATCAGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069764285 Original CRISPR GAGGAAGAGGGAGCCTTTGG GGG (reversed) Intronic
901167432 1:7230315-7230337 GAGGAAGAAAGAGTCTTTGAGGG + Intronic
902658833 1:17887444-17887466 GGGGAGGAGGGACCCTTGGGTGG + Intergenic
903163151 1:21503476-21503498 GAGGGAGAGGGAGACCGTGGGGG + Intergenic
903213084 1:21829443-21829465 GGGGAAGAGCGGGCCTGTGGAGG - Exonic
903336472 1:22627692-22627714 GATGATGTGGGAGCCATTGGGGG + Intergenic
903864282 1:26387023-26387045 CAGCACGAGGAAGCCTTTGGAGG - Intergenic
904255044 1:29249428-29249450 GAGGCTGGGGGAGCCCTTGGGGG + Intronic
904421959 1:30399834-30399856 GTGGAAGAGGGAGCAAGTGGAGG - Intergenic
904687309 1:32269934-32269956 GAGGAAAAGTGAGGCTTAGGAGG + Intronic
905070377 1:35220045-35220067 GAAGAGGAGGCTGCCTTTGGGGG + Intergenic
905646163 1:39626360-39626382 GAGGAGGAGGGGGCCTCTGATGG + Exonic
906113156 1:43337962-43337984 CAGGAAGAGGGAGCCCTGGGAGG + Intronic
906672420 1:47666044-47666066 TAGGAAGAGGGAGTGTCTGGAGG - Intergenic
907039883 1:51249467-51249489 GGGCAGGAGGGAGCCTTTTGGGG - Intronic
907522009 1:55030099-55030121 GTGGAGGGGGGAGCCATTGGAGG - Intergenic
907765787 1:57409137-57409159 GAGGCAGGTGGAACCTTTGGAGG - Intronic
907877161 1:58502302-58502324 GAGGAAGACAGAGCCTGTGTTGG - Intronic
907964927 1:59319756-59319778 CAGGCAGAGGGAGCCTGTGGAGG + Intronic
907969885 1:59370014-59370036 GAGGAACTGCGATCCTTTGGAGG - Intronic
907991614 1:59587897-59587919 GAGGAACTGCGATCCTTTGGAGG - Intronic
908257056 1:62311499-62311521 GAGGAGGAGGGAGGATGTGGAGG - Intronic
908455304 1:64297617-64297639 GAGGTAGTGTGATCCTTTGGAGG - Intergenic
908462209 1:64356820-64356842 GAGGAAGAGGGAGCGTTCCTGGG + Intergenic
908679256 1:66641482-66641504 GAGGAAGATGAAGCATTTGTAGG - Intronic
908826777 1:68140975-68140997 GAGGAGGGGGGAGGGTTTGGCGG - Intronic
908976962 1:69910227-69910249 GAGGAAGTGCGTTCCTTTGGAGG + Intronic
909505176 1:76379925-76379947 GAGGAAGGGGGAGGATATGGAGG + Intronic
909742851 1:79054209-79054231 GAGGAAGAGGAAGACTGGGGAGG + Intergenic
909846343 1:80399384-80399406 GAGGAACTGCGATCCTTTGGAGG + Intergenic
909874476 1:80784637-80784659 GAGGAATTGTGATCCTTTGGAGG - Intergenic
910911288 1:92237147-92237169 GAGGAACTGTGATCCTTTGGAGG + Intronic
911266959 1:95753909-95753931 GAGGAAGTGTGTGCCTATGGAGG - Intergenic
911359338 1:96858247-96858269 GAGGAACTGCGATCCTTTGGGGG + Intergenic
911612217 1:99969955-99969977 GCGGAAGCCGGAGCATTTGGGGG + Intronic
912226454 1:107739853-107739875 GGGGTAGAGGAAGCCTGTGGTGG - Intronic
912266870 1:108166832-108166854 GAGGAACAGCGTTCCTTTGGAGG + Intronic
913219282 1:116646325-116646347 GAGGAAGATGGAGAATTGGGGGG + Intronic
913264543 1:117031516-117031538 AAGGGAGAGAGAGCCTGTGGAGG + Intronic
914000220 1:143687837-143687859 GAGGAAGAGGGGGCATGAGGTGG - Intergenic
914197524 1:145455866-145455888 GAGGAAGAGGGGGCATGAGGTGG - Intergenic
914476628 1:148028959-148028981 GAGGAAGAGGGGGCATGAGGTGG - Intergenic
914509973 1:148323243-148323265 GAGGAAGAGGGGGCATGAGGTGG - Intergenic
915349028 1:155213147-155213169 GAGGAAGAGTCAGCCTTGGGAGG - Intronic
915352215 1:155233774-155233796 GAGGAAGAGTCAGCCTTGGGAGG - Intergenic
915354420 1:155247646-155247668 GAGGGAAAGGGACACTTTGGGGG + Exonic
916020145 1:160784174-160784196 GAGGAACTGCGATCCTTTGGAGG - Intergenic
917135678 1:171786135-171786157 GAGGCAGAGGGAGCCTTGGCAGG + Intronic
917444531 1:175095940-175095962 GAGCAGCAGGGAGCCTCTGGAGG + Intronic
918449520 1:184645096-184645118 GAGGAACAGGGTTCCTCTGGAGG - Intergenic
918583698 1:186162457-186162479 GAGGAACTGTGATCCTTTGGAGG + Intronic
918616479 1:186550351-186550373 GAGGAATTGCGATCCTTTGGAGG + Intergenic
918712971 1:187754410-187754432 GAGGATGGGGAAGCCATTGGTGG + Intergenic
919236482 1:194851352-194851374 GGGAAAGAGGGTGACTTTGGGGG - Intergenic
920194470 1:204217741-204217763 GAGGAGGAGGCAGCCCTTGTCGG + Intergenic
920653450 1:207855909-207855931 GAGGTAGAGGCAGTCTTGGGAGG - Intergenic
921049206 1:211499170-211499192 GAGGAAGACTGAGCCAGTGGTGG + Intergenic
921307045 1:213807817-213807839 GAGGAACTGCGATCCTTTGGAGG + Intergenic
922573331 1:226646448-226646470 GAGGAAGAGGGGGCTTGAGGAGG - Intronic
922823885 1:228503648-228503670 AAGGAAGGGGGAGCGTTTGGTGG - Intergenic
923543755 1:234908957-234908979 GATGAAGCTGGAGCCTCTGGAGG - Intergenic
923653635 1:235896972-235896994 GAAGAAGGGAGAGCCATTGGGGG - Intergenic
923936418 1:238765231-238765253 GAGGAAGAGGTCACCTGTGGGGG + Intergenic
924167804 1:241303291-241303313 GAGGAAGAGAGAGCAGTGGGAGG - Intronic
924299577 1:242623905-242623927 GAGGAACAGGGAGTCTCTGCAGG + Intergenic
1062793714 10:326316-326338 AGGGCAGAGGGAGCCTTCGGAGG + Intronic
1062829568 10:596759-596781 GAGAAATAAGGAGCCATTGGTGG + Intronic
1064173117 10:13051352-13051374 CAGGAAGATTGAGGCTTTGGTGG + Intronic
1064372664 10:14766565-14766587 GGGAAATAGGGAGCATTTGGAGG + Intronic
1065312440 10:24429618-24429640 GAAAAAGGGGGAGCATTTGGAGG - Intronic
1065621727 10:27588407-27588429 GAGGAGGTGTGATCCTTTGGAGG - Intergenic
1065808676 10:29420845-29420867 GAGGAAGAGGCTGCCTTGGCGGG - Intergenic
1067182899 10:44004039-44004061 GGGGAAGAGAGAGCCCTTGGAGG + Intergenic
1067344777 10:45429203-45429225 GAGGAAGAGGGAGACCCTGGAGG + Intronic
1067458764 10:46441805-46441827 AAGGCAGAGGGAGCCTTTAGTGG - Intergenic
1067498808 10:46784119-46784141 GAGGAAGAGGAATCCTAGGGAGG + Intergenic
1067595838 10:47556255-47556277 GAGGAAGAGGAATCCTAGGGAGG - Intergenic
1067628430 10:47942831-47942853 AAGGCAGAGGGAGCCTTTAGTGG + Intergenic
1067820459 10:49524324-49524346 GAGGCAGAGGGAGACTCTGAGGG - Exonic
1068516902 10:58036392-58036414 GAGGAATTGTGATCCTTTGGAGG + Intergenic
1068962456 10:62879451-62879473 GAGCATGAGGGAGCCTTCTGGGG + Intronic
1069059028 10:63874061-63874083 GAGGAAGAGAGAGTTGTTGGAGG + Intergenic
1069742500 10:70693983-70694005 CAGGAAGAAGGAGCTCTTGGAGG - Intronic
1069764285 10:70841614-70841636 GAGGAAGAGGGAGCCTTTGGGGG - Intronic
1069849956 10:71397920-71397942 GAGGAGCCGGGAGCCTTTTGCGG + Intronic
1070202241 10:74217972-74217994 GAGGAACTGCGATCCTTTGGAGG - Intronic
1070325571 10:75386684-75386706 AAGCAATAGGGAGCCATTGGAGG - Intergenic
1070690699 10:78522725-78522747 GAGGAAGTGGGAGTCCTGGGAGG + Intergenic
1071174498 10:82908867-82908889 GAGGGAGAGGAAGCCAATGGAGG + Intronic
1071174510 10:82908942-82908964 GAGGGAGAGGCAGCCAATGGAGG + Intronic
1071263514 10:83943041-83943063 GAGGAAGAGGAAGTTTATGGGGG - Intergenic
1071497803 10:86180658-86180680 CATGGAGAGGGAGCCTTTTGTGG - Intronic
1071538178 10:86454377-86454399 GAGGGAGAGGGAGATTGTGGAGG - Intronic
1072572837 10:96673502-96673524 AAGAAAGAGGAAGCCTTTCGGGG - Intronic
1072803162 10:98407459-98407481 GTGGAAGAGGGAGCCCTCAGGGG + Intronic
1072891565 10:99329578-99329600 GAGGAAGCTGGTGCCTTCGGCGG - Exonic
1072936266 10:99716612-99716634 GTGGAAGAGACAGCCTGTGGAGG - Intronic
1074472931 10:113743940-113743962 GAGGCAGAGGGAGCCTAAGAGGG - Intergenic
1075229009 10:120656289-120656311 GGACAAGAGGAAGCCTTTGGAGG - Intergenic
1075633978 10:124017997-124018019 GAGGAGGAGGAAGGCATTGGTGG - Intronic
1076141717 10:128084645-128084667 GAGGAAAATGGAGCTTTTTGAGG + Exonic
1076606417 10:131692437-131692459 AAGGAAGAGGGAGCCACTTGGGG - Intergenic
1076626572 10:131824687-131824709 GAGGAGGAGGGAGCCTGAGGAGG + Intergenic
1076657621 10:132035552-132035574 GAGGGAGTGGGTGCCTTTGGAGG - Intergenic
1077074381 11:693917-693939 GAGGAAGAGGGAGGACTGGGAGG + Intronic
1077464641 11:2727895-2727917 GAGGCAGAGGGAGCATCTGATGG + Intronic
1077530372 11:3092163-3092185 TTGGCAGAGGGAGACTTTGGGGG + Intronic
1078180367 11:9005346-9005368 GAGCAATAGGAAGCCTTTTGAGG - Intergenic
1078230336 11:9435792-9435814 GAGGAAGAGGCAGCCTGTTGAGG - Intronic
1079095861 11:17509687-17509709 AAGGCAGAGGGAGTCTTGGGGGG + Exonic
1079237447 11:18700425-18700447 GAGGAGGAGAGAGGCTGTGGTGG + Intronic
1079895584 11:26114598-26114620 GAGGAACTGTGATCCTTTGGAGG - Intergenic
1079909531 11:26292459-26292481 GAGGAGGTGCGATCCTTTGGAGG + Intergenic
1080017515 11:27522822-27522844 GAAGAAGAGAGAGCCTTGGCTGG - Intergenic
1080030039 11:27650693-27650715 GAGGAAGAGGGTGAACTTGGGGG - Intergenic
1081536670 11:44001844-44001866 GAGGAAGAAGGAGCCTGTCGGGG - Intergenic
1081970528 11:47195201-47195223 GTGCAAGAGGGGGCCCTTGGAGG + Intergenic
1082706045 11:56496548-56496570 GAGGAAGAGGGAGACCGTGGAGG - Intergenic
1083530811 11:63419804-63419826 GAGGAACTGCGAACCTTTGGAGG - Intergenic
1083690369 11:64404675-64404697 CAGGAGGAGGGAGGCTTTTGAGG + Intergenic
1084014089 11:66368595-66368617 GAGGAAGAGGGTGCTGTAGGTGG + Exonic
1084064172 11:66693868-66693890 GAGGAAGAGGGGGTCAGTGGAGG + Intronic
1084174761 11:67417464-67417486 GAGGAAGAGGGCCCCTGGGGAGG + Exonic
1084710445 11:70840698-70840720 CAGGAAGTGGGAGCCTGGGGAGG + Intronic
1084943253 11:72625554-72625576 GAGGAAAAGGCAGCCTGAGGAGG + Intronic
1085003503 11:73062381-73062403 GAGGAATTGTGATCCTTTGGAGG - Intronic
1085413429 11:76305431-76305453 GATGAAGAGGAGGCCTGTGGGGG + Intergenic
1085876102 11:80407224-80407246 GAGACAGTGGGATCCTTTGGAGG - Intergenic
1086491313 11:87360129-87360151 GAGAAGGAGGGAGCCTTTGCCGG + Intergenic
1086503192 11:87474316-87474338 GAGGAGGAAGGAGCATCTGGAGG + Intergenic
1086882951 11:92170496-92170518 GAGGAACTGCGATCCTTTGGAGG - Intergenic
1086884768 11:92192584-92192606 GAGTAATAGGAAGCCTTTGAAGG - Intergenic
1087947798 11:104185366-104185388 TAGTAAGATGGGGCCTTTGGAGG + Intergenic
1088429557 11:109743976-109743998 GAGGAAAAGGCAGCATTTGCAGG + Intergenic
1088580654 11:111312574-111312596 GAGGAGGAGGGAGCCATGAGGGG - Intergenic
1088757556 11:112898622-112898644 GAGGATGAGGGACCATGTGGAGG + Intergenic
1089751383 11:120653823-120653845 GAGGAAGAGGCAGGCTCTGAGGG + Intronic
1089780415 11:120869739-120869761 GAGGAAGAGGGGGCCTGGGGAGG + Intronic
1090040367 11:123285355-123285377 GAGGAAGAGGGTGGCATGGGAGG - Intergenic
1090042351 11:123302007-123302029 GAGGGAGAGGGCTCCTTTGAGGG - Intergenic
1090650307 11:128800364-128800386 GATGAAGAGAGAGGCTTTTGTGG + Intronic
1091280996 11:134381571-134381593 GGGGAAGAGGCAGACTTGGGGGG + Intronic
1091305953 11:134536184-134536206 GAGGAAGAGGGAGGCTTGCCAGG + Intergenic
1091720878 12:2812622-2812644 GAGGAAGAGGCAGAGATTGGAGG + Exonic
1092163856 12:6330558-6330580 GAGGGAGAGGGAGCTGGTGGGGG - Intronic
1092477896 12:8834723-8834745 GAGGAAGAATGAGAATTTGGTGG + Intronic
1092867749 12:12778932-12778954 GGGAAAGAGGGAGCCATTGAAGG - Intronic
1093268364 12:17027371-17027393 TATGAAGATGAAGCCTTTGGAGG - Intergenic
1093402422 12:18762010-18762032 GAGGAGTAGTGATCCTTTGGAGG - Intergenic
1093436270 12:19138622-19138644 GAGGAAGAGGCAGCCTAGGCTGG + Intronic
1093649462 12:21626613-21626635 GAGGAGCTGTGAGCCTTTGGAGG + Intergenic
1093664343 12:21794596-21794618 GAGGAATTGTGATCCTTTGGAGG + Intergenic
1093810424 12:23485875-23485897 GAGGAAGAGAGAGAATGTGGAGG + Intergenic
1094536488 12:31326091-31326113 GAGGAGGAGGGAGCGCTTGAGGG - Exonic
1094744856 12:33332816-33332838 GAGGAACTGCGATCCTTTGGAGG - Intergenic
1095126710 12:38487743-38487765 TAGGAAGAGGGAACCTTGGAGGG - Intergenic
1095151124 12:38797649-38797671 GAGGAACTGGGTTCCTTTGGAGG - Intronic
1098062684 12:66579360-66579382 GAGGAACTGCGATCCTTTGGAGG - Intronic
1098668785 12:73198676-73198698 GAGGAACTGCGATCCTTTGGAGG + Intergenic
1099041087 12:77655059-77655081 GAGGAAGTGCGATCCTTTGGAGG - Intergenic
1099284347 12:80697628-80697650 GAGGAAGAGGGAGAGTGTGGGGG - Intergenic
1099645236 12:85344610-85344632 GAGGAAGATGGAGCATTTATAGG + Intergenic
1100202608 12:92314955-92314977 GAGGAACAGCGTTCCTTTGGAGG - Intergenic
1100753521 12:97724805-97724827 GAGGAACTGGGTTCCTTTGGAGG - Intergenic
1101040803 12:100753508-100753530 GAGGAAGAGAGGGCCTTTATAGG - Intronic
1101957113 12:109221637-109221659 GAAGGAGCGGGAGGCTTTGGGGG + Intronic
1102196456 12:111028881-111028903 GAGGAAGAGGGAGCAGTTGCTGG + Intergenic
1102770092 12:115468328-115468350 GTGGCAGAGGCAGCCTTAGGTGG - Intergenic
1102915231 12:116747594-116747616 CAGCAGGAGGGAGGCTTTGGTGG - Intronic
1103198456 12:119066988-119067010 GAGAAGCAGGGAGCCTTTGATGG - Intronic
1103212359 12:119176206-119176228 GAGGCAGAGGGGTCCTCTGGAGG + Intergenic
1103255523 12:119538737-119538759 GAGGAACTGTGATCCTTTGGAGG + Intronic
1104183682 12:126407523-126407545 GGGGATGAGGGAGGTTTTGGAGG + Intergenic
1104878789 12:132054894-132054916 AATGAAGTGGAAGCCTTTGGAGG + Intronic
1104899812 12:132182756-132182778 GAGGAAGAGCGAGGCCTGGGGGG - Intergenic
1105462848 13:20608030-20608052 GGGGAAGAGGAGGCCATTGGTGG - Intronic
1105467619 13:20660762-20660784 GGGGAAGAAGCAGCTTTTGGAGG + Intronic
1105475303 13:20723541-20723563 GAAGAAAAGGGATCCTCTGGTGG + Intergenic
1106025924 13:25954942-25954964 GAGGAATTGTGATCCTTTGGAGG - Intronic
1107433657 13:40362611-40362633 GAGGAAGACAGAACCCTTGGAGG - Intergenic
1107448635 13:40489303-40489325 GAAGAAGAGGCAGCTTTTGAAGG - Intergenic
1107567692 13:41622848-41622870 GAAGAAAAGTGAGCTTTTGGAGG + Intronic
1107641832 13:42452214-42452236 GAGGAATTGTGATCCTTTGGAGG + Intergenic
1107746956 13:43520634-43520656 GAGGATTAGGGAGGCTTTGCCGG + Intronic
1108168133 13:47713238-47713260 GAGGAAGTGCGTTCCTTTGGAGG - Intergenic
1108628426 13:52255399-52255421 GAGGAACTGCGATCCTTTGGAGG - Intergenic
1108657632 13:52551050-52551072 GAGGAACTGCGATCCTTTGGAGG + Intergenic
1109270514 13:60250937-60250959 GAGGAACTGCGATCCTTTGGAGG + Intergenic
1109276978 13:60314192-60314214 GAGGAGGAGGTTGCCTTCGGAGG + Intergenic
1109320532 13:60804916-60804938 GAGGAACTGCGATCCTTTGGAGG + Intergenic
1109859138 13:68174039-68174061 TAGGAAGTGGGGGCCTTGGGAGG - Intergenic
1110119544 13:71865598-71865620 GAGGAGGACGGCGCCTTTGCTGG - Intronic
1110135625 13:72063380-72063402 GAGGAATTGTGATCCTTTGGAGG - Intergenic
1112159246 13:96851165-96851187 GAGGGAAAGGAAGCCCTTGGAGG - Intergenic
1113973753 13:114211209-114211231 GATGGAGAGGGAGCCATGGGGGG - Intergenic
1114216918 14:20664017-20664039 CAGAAAGAGGAAGCCTCTGGGGG - Intergenic
1114491457 14:23104772-23104794 GAGGAAGAGCGAGATTTTGAGGG + Intergenic
1114631771 14:24163878-24163900 GAGGAGGAGGGGGCCAGTGGGGG + Exonic
1115078517 14:29421291-29421313 GAGAAAGAGGGAGACATGGGGGG + Intergenic
1115704629 14:35986481-35986503 GAGCAAGGGGGACCCTTAGGGGG + Intergenic
1118821078 14:69346769-69346791 GAGGATGGGGGAGCCATGGGCGG - Intronic
1118833047 14:69452910-69452932 GAGGAAGTTGGGGCCATTGGGGG + Intronic
1120271667 14:82321131-82321153 GAGGAGTTGGGATCCTTTGGAGG + Intergenic
1121283976 14:92720309-92720331 AAGGAAAACGCAGCCTTTGGAGG + Intronic
1121615186 14:95309059-95309081 GAGGGAGAGGGAGGCTAGGGAGG + Intronic
1121939476 14:98055921-98055943 GAGGATCAGGGATCCTGTGGTGG - Intergenic
1122861971 14:104586777-104586799 GAGGAAGTGGGAGCCATGGAGGG + Intronic
1123449561 15:20351339-20351361 GAGGGACAGGGGGCCTTTGGTGG + Intergenic
1124152330 15:27192757-27192779 GAGGAACTGTGATCCTTTGGAGG + Intronic
1124513305 15:30346246-30346268 GAGGAACTGCGATCCTTTGGAGG + Intergenic
1124657599 15:31521834-31521856 GAGCAAGAGGGACCGTTTGGGGG - Intronic
1124729618 15:32184519-32184541 GAGGAACTGCGATCCTTTGGAGG - Intergenic
1125416653 15:39460882-39460904 GAGAGAGAGAGAGCCTTTGTGGG - Intergenic
1125676157 15:41503585-41503607 GAGGAAGAGGGGGCCGGAGGAGG - Intergenic
1128551656 15:68601523-68601545 TAGGATGAGGGTGCCTGTGGGGG + Intronic
1128745555 15:70111724-70111746 GGGGCAGAGGGAGGCTTGGGGGG + Intergenic
1128929822 15:71694101-71694123 GATGAAGGTGGACCCTTTGGTGG + Intronic
1128942182 15:71798062-71798084 GAGGAACTGCGATCCTTTGGAGG + Intronic
1128973825 15:72133278-72133300 GAGGAAGTGGGAGCCATTAATGG - Intronic
1129097077 15:73220967-73220989 GAGGAACTGGGTTCCTTTGGAGG + Intronic
1129413323 15:75361489-75361511 GAGGCAGAGTGAGGGTTTGGTGG + Intronic
1129781834 15:78277482-78277504 GAGGAAATGGGTGCCTTGGGAGG - Intronic
1130078483 15:80710376-80710398 CAGGAAATGGGAGCCATTGGAGG + Intronic
1130452717 15:84073166-84073188 GAGGAACTGCGATCCTTTGGAGG - Intergenic
1130645187 15:85719248-85719270 GCGGAAGAAGGAGTCTCTGGTGG + Exonic
1131091300 15:89626595-89626617 CAGGAGGAGGGGGCCTTTGGTGG + Intronic
1131229010 15:90646954-90646976 GAGGAAGAGGAGGTGTTTGGAGG - Intergenic
1131279594 15:91009800-91009822 GAGGAAGAGGGAATCTATGGAGG - Exonic
1131931945 15:97452419-97452441 GAGGAAGACTGAGGCTTTGTGGG + Intergenic
1132768223 16:1545887-1545909 AGGGAAGAGGGAGCCTTGAGGGG - Intronic
1132827310 16:1911752-1911774 GAGGCAGGGGAAGCCCTTGGTGG + Exonic
1134197179 16:12168270-12168292 GTGGAGGGAGGAGCCTTTGGGGG + Intronic
1134333480 16:13271753-13271775 GAGGATGAGGGATCTTATGGGGG + Intergenic
1134649561 16:15898056-15898078 AAGGAAGAGAGAGAGTTTGGGGG - Intergenic
1135205315 16:20478981-20479003 GAGGGAAAGGCAGCCCTTGGGGG - Intronic
1135213589 16:20544831-20544853 GAGGGAAAGGCAGCCCTTGGGGG + Intronic
1135932234 16:26747819-26747841 GAGAAAGAGAGAGCATATGGGGG - Intergenic
1136057108 16:27698661-27698683 GAAGAAAAGGGAGCCTTAGCAGG - Intronic
1136459388 16:30400279-30400301 GAGGAAGAGGGGGCGTGTGGGGG + Intergenic
1137439220 16:48483867-48483889 GAGAGAGAGGGAGACTGTGGAGG + Intergenic
1137606414 16:49789617-49789639 GAGGAAGAAGGAACATTTGTGGG + Intronic
1137803593 16:51283546-51283568 GAGCAACAGGGAGCCTTTGAGGG + Intergenic
1138294856 16:55877500-55877522 GTGGAAGAGTAAGACTTTGGTGG - Intronic
1139052980 16:63148236-63148258 GAGGAACTGCGATCCTTTGGAGG - Intergenic
1139326370 16:66155551-66155573 GAAGAAAAGGGTGCCATTGGTGG - Intergenic
1139498724 16:67342719-67342741 GAGGAAGAAGCAGTATTTGGGGG - Intronic
1140106428 16:71964690-71964712 GAGGGATAGGGAGCTTTTGGGGG - Intronic
1140353536 16:74285261-74285283 GAGGAAGAGAGAGACTGGGGGGG + Intergenic
1140466673 16:75188630-75188652 GAGGAAGGGGTCTCCTTTGGGGG + Intergenic
1142011639 16:87718363-87718385 GAGGGAGAGGGAGACTGTGGAGG - Intronic
1142283317 16:89160602-89160624 GTGGAAGAGGGAGGCCATGGCGG + Intergenic
1142550191 17:733292-733314 GAGGAAGAAGGAGCCCATTGTGG - Intronic
1142878861 17:2869112-2869134 GAGGAAGAGGGGCCTTTGGGAGG - Intronic
1144091946 17:11866058-11866080 GAGGAACTGTGATCCTTTGGAGG + Intronic
1144248342 17:13390879-13390901 GAGACAGAGGGAGACTTTGGGGG - Intergenic
1144625692 17:16843419-16843441 CAGGTAGAGGGAGCCTCTGCGGG + Intergenic
1144704600 17:17359082-17359104 AATGAAGAGGGAGCCTTTGCTGG + Intergenic
1144880739 17:18429301-18429323 CAGGTAGAGGGAGCCTCTGCGGG - Intergenic
1145072136 17:19819718-19819740 GAGGAAGAGTGAGACCTTGCTGG - Intronic
1145151496 17:20515086-20515108 CAGGTAGAGGGAGCCTCTGCGGG + Intergenic
1145937502 17:28723506-28723528 GAGGAAGGGGGAGGGTGTGGGGG + Intronic
1146065519 17:29631875-29631897 GAGGCAGAGGTAGCACTTGGGGG + Exonic
1146162846 17:30569336-30569358 CAGGTAGAGGGAGCCTCTGCGGG + Intergenic
1146530341 17:33603066-33603088 GAGGAAGATGGGGCTTCTGGAGG - Intronic
1147133650 17:38423004-38423026 GAGGAAGAAGGGGTCTTGGGAGG - Intergenic
1147260014 17:39204382-39204404 GTTGAAGCAGGAGCCTTTGGTGG + Intronic
1147579849 17:41622107-41622129 TAGGTAGAGGGAGCCTCTGCAGG + Intronic
1147913286 17:43870779-43870801 GAGGTAGAGGGACCTGTTGGGGG + Intergenic
1148749772 17:49938828-49938850 CAGGCAGAGGAAGCCTTTGTGGG - Intergenic
1148853032 17:50563908-50563930 GAGAAAGAGGGAGGCCCTGGAGG - Intronic
1148863839 17:50618524-50618546 GAGGAGGAGGGAGTGTTTGGGGG - Intronic
1148909990 17:50936819-50936841 CAGGAGGAGGGAGGATTTGGGGG - Intergenic
1150074126 17:62178256-62178278 GAGCATGAGAGAGCTTTTGGGGG + Intergenic
1150227557 17:63532103-63532125 GAGGCAGTGGGAGATTTTGGGGG + Intronic
1150347288 17:64413955-64413977 GGGCAAGAGGGAACTTTTGGGGG + Intergenic
1152171522 17:78753011-78753033 AAGGAAGAGTAAACCTTTGGGGG - Intronic
1152190346 17:78884138-78884160 GAGGCAGAGGGAGCCTGGAGAGG + Intronic
1152339070 17:79714551-79714573 GAGGGACGGGGGGCCTTTGGTGG - Intergenic
1152358528 17:79818636-79818658 GAGGAAATGGGTGCCTTGGGAGG - Intergenic
1152465295 17:80462822-80462844 GGGGAAGATGGAGGCTTGGGAGG + Intergenic
1152791803 17:82284029-82284051 GAGGAACAGGGAGGCATTGAAGG + Intergenic
1155523727 18:26695555-26695577 GAGGATGAGGGACCATGTGGAGG - Intergenic
1156171338 18:34490101-34490123 CAGGAAGAAGGAGACATTGGGGG + Intergenic
1156480447 18:37433153-37433175 GGGGAAGAGGGGGCCATTGTAGG - Intronic
1156979156 18:43264850-43264872 GAGGAATTGTGATCCTTTGGAGG + Intergenic
1157242971 18:46028345-46028367 GATGAAGCGGCAGCCTTTTGGGG - Intronic
1157319704 18:46624545-46624567 AAGGAAGAGGAAACCTTTTGGGG - Intronic
1157466773 18:47954108-47954130 GTGGAAAGGGCAGCCTTTGGGGG - Intergenic
1158093292 18:53740787-53740809 GAGGAAGAGGGTACGTTTGGGGG + Intergenic
1159615035 18:70570339-70570361 GAGGGAGAGGGAGACCGTGGGGG + Intergenic
1159615044 18:70570363-70570385 GAGGGAGAGGGAGACCGTGGGGG + Intergenic
1159615053 18:70570387-70570409 GAGGGAGAGGGAGACCGTGGGGG + Intergenic
1159615062 18:70570411-70570433 GAGGGAGAGGGAGACCGTGGGGG + Intergenic
1159677486 18:71303965-71303987 GAGGAAGAGGGAGCAGGGGGAGG - Intergenic
1160322027 18:77905429-77905451 GTGGAAGAGGCGGCCCTTGGGGG - Intergenic
1160900179 19:1424080-1424102 GAGGAAGAGGGAGGAGGTGGCGG - Intronic
1160965746 19:1746230-1746252 GAGGAAGAGGGAGGGTGAGGAGG + Intergenic
1161241525 19:3225908-3225930 GAGGAGGAGGGAGGCGTGGGCGG + Intronic
1161694396 19:5757968-5757990 GAGGAAGAGGGGGCCTCTCAAGG - Intronic
1161715685 19:5874976-5874998 GGGCAATAGGGAGCCATTGGAGG + Intronic
1162251444 19:9447345-9447367 GAGTGAGAGTGACCCTTTGGTGG - Intergenic
1162397219 19:10424211-10424233 GAGGAAGAGGAGGACTTTGGTGG + Intronic
1162467787 19:10852874-10852896 CAGGAGGGAGGAGCCTTTGGTGG + Intronic
1162470187 19:10868436-10868458 GAGGAGGAGGTAGACTTTTGAGG + Intronic
1162735559 19:12745257-12745279 GGGCCAGAGGGAGCCTGTGGTGG - Intronic
1164669115 19:30063020-30063042 GAGGAACAGGGAGCCAATTGTGG + Intergenic
1165449252 19:35872698-35872720 GGGGCTTAGGGAGCCTTTGGAGG - Intronic
1165822003 19:38682683-38682705 TAAGAAGAGGAAGCCTTTGGAGG - Intronic
1165897707 19:39153210-39153232 GAGGGACTGGGAGCTTTTGGGGG - Intronic
1166748401 19:45152880-45152902 GAGGAAGAGGTAGCCGTTATCGG + Exonic
1167710433 19:51107193-51107215 GAGGAGATGGGAGCCTTGGGAGG + Intronic
1168302050 19:55410689-55410711 GAGCAATGGGGAGCCATTGGTGG + Intergenic
1168328868 19:55554462-55554484 GAGCAATAGGGAGCCATGGGAGG - Intergenic
1168344210 19:55642575-55642597 GGGAAAGGGGGAGCCTTGGGGGG - Exonic
925126546 2:1461247-1461269 GTGGAGGAAGGAGCCTCTGGGGG - Intronic
925268145 2:2581661-2581683 GAGGAAGACGGGATCTTTGGGGG - Intergenic
925854729 2:8118484-8118506 GAGGCAGAAGGAGGCTTGGGGGG + Intergenic
926627689 2:15106768-15106790 CAGGTAGAGGGAGCATTAGGAGG + Intergenic
927704856 2:25290782-25290804 GGGGAAGGGGGATCCTGTGGGGG + Intronic
928028817 2:27761627-27761649 GAGGGAGGGAGAGCCTGTGGAGG - Intergenic
930869304 2:56153876-56153898 GAGGTTGAGGTAGCATTTGGGGG + Intergenic
931208370 2:60169280-60169302 GTGGAAGAGGAGGCCTGTGGAGG - Intergenic
931887365 2:66632126-66632148 GAGGAAGTGTGTTCCTTTGGAGG + Intergenic
932999614 2:76905450-76905472 GAGGAACTGCGATCCTTTGGAGG - Intronic
933638999 2:84739915-84739937 GAGCTAGTGGGATCCTTTGGAGG + Intronic
934531706 2:95093826-95093848 GAGGAGCTGGGATCCTTTGGTGG - Intronic
934678509 2:96266226-96266248 GCGGAAGCGGGAGCCTCTGTCGG + Exonic
934941422 2:98505459-98505481 GAGGACGTGGGAGCTTTTGTAGG + Intronic
935217374 2:100984997-100985019 GAGCAAGAGGCAGCCTTGGAGGG - Intronic
935566052 2:104608413-104608435 GAGGAGCTGGGATCCTTTGGAGG - Intergenic
935665184 2:105505895-105505917 GAGGAAGATGGAGGCATTGAAGG - Intergenic
936376814 2:111947971-111947993 CAGGAAGTGTGAGCCCTTGGGGG + Intronic
936937228 2:117850156-117850178 GAGGGAGAGGGAGCACGTGGAGG - Intergenic
937143262 2:119619682-119619704 GAGGAATTGTGATCCTTTGGAGG - Intronic
937955587 2:127420241-127420263 GTGGAGGAGGGAGCTTTAGGAGG - Intronic
939239269 2:139537863-139537885 GAGGAACTGCGATCCTTTGGAGG + Intergenic
940449595 2:153819868-153819890 GAGCTAGAGTGATCCTTTGGTGG - Intergenic
940814144 2:158279229-158279251 GAGGAACTGCGATCCTTTGGAGG - Intronic
941565245 2:167098590-167098612 GAGGAATTGTGATCCTTTGGAGG + Intronic
941606576 2:167604862-167604884 AAGGAAGAGTGAGCCTTTCAGGG + Intergenic
942802482 2:179891649-179891671 AAGGAGCAGGGAGCCTCTGGAGG + Intergenic
942891618 2:180996614-180996636 GGGGAAGAGGCAGGTTTTGGTGG - Intronic
943130088 2:183842969-183842991 GAGGAATTGTGATCCTTTGGAGG - Intergenic
943629354 2:190233470-190233492 GTGGAAGAGGGAGCTTGTGCAGG - Intronic
944018416 2:195072565-195072587 GAGGAAGTGCGTTCCTTTGGAGG + Intergenic
944861073 2:203816553-203816575 CAGGAAGAGGCACCCATTGGAGG + Intergenic
945139318 2:206667130-206667152 AATGAAGAGGGAGCCCCTGGAGG - Intronic
945530646 2:210950140-210950162 GAGGGAGAGGGAGACTGTGGGGG - Intergenic
945927529 2:215820421-215820443 GAGGAGTTGTGAGCCTTTGGAGG - Intergenic
945945814 2:215994638-215994660 GAGGAGGAGGAAGCTTCTGGAGG + Intronic
945976874 2:216277793-216277815 GAGGAAGAGGGAGCCCAGGATGG + Exonic
947305101 2:228736962-228736984 GAGAAAGAGACAGGCTTTGGGGG - Intergenic
947577866 2:231291227-231291249 GAGGAAGAGGATACCTTGGGTGG - Intronic
948080641 2:235202688-235202710 GAGGAGGAGGGAGCCTGCGTGGG + Intergenic
948107028 2:235422452-235422474 GAGGAAGAGAGAGATTCTGGGGG + Intergenic
948410902 2:237759854-237759876 GAGAAAGAAGTAGCCTTTGGAGG + Intronic
948415756 2:237802099-237802121 GAGTAAGAGTTAGCCATTGGGGG - Intronic
948652751 2:239458790-239458812 GGGGCAGGGGGAGCTTTTGGAGG - Intergenic
948750314 2:240128447-240128469 GAGGGCGAGGGAGCCTTCTGGGG - Intronic
949059684 2:241949600-241949622 GAGGCAGAGGGAGCCAGGGGAGG + Intergenic
1168876235 20:1174147-1174169 GAGGAATAGGGAGAGATTGGAGG + Intronic
1170071832 20:12377612-12377634 GAGGAAAACAGAGCCTTTGGAGG + Intergenic
1170097556 20:12663238-12663260 GAGGAACTGCGATCCTTTGGAGG - Intergenic
1170816815 20:19720934-19720956 GAGGAGGCAGCAGCCTTTGGGGG - Intronic
1171282648 20:23914017-23914039 GAGGCAGAAAGAGCCTTGGGAGG - Intergenic
1171284067 20:23923462-23923484 CAGGAAGAGGAAGCCCCTGGAGG + Intergenic
1171565410 20:26180579-26180601 GAGGAAGAGGGATCAATAGGTGG + Intergenic
1172134777 20:32679630-32679652 GGGGAGGAGGTAGCCTCTGGAGG - Intergenic
1172152461 20:32800144-32800166 GAGGACTAGGTAGCCTGTGGGGG - Exonic
1172913098 20:38424721-38424743 GAGGCAGAGAGAGCTTCTGGGGG + Intergenic
1173417128 20:42866526-42866548 GAGCAGCAGGGAGCCTGTGGTGG - Intronic
1173873894 20:46357822-46357844 GAGGAAGAGGGAGCCGGTGGGGG - Intronic
1174080980 20:47970603-47970625 AGGGAAGTGGGAGCCATTGGAGG - Intergenic
1174183987 20:48692730-48692752 GATGTAGAGGGAGCCGTTGATGG + Exonic
1174424129 20:50420074-50420096 GAGGGAGCGGGAGCCCTGGGAGG - Intergenic
1175892294 20:62321205-62321227 GAGGAAGAGGGGGCCAGTGGAGG + Intronic
1175892327 20:62321291-62321313 GAGGAAGAGGGGGCCAGTGAAGG + Intronic
1175892415 20:62321546-62321568 GAGGAAGAGGGGGCCAGTGGAGG + Intronic
1176169495 20:63690562-63690584 GAGGGAGAGGCAGCCTTTGGAGG - Intronic
1178019572 21:28393930-28393952 GAGAAGGAAGGAGCCTTTGCTGG + Intergenic
1178873286 21:36393214-36393236 GAGGGAGAGGGAGACGGTGGAGG + Intronic
1179166106 21:38936491-38936513 GAGGAAGAGGGAGCTGTAAGTGG - Intergenic
1179808486 21:43855000-43855022 GAGGCAGAGGGGGCTTGTGGTGG + Intergenic
1180090465 21:45531291-45531313 GCGGGAGAGGGAGCCTCCGGGGG + Intronic
1180523941 22:16236136-16236158 GAGGAACTGTGATCCTTTGGAGG - Intergenic
1180857826 22:19059428-19059450 GAGGAAGTGGGAGGCCCTGGAGG - Intronic
1181174490 22:21027997-21028019 CAGGAAGAGGGTGGCTTTGCTGG - Exonic
1181364798 22:22367643-22367665 GAGTAAGCGAGATCCTTTGGAGG - Intergenic
1181487706 22:23241914-23241936 GAGGAAGAGGGTGATTTTGTGGG - Intronic
1181880400 22:25974896-25974918 GGGGAAGAAGGAGACTTTGGAGG + Intronic
1182278341 22:29204396-29204418 GAGGGAGAGGGAGCCCTTGGGGG + Intergenic
1183597602 22:38822040-38822062 GAGGAAGAGGGAGGCATGGGTGG + Exonic
1184327183 22:43797820-43797842 GAGGCAGAGGGAGCCGGGGGAGG - Intronic
1184433964 22:44458817-44458839 GCAGAAGCTGGAGCCTTTGGGGG - Intergenic
1184851982 22:47126299-47126321 AAGAAAGAGGGAGCCTTTTCAGG + Intronic
1185235890 22:49712725-49712747 GAGGAAGAGGGGGGCTTTAGTGG - Intergenic
949404904 3:3703821-3703843 GAGGAAGAGAGAGAGTTGGGAGG + Intronic
949585288 3:5431207-5431229 GAGGATGAAGGAGCCTTTCAAGG + Intergenic
949768001 3:7548275-7548297 GAGCAAGAGAGAGACTTAGGAGG - Intronic
949778784 3:7662267-7662289 GAGGAATAAGGAACTTTTGGAGG + Intronic
949940441 3:9150350-9150372 GAGGAAAAGGGAGCCTGGAGAGG + Intronic
950121940 3:10487836-10487858 GAGGCAGTGGGAGCCATTGCAGG - Intronic
950206059 3:11082061-11082083 GAGGCTGAGGGAACCTTTGGAGG + Intergenic
951071096 3:18330321-18330343 GAGGAACTGAGATCCTTTGGAGG + Intronic
952652837 3:35747014-35747036 GTGGAAGAGGAAGCCTATGTTGG + Intronic
953100466 3:39820840-39820862 GAGCATGAAGGAGCCTTTAGGGG - Intronic
953768360 3:45760946-45760968 GCGGAAGAGGCAGCCTTGGCGGG + Intronic
954980005 3:54737341-54737363 GAGGAGGAGGGGTCTTTTGGAGG + Intronic
955255376 3:57325671-57325693 GAGGAACTGTGATCCTTTGGAGG - Intronic
956965571 3:74455541-74455563 GAGGAACTGCGATCCTTTGGAGG + Intronic
957194207 3:77047076-77047098 GAGGAAGAGTGGGATTTTGGTGG + Intronic
957868235 3:86051736-86051758 GAGGAAGAGAGAGCCGAGGGAGG + Intronic
958512301 3:95064844-95064866 GAGGAACAGCGTTCCTTTGGAGG + Intergenic
958897116 3:99841550-99841572 GAGGACGAGGTAGGCTTTGTAGG + Intronic
958994674 3:100890359-100890381 GGGGAAGAGAGACCCTTTAGAGG - Intronic
960238867 3:115317357-115317379 GAGGAACTGCGATCCTTTGGAGG + Intergenic
962020534 3:131496566-131496588 AAGGAAAAGGGAAGCTTTGGAGG - Intronic
962198506 3:133382545-133382567 ACGGAAGAGGGAGCCGATGGTGG + Intronic
962634662 3:137318628-137318650 GAGGAATTGTGATCCTTTGGAGG + Intergenic
962935540 3:140077275-140077297 AAGGAAGAGGTAGCCACTGGCGG - Intronic
963081130 3:141394618-141394640 AAGGAAGAGGAAGGCTCTGGGGG - Intronic
965234198 3:166093927-166093949 GAGGCAGAGGGAGAGATTGGGGG + Intergenic
965302010 3:167017490-167017512 GAGGGAGAGGGAGACCGTGGAGG - Intergenic
965302034 3:167017577-167017599 GAGGGAGAGGGAGACCGTGGAGG - Intergenic
965302044 3:167017608-167017630 GAGGGAGAGGGAGACCGTGGAGG - Intergenic
965302052 3:167017633-167017655 GAGGGAGAGGGAGACCGTGGAGG - Intergenic
965302110 3:167017850-167017872 GAGGGAGAGGGAGACCGTGGAGG - Intergenic
965302120 3:167017881-167017903 GAGGGAGAGGGAGACCGTGGAGG - Intergenic
965302128 3:167017906-167017928 GAGGGAGAGGGAGACCGTGGAGG - Intergenic
965729517 3:171755907-171755929 TAGGAAGAGGGAGTGTTTTGTGG - Intronic
967106070 3:186256026-186256048 GAGGGAGAAGTAGGCTTTGGCGG - Intronic
967972018 3:195006106-195006128 GAGGAAGAGGGACCCTAATGTGG + Intergenic
968224920 3:196967518-196967540 GCGGGAGAAGCAGCCTTTGGTGG - Intronic
968635675 4:1677427-1677449 GAAGAGGAGGGAGCCCTTGGGGG - Intronic
968755836 4:2416334-2416356 GTGGAAGAGGCCGCATTTGGGGG - Intronic
969232151 4:5839470-5839492 GAGGCAGCTGGGGCCTTTGGAGG - Intronic
969256703 4:6007385-6007407 GAGGGAGAGGGAGCCTTCTGGGG - Intergenic
969309977 4:6347462-6347484 TTGGAAGAGGGAAGCTTTGGGGG + Intronic
969444744 4:7238275-7238297 GAGGTAGAGGGAGTCTGGGGGGG + Intronic
969584423 4:8083871-8083893 GTGGAAGAGGGAGCCTTTTGGGG - Intronic
969591782 4:8126321-8126343 GGGGAGGAGGGAGCCGCTGGAGG + Intronic
970007881 4:11428234-11428256 TCGGCTGAGGGAGCCTTTGGGGG - Intronic
970570739 4:17379880-17379902 GAGGGAGAGGGAGTCTGGGGAGG - Intergenic
972028929 4:34427743-34427765 GAGGAAGAGGGATCAATAGGTGG + Intergenic
972633131 4:40859012-40859034 GAAGGAGAGGCAGCCTTTGAAGG - Intronic
972674649 4:41248567-41248589 GGGCAAGAGGGAGCTTTTGTGGG + Intergenic
972789640 4:42358561-42358583 GAGGAACAGAGCACCTTTGGGGG + Intergenic
972958957 4:44428633-44428655 GAGGTACAGGGACCTTTTGGAGG - Intronic
973015052 4:45127672-45127694 GAGGAAGAGAGAGCATGGGGAGG - Intergenic
973362001 4:49174845-49174867 GAGGAACAGCGTTCCTTTGGCGG + Intergenic
973399092 4:49622014-49622036 GAGGAACAGCGTTCCTTTGGCGG - Intergenic
974142168 4:57900702-57900724 GAGGAACTGCGATCCTTTGGAGG - Intergenic
974211252 4:58779072-58779094 GAGGAAGTGCGTTCCTTTGGAGG - Intergenic
975528834 4:75379200-75379222 GAGGAGCTGTGAGCCTTTGGAGG - Intergenic
975744534 4:77463641-77463663 GAGGAGGAGTGATCCTTTGGAGG + Intergenic
976039029 4:80860449-80860471 GAGGAACTGCGATCCTTTGGAGG + Intronic
976276967 4:83287906-83287928 AAATAAGAGGGAGCCATTGGAGG + Intergenic
976344994 4:83990044-83990066 GGGGAAGGGGAAGCCTCTGGTGG - Intergenic
976354091 4:84095278-84095300 GGGGAAGAGGGACCTTTGGGAGG + Intergenic
976403704 4:84637445-84637467 GAGGAAGAGGGAGAGTGAGGAGG + Intronic
976683011 4:87778253-87778275 GAAGAAGAGGGAACAGTTGGTGG - Intergenic
976713441 4:88098462-88098484 GAGAAAGACGGTGCCTTTTGGGG - Intronic
976853307 4:89574605-89574627 GAGGAAGAGGAATATTTTGGGGG - Intergenic
977723358 4:100266820-100266842 GAGGAATTGTGATCCTTTGGAGG + Intergenic
978278205 4:106977784-106977806 GAGGAATTGTGATCCTTTGGAGG + Intronic
978418529 4:108504216-108504238 GAGGAAGTGTGTTCCTTTGGAGG - Intergenic
979005381 4:115288568-115288590 GAGCTAGTGGGAGCCTTTGAAGG + Intergenic
979768259 4:124489766-124489788 GAAGAAGAAGGAACCTTTAGAGG + Intergenic
980729911 4:136811996-136812018 GGGGAAGGGGGAGCCTTTCTGGG + Intergenic
981456899 4:144962851-144962873 TAGGAATAGGGAGACCTTGGAGG - Intergenic
982284315 4:153718810-153718832 GAGTAAGATAGAGCCTATGGTGG + Intronic
982723263 4:158881189-158881211 GAGGGAGAGGGAGACCGTGGAGG - Intronic
983070414 4:163261377-163261399 GAAGCAGAGGGAGTTTTTGGGGG - Intergenic
984254876 4:177379918-177379940 CAGAAAGAGGGAGCCCATGGGGG - Intergenic
984714858 4:182916734-182916756 GAGGGAGGGGGAGCCATGGGGGG + Intronic
984804409 4:183737779-183737801 GAGGGAGAGGGAGACCGTGGAGG + Intergenic
985015235 4:185626964-185626986 GAGGAAGAGCGAGCCTGCAGTGG - Exonic
985134435 4:186771448-186771470 GAGGAAGAGGATGTCCTTGGTGG - Intergenic
985575384 5:671294-671316 TAGGAAGAGGTGGCCCTTGGTGG + Intronic
985621807 5:959903-959925 GAGGACGAGGGAGCTTCAGGGGG - Intergenic
985672444 5:1213539-1213561 GAGGAAGACGATGCCATTGGTGG - Exonic
985759483 5:1737752-1737774 CAGGAAGAAGGCGCCTTTGTAGG - Intergenic
985827178 5:2201177-2201199 GATGAAGATGGAGCCCTGGGAGG - Intergenic
986147637 5:5093977-5093999 GGGGCAGAGCGAGCCCTTGGTGG + Intergenic
986868433 5:12017191-12017213 GAGCAAGAGGGAGCTGTGGGTGG - Intergenic
987304101 5:16621634-16621656 GAGCAACAGGGAGCCATGGGTGG + Intergenic
988052036 5:26042923-26042945 GAGCTAGTGGGATCCTTTGGAGG - Intergenic
988649299 5:33130840-33130862 GAAGAAGAGAGAGCTTGTGGAGG - Intergenic
989618925 5:43366212-43366234 GAGGAATTGTGATCCTTTGGAGG + Intergenic
989703429 5:44298224-44298246 GAGGTGGAGGGGGCCTTCGGAGG + Intergenic
990369015 5:55097622-55097644 GAGGAACTGCGATCCTTTGGAGG - Intergenic
991035605 5:62124525-62124547 GAGAAAAAGGGAGCCTGCGGAGG + Intergenic
991193666 5:63906193-63906215 AGGGAAGAGAAAGCCTTTGGAGG - Intergenic
991241831 5:64469809-64469831 GAGGAACTGGGTTCCTTTGGAGG + Intergenic
991242792 5:64478186-64478208 GAGGAACTGGGTTCCTTTGGAGG - Intergenic
992150937 5:73902417-73902439 GTGGAAGAGGGAGACTTTAGGGG - Intronic
992329074 5:75696660-75696682 GAGGAACTGCGATCCTTTGGAGG - Intronic
992566772 5:78003935-78003957 GTGGAAAAGGGAGGCTTGGGAGG - Intronic
992984202 5:82210873-82210895 GAGGAAGTTGGAGAGTTTGGAGG + Intronic
993259418 5:85639432-85639454 GAGGAAGTGCGTTCCTTTGGAGG - Intergenic
993261426 5:85662638-85662660 GAGGAAGTGCGTTCCTTTGGAGG + Intergenic
993798658 5:92302011-92302033 GAGGAAGTGTGTTCCTTTGGAGG + Intergenic
993891808 5:93483542-93483564 GAGGAGTAGTGATCCTTTGGAGG - Intergenic
994224727 5:97239309-97239331 GAGGAACTGTGATCCTTTGGAGG + Intergenic
994981208 5:106876437-106876459 GAGAAGGAGCGAGCCTTTGTCGG - Intergenic
995263676 5:110135077-110135099 GAGGAATTGTGATCCTTTGGAGG + Intergenic
995413304 5:111881930-111881952 GAGGAACTGTGATCCTTTGGAGG - Intronic
995771520 5:115675609-115675631 GAGGAACTGTGATCCTTTGGAGG - Intergenic
995815843 5:116166942-116166964 GAGGAACTGTGATCCTTTGGAGG - Intronic
996002819 5:118384058-118384080 GAGGAACTGCGATCCTTTGGAGG - Intergenic
996130066 5:119770625-119770647 GAGGAATTGTGATCCTTTGGAGG - Intergenic
997256358 5:132431276-132431298 GAGTTGGAGGGAGACTTTGGGGG + Intronic
997321805 5:132983927-132983949 GAGGGAGAGGGAGACCGTGGGGG + Intergenic
998302711 5:141040320-141040342 GAGGAAGAGGGAGTGTCTGAGGG + Intergenic
998367907 5:141642970-141642992 AAGGAACTGGGAGCCTTGGGAGG - Intronic
998630658 5:143894637-143894659 GAGAAAGAGGCTGCTTTTGGGGG - Intergenic
999150735 5:149424374-149424396 GAGTAGGAGGGAGCCTTTGGTGG + Intergenic
999230165 5:150057187-150057209 GAGGAAACGGGAGCCTGTGAGGG - Intronic
999477827 5:151917566-151917588 GAGCAAGAGGAAACTTTTGGGGG - Intronic
1000798253 5:165692457-165692479 GAGGAATTGTGATCCTTTGGAGG + Intergenic
1001036331 5:168299452-168299474 GAGGCAGAGGGACTCTTTGAAGG + Intronic
1001198279 5:169693221-169693243 GAGGAAGAGGCAAGCATTGGAGG + Intronic
1001436841 5:171705753-171705775 AAGGAAGAGGGAGACGGTGGTGG - Intergenic
1002010994 5:176281469-176281491 GAGGAACTGCGATCCTTTGGAGG + Intronic
1002452336 5:179326023-179326045 GACGGAGAGGCAGCCTTTGTTGG - Intronic
1002579854 5:180201266-180201288 GAAGTAGAGGCAGCCTTCGGAGG + Intronic
1002693716 5:181070339-181070361 GAGGCAGACGGAGTCCTTGGCGG - Intergenic
1003115106 6:3278377-3278399 GAGGAAGAGCAAGAATTTGGGGG + Intronic
1003296553 6:4835112-4835134 GAGGAACTGCGATCCTTTGGAGG + Intronic
1003464291 6:6363711-6363733 GAGGAAGCTGAAGCCATTGGGGG + Intergenic
1005386002 6:25284744-25284766 GAGGAGGAGTAAGCATTTGGAGG - Intronic
1005822365 6:29608332-29608354 GAAGAGGAGGGAGCCATTGAAGG - Intronic
1005848137 6:29798777-29798799 GAGTAAGATGGAGCCATTAGAGG + Intergenic
1006180478 6:32150807-32150829 GAGGAAGGGGCTGCCTGTGGCGG + Exonic
1006678909 6:35783096-35783118 GAGTAAGAGTGAGGCTTTTGGGG - Intronic
1006923036 6:37638654-37638676 GAGGTTGAGGGAGCCTGCGGTGG + Exonic
1006945920 6:37784457-37784479 GAGGGAGAGGGAGGCGGTGGGGG + Intergenic
1007237436 6:40401004-40401026 GAGGATGTGGGAGCCTCTGGGGG - Intronic
1007272877 6:40651487-40651509 GAGCAAGAGGGAGGCATTGTGGG + Intergenic
1007274040 6:40660643-40660665 GAGGAAGAGGGAGTCTTGCTGGG + Intergenic
1007286219 6:40749374-40749396 GGGCAATAGGGAGCCATTGGAGG - Intergenic
1007947836 6:45841606-45841628 CAGGAAGAGGAAGCCTTCCGAGG - Intergenic
1008785232 6:55159432-55159454 GAGGAATTGTGATCCTTTGGAGG - Intronic
1008940113 6:57037757-57037779 AGGGAAGAGGGATCCATTGGAGG - Intergenic
1009382885 6:63054000-63054022 GAGGAACTGCGATCCTTTGGAGG - Intergenic
1009797299 6:68487211-68487233 GAGAAAGCGGGAGCACTTGGTGG - Intergenic
1010282135 6:74034726-74034748 GAGGAGGTGTGATCCTTTGGAGG + Intergenic
1012087796 6:94852093-94852115 GAGGAACAGCGTTCCTTTGGAGG - Intergenic
1012605874 6:101157290-101157312 GAGGAACTGTGATCCTTTGGAGG + Intergenic
1014070498 6:117175967-117175989 GAGGAACTGTGATCCTTTGGAGG - Intergenic
1014122937 6:117746692-117746714 GAGGAGTTGGGATCCTTTGGAGG - Intergenic
1014352547 6:120362834-120362856 GAGGAATTGTGATCCTTTGGAGG + Intergenic
1014710977 6:124805592-124805614 GAGGAACTGCGATCCTTTGGAGG - Intronic
1015519377 6:134115242-134115264 GAGGAAGAGGGAGCATCTCTCGG - Intergenic
1016509403 6:144824226-144824248 GAGCAGTGGGGAGCCTTTGGGGG + Intronic
1016987723 6:149907616-149907638 GAGGAAAAGGGTGCGTTTGGAGG + Intergenic
1017211185 6:151858377-151858399 GAGGAAGAGCTAGCCTTTTTGGG + Intronic
1017652645 6:156597388-156597410 GAGGAGGAGGGGGCATTGGGGGG - Intergenic
1017764094 6:157592935-157592957 GAGGCAGAGGGAGGCTCTGAAGG + Intronic
1017959653 6:159210651-159210673 CAGGAAGAACGAGCCTGTGGTGG + Intronic
1018932297 6:168249034-168249056 GAGGAGGTGTGATCCTTTGGAGG - Intergenic
1019309156 7:351889-351911 GAGGAAGAGGGAGCCCGTAATGG - Intergenic
1019347669 7:538726-538748 GAGGAAGTGGGGGCCCTGGGGGG - Intergenic
1019373013 7:673205-673227 GAGGAAGAGAGAGCCCTTTCTGG - Intronic
1019570219 7:1707955-1707977 GAGGCTGAGGGAGCCTCAGGAGG - Intronic
1019630478 7:2046324-2046346 GAGGTTGTGGGGGCCTTTGGTGG - Intronic
1020693698 7:11390639-11390661 GAGGAGGTGTGATCCTTTGGAGG + Intronic
1020716172 7:11676359-11676381 GAGGAATTGTGATCCTTTGGAGG - Intronic
1021065192 7:16164555-16164577 GAGGAATTGTGATCCTTTGGAGG + Intronic
1022531624 7:31070354-31070376 GAGGAAGAGGAGGCCTGTGGTGG + Intronic
1022949892 7:35328110-35328132 GAGGCAGAGGAAGGCTGTGGAGG - Intergenic
1024098899 7:46008689-46008711 GAGGAAGAGTGAGCCTCAGCTGG - Intergenic
1025272052 7:57531288-57531310 GAGGAAGAGGGATCAATAGGTGG - Intergenic
1027583006 7:80021218-80021240 GAGGAGGTGTGATCCTTTGGAGG - Intergenic
1027684852 7:81267234-81267256 GAGAAAGAGTGAGCCTTTGCCGG - Intergenic
1028532011 7:91848680-91848702 GAGGAAGAGTGAAACCTTGGTGG - Intronic
1028796250 7:94907613-94907635 GAGAGAGAGGGAGCCTCTGGCGG - Intronic
1029506858 7:100968099-100968121 GAGGAGGAGGGAGACTGAGGGGG - Exonic
1029514999 7:101018511-101018533 GAGGAAGAGGGAGCCCTGGCGGG - Intronic
1030466480 7:109909166-109909188 GAGGAACTGCGATCCTTTGGAGG - Intergenic
1031391968 7:121226027-121226049 GAGGAACTGTGATCCTTTGGAGG + Intronic
1031865970 7:127039545-127039567 AATGAGGAGGGAGCCTGTGGAGG + Intronic
1031902586 7:127427805-127427827 GAGGAATTGTGATCCTTTGGAGG + Intronic
1032004907 7:128293098-128293120 GAGGAACTGTGATCCTTTGGAGG - Intergenic
1032094777 7:128932565-128932587 GAAGGAGAGGGAGCACTTGGGGG - Intergenic
1032944344 7:136832152-136832174 GAGGAAGTGCGTTCCTTTGGAGG - Intergenic
1033830025 7:145240964-145240986 GAGGAACTGCGATCCTTTGGAGG + Intergenic
1033862264 7:145643325-145643347 GAGCTAGAGTGAGCCTTTGGTGG + Intergenic
1033962322 7:146929539-146929561 GAGGAACTGCGTGCCTTTGGAGG - Intronic
1034955174 7:155329427-155329449 GAGGATGTGGGTGTCTTTGGGGG - Intergenic
1036001317 8:4608130-4608152 CAGGAAGAGGGAGGCATTAGAGG + Intronic
1037160280 8:15761414-15761436 GGGGAAGTGGGAGCTTCTGGGGG + Intronic
1037946110 8:22990613-22990635 GAGGAAGAGGGTGGGTTGGGAGG + Intronic
1038267963 8:26050562-26050584 GAGGATGGGGGAGACTTTGGCGG + Intergenic
1038354205 8:26811717-26811739 GAGCATGAGGGAGCCTTCTGAGG - Intronic
1038493879 8:27988242-27988264 GAGGAGCAGGGAGCCTCTGAAGG + Intronic
1038535392 8:28349702-28349724 GAGGAAGGGGGAGAATGTGGAGG - Intronic
1039469812 8:37806416-37806438 GAGGAAGAGGAAACAGTTGGGGG - Intronic
1039512935 8:38105845-38105867 GAGGCAGGGCGAGCCATTGGCGG - Intronic
1039753331 8:40497223-40497245 GAGGGAGAGGGAGGCAGTGGAGG + Intergenic
1039928761 8:41963013-41963035 GAGGAAGAGGGAGAATTCAGAGG - Intronic
1041392673 8:57360615-57360637 GAGGAAGAGGGAGCAGGGGGAGG - Intergenic
1042290906 8:67168293-67168315 GAGGGAGAGGGAGGCCGTGGGGG + Intronic
1042560762 8:70070967-70070989 TAGGAGAAGGGCGCCTTTGGAGG - Intronic
1042627052 8:70769987-70770009 GAGGAATTGTGATCCTTTGGAGG + Intronic
1043835478 8:85040466-85040488 AACGAATAGGGAGTCTTTGGAGG + Intergenic
1044315934 8:90750274-90750296 GAGCCAGAGTGAGCCTTTGGTGG + Intronic
1044387327 8:91604498-91604520 GGGGAAGAGGGAGGCTTCTGGGG - Intergenic
1044549851 8:93499629-93499651 GAGTAATAGAGAACCTTTGGAGG + Intergenic
1044872744 8:96635909-96635931 CAGTATGAGGGAGACTTTGGGGG + Intergenic
1045545047 8:103121181-103121203 GAGGTAGTGGAAGCTTTTGGAGG + Intergenic
1045726917 8:105185277-105185299 GAGCAAGTGTGATCCTTTGGTGG + Intronic
1045775145 8:105794115-105794137 GAGGAACTGTGATCCTTTGGAGG + Intronic
1046220053 8:111201756-111201778 GAGGAATTGTGATCCTTTGGAGG - Intergenic
1046978656 8:120312319-120312341 GAGGAAGAGGAAGCATATGTGGG - Intronic
1047512979 8:125529563-125529585 GGGGAAGAAGGAGACTCTGGTGG + Intergenic
1047586295 8:126277599-126277621 TAGGAAGAGGAAGGCTTTGGGGG - Intergenic
1047664664 8:127077733-127077755 AAGGCAGAGGAAACCTTTGGGGG - Intergenic
1048096579 8:131301674-131301696 GAGCAAGAGGGAGAGTTGGGGGG + Intergenic
1048580806 8:135728654-135728676 GAGCAGGAGGGAGCCCTTGGGGG - Intergenic
1048697034 8:137040002-137040024 GAGGAACTGTGATCCTTTGGAGG + Intergenic
1048804737 8:138229551-138229573 GTGGAAAAGGCAGCCTTTGTGGG + Intronic
1049429316 8:142551835-142551857 CAGGAACAGGCAGCCATTGGAGG + Intergenic
1049569993 8:143365122-143365144 GTGGAAGAGGTGGGCTTTGGGGG - Intergenic
1049758858 8:144322846-144322868 GGGGAGGAGGGAGGCTCTGGTGG - Intronic
1050569639 9:6924363-6924385 GAGGGAAAGGGGGCCTGTGGTGG - Intronic
1050645417 9:7714000-7714022 GAGGAGCTGCGAGCCTTTGGAGG - Intergenic
1051005191 9:12334965-12334987 GAGGAACAGCGTTCCTTTGGAGG - Intergenic
1051584488 9:18712198-18712220 GAGGAACTGTGATCCTTTGGAGG - Intronic
1052228195 9:26115434-26115456 GAGGCAGAGGGATCCTTTCAAGG + Intronic
1053009281 9:34624143-34624165 GGGAAAGAGGGAGACTTGGGCGG + Intronic
1054889257 9:70233594-70233616 GAGGATTTGGGATCCTTTGGAGG - Intergenic
1055312484 9:74997416-74997438 GAGAAACAGGAAGCCATTGGAGG - Intronic
1055665439 9:78548303-78548325 GATGAAGAGAGAGCATTTGGAGG - Intergenic
1056097120 9:83266723-83266745 GAGGGAGAGGGAGGCAGTGGTGG - Intronic
1056222135 9:84460392-84460414 GTGGTAGAGGGAGGCTTTGGGGG - Intergenic
1056385022 9:86089803-86089825 GAGGAGGTGTGATCCTTTGGAGG + Intronic
1056642086 9:88380201-88380223 AAGGGAGAGGGAGCCAATGGTGG - Intergenic
1057095970 9:92309925-92309947 GAGGAAAATGGTACCTTTGGTGG + Intronic
1058102864 9:100936784-100936806 GAGCTAGAGTGAGCCTTTGGTGG + Intergenic
1058485384 9:105439016-105439038 GAGGACCAGGGAGTCTTTAGAGG + Intronic
1058747284 9:108003925-108003947 GAGGACCAGGGAGCTTTTGGGGG - Intergenic
1058846022 9:108960225-108960247 GAGGGAGAGGGAGGAGTTGGAGG - Intronic
1058890721 9:109358420-109358442 TAGGAAGTGGGGGCCTTTGGGGG + Intergenic
1058981431 9:110174150-110174172 GGGGAAGAGTGAGGTTTTGGTGG + Intergenic
1059392852 9:114009831-114009853 GAGGAAGAAAAAGCATTTGGGGG - Intronic
1059414651 9:114155524-114155546 GAGGAAAAGGAAGGATTTGGGGG - Intergenic
1059992523 9:119878651-119878673 GAGGTACAGGGAGCCTTCCGTGG - Intergenic
1060416888 9:123437060-123437082 GATGAAGAGGGAGCCTCTGGGGG + Intronic
1061312582 9:129773823-129773845 GAGGAGGAGGGAGTGTTTTGTGG + Intergenic
1061448177 9:130653624-130653646 GAGCAAGGGGAAGCTTTTGGAGG + Intergenic
1061625890 9:131840477-131840499 GAGGAAAAGGGTGGCTGTGGTGG - Intergenic
1061719702 9:132543962-132543984 CAGGCAGAGGGAGCCTTTCTAGG + Intronic
1061928643 9:133820748-133820770 GAGGAAGAGGGAACCCTCAGGGG + Intronic
1062070770 9:134553965-134553987 GAGGAAGAGGAAGGCTGGGGAGG + Intergenic
1062411855 9:136429813-136429835 GAGGAGGAGGGGGCGTTAGGAGG + Intronic
1062720874 9:138043346-138043368 GAGGTACAGGGAGCCTCTGTGGG + Intronic
1185456573 X:313777-313799 GAGGCAGAAGGAGCCCCTGGAGG + Intronic
1185499063 X:584011-584033 GAGGAGGAGGGAGTGGTTGGAGG + Intergenic
1185635494 X:1548961-1548983 CAGGACGATGGAGCCTTGGGTGG - Intergenic
1186078910 X:5909137-5909159 GAGAATGTGGGAGCCTTTGGCGG - Exonic
1186534521 X:10332277-10332299 GAGGCAGAGGAAGCCCTTGCTGG - Intergenic
1186919496 X:14262501-14262523 AAGGAAGAGGGAGATTTTGAAGG - Intergenic
1187281209 X:17860082-17860104 GAAGAAGAAGGTGGCTTTGGAGG - Intronic
1187288526 X:17930064-17930086 GAGGAAAAGGCACCTTTTGGGGG + Intergenic
1187784439 X:22867757-22867779 GAGGAATTGTGATCCTTTGGAGG - Intergenic
1187850085 X:23583116-23583138 AAGGAAGAGGGAGATTTTGGAGG + Intergenic
1190342155 X:49305497-49305519 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190344406 X:49323836-49323858 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190345496 X:49333380-49333402 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190346598 X:49342946-49342968 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190347846 X:49533974-49533996 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190348947 X:49543530-49543552 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190350049 X:49553086-49553108 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190351152 X:49562639-49562661 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190352253 X:49572197-49572219 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190353353 X:49581746-49581768 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190355559 X:49600817-49600839 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190519550 X:51263099-51263121 GAGGAACTGCGATCCTTTGGAGG - Intergenic
1190970579 X:55343589-55343611 GAGCCAGTGTGAGCCTTTGGAGG - Intergenic
1191074321 X:56436243-56436265 GAGGAACTGCGATCCTTTGGAGG + Intergenic
1191074433 X:56437089-56437111 GAGGAACTGCGATCCTTTGGAGG - Intergenic
1191192548 X:57681761-57681783 GAAGAAGAAGGAGCAGTTGGAGG + Intergenic
1191987120 X:66994213-66994235 GAGGAATTGTGATCCTTTGGAGG + Intergenic
1192294749 X:69835760-69835782 GAGGAGCTGCGAGCCTTTGGAGG + Intronic
1192827482 X:74713047-74713069 GAGGAACTGCGATCCTTTGGAGG - Intergenic
1192922624 X:75723642-75723664 GAGGAATTGTGATCCTTTGGAGG + Intergenic
1193412038 X:81176379-81176401 GAGGAACTGTGATCCTTTGGAGG - Intronic
1193874410 X:86843055-86843077 TATGAAGAGGAAGGCTTTGGAGG + Intergenic
1195067453 X:101250518-101250540 GGTGAAGTGGCAGCCTTTGGGGG + Exonic
1196078256 X:111601471-111601493 AAGGAAGCGGGGGCCTGTGGGGG + Intergenic
1197662270 X:129187034-129187056 GAGGAACAGGGAGCCATTAGAGG + Intergenic
1198168229 X:134078376-134078398 GAGCTAGTGGGATCCTTTGGAGG - Intergenic
1198440713 X:136660430-136660452 GGGAAAGAGGAAGCATTTGGAGG + Intergenic
1198595574 X:138231807-138231829 GAGGAGGTGTGATCCTTTGGAGG - Intergenic
1199362086 X:146933005-146933027 GAGGACGAGGTTGCCTTTGTAGG + Intergenic
1199383100 X:147193438-147193460 GAGGAAGAGAGAGGCTGGGGAGG - Intergenic
1199507133 X:148576240-148576262 GACAAAGTGGCAGCCTTTGGGGG + Intronic
1200151558 X:153953833-153953855 GTGGTAGAGGAAGCCTGTGGTGG - Intronic
1200913803 Y:8553896-8553918 GAAGGAGAAGGAGACTTTGGAGG + Intergenic
1200972798 Y:9174803-9174825 GAGAAACATGGAGGCTTTGGAGG + Intergenic
1201080678 Y:10242009-10242031 GAGGAACTGTGATCCTTTGGAGG + Intergenic
1201485993 Y:14495247-14495269 GTGGAGGAGTGAGCCATTGGAGG + Intergenic
1201509179 Y:14739040-14739062 CAAGAAGAGGGGGCCTCTGGTGG - Intronic
1201516520 Y:14824268-14824290 GAGAATGTCGGAGCCTTTGGCGG + Exonic