ID: 1069764286

View in Genome Browser
Species Human (GRCh38)
Location 10:70841615-70841637
Sequence GGAGGAAGAGGGAGCCTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 2, 1: 0, 2: 5, 3: 75, 4: 621}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069764286_1069764298 22 Left 1069764286 10:70841615-70841637 CCCCAAAGGCTCCCTCTTCCTCC 0: 2
1: 0
2: 5
3: 75
4: 621
Right 1069764298 10:70841660-70841682 TTTCAACATATGAATTTTTGGGG 0: 28
1: 444
2: 1606
3: 3278
4: 4796
1069764286_1069764292 -6 Left 1069764286 10:70841615-70841637 CCCCAAAGGCTCCCTCTTCCTCC 0: 2
1: 0
2: 5
3: 75
4: 621
Right 1069764292 10:70841632-70841654 TCCTCCTACCATCAGCTTGAGGG No data
1069764286_1069764297 21 Left 1069764286 10:70841615-70841637 CCCCAAAGGCTCCCTCTTCCTCC 0: 2
1: 0
2: 5
3: 75
4: 621
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764286_1069764291 -7 Left 1069764286 10:70841615-70841637 CCCCAAAGGCTCCCTCTTCCTCC 0: 2
1: 0
2: 5
3: 75
4: 621
Right 1069764291 10:70841631-70841653 TTCCTCCTACCATCAGCTTGAGG No data
1069764286_1069764296 20 Left 1069764286 10:70841615-70841637 CCCCAAAGGCTCCCTCTTCCTCC 0: 2
1: 0
2: 5
3: 75
4: 621
Right 1069764296 10:70841658-70841680 GATTTCAACATATGAATTTTTGG 0: 182
1: 925
2: 2225
3: 3438
4: 4626
1069764286_1069764299 23 Left 1069764286 10:70841615-70841637 CCCCAAAGGCTCCCTCTTCCTCC 0: 2
1: 0
2: 5
3: 75
4: 621
Right 1069764299 10:70841661-70841683 TTCAACATATGAATTTTTGGGGG 0: 28
1: 372
2: 1349
3: 2634
4: 3546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069764286 Original CRISPR GGAGGAAGAGGGAGCCTTTG GGG (reversed) Intronic
900650752 1:3729064-3729086 GGAGGAAGAGGGAGGCTTGGGGG + Intronic
901167431 1:7230314-7230336 AGAGGAAGAAAGAGTCTTTGAGG + Intronic
901287620 1:8093705-8093727 GGAGGAATAGGGATGCTTTGTGG + Intergenic
901658759 1:10785776-10785798 GGAGGATGAAGCAGCCGTTGTGG - Intronic
901784426 1:11615404-11615426 GGAGGAAGAGAGAGGATTTGAGG + Intergenic
902881311 1:19373537-19373559 GGTGGCAGAGGGAGCCTCTGGGG + Intronic
903052347 1:20611140-20611162 TGAGGTAGGAGGAGCCTTTGAGG + Intronic
903519260 1:23934991-23935013 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
903894414 1:26594386-26594408 GGAGCATGAGGAAGCTTTTGGGG - Intergenic
903938865 1:26914732-26914754 TGAGGAAGGGGGATCATTTGAGG + Intronic
904237431 1:29124140-29124162 GTAGGAAGGGGTCGCCTTTGTGG - Intergenic
904615192 1:31745782-31745804 GCAGGAAGAGGCAGCCCTGGTGG - Intronic
905070376 1:35220044-35220066 GGAAGAGGAGGCTGCCTTTGGGG + Intergenic
905280388 1:36845506-36845528 GTTGGAAGAGGGAGTCTTGGGGG + Intronic
905427183 1:37895513-37895535 AGAGGGAGAGGGAGACTGTGGGG - Intronic
905863771 1:41366161-41366183 GGAGGAGGAGGGAGCCCTGCTGG - Intronic
905875217 1:41427870-41427892 GAGGGAGGAGGGAGCATTTGTGG - Intergenic
906256628 1:44355374-44355396 GGCGGGAGAGCGAGCGTTTGGGG - Intergenic
906319782 1:44808781-44808803 GGTGGAGGAGGGAGCCTGGGAGG - Exonic
906322623 1:44826607-44826629 AGAGGAAGGGGGAGCCGCTGGGG + Exonic
906722447 1:48018907-48018929 AGAGGAAGAAGGAGGCTGTGCGG + Intergenic
907039884 1:51249468-51249490 GGGGCAGGAGGGAGCCTTTTGGG - Intronic
907411979 1:54289610-54289632 GGGGGATCAGGGAGGCTTTGTGG + Intronic
907877340 1:58504363-58504385 GGAGGGAGAGAGAGCCTTTTAGG - Intronic
908462208 1:64356819-64356841 GGAGGAAGAGGGAGCGTTCCTGG + Intergenic
909491042 1:76226680-76226702 GGAGGAAGAGAGAGAGTTGGGGG + Intronic
910302647 1:85724293-85724315 TGAGGCAGATGGATCCTTTGAGG - Intergenic
910722414 1:90301273-90301295 GGAGGACGAGGGAACCTTCCAGG - Intergenic
911089773 1:94009309-94009331 GGAGGAAGTGGGAGGCTCGGAGG - Intronic
911152787 1:94611150-94611172 GGAGGAAGAGTGATCCTCTAAGG - Intergenic
911486859 1:98513607-98513629 AGAGGGAGAGGGAGACTGTGGGG + Intergenic
911612216 1:99969954-99969976 GGCGGAAGCCGGAGCATTTGGGG + Intronic
912116151 1:106411836-106411858 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
912961831 1:114202922-114202944 GGAGGCAGATGGATCATTTGAGG + Intergenic
913219281 1:116646324-116646346 GGAGGAAGATGGAGAATTGGGGG + Intronic
913317827 1:117567380-117567402 GGAAGAAGAGGGAGTCAGTGTGG + Intergenic
913968385 1:143395260-143395282 GAATGAAGAGTGAGGCTTTGGGG + Intergenic
914062763 1:144220856-144220878 GAATGAAGAGTGAGGCTTTGGGG + Intergenic
914116387 1:144745498-144745520 GAATGAAGAGTGAGGCTTTGGGG - Intergenic
915354419 1:155247645-155247667 GGAGGGAAAGGGACACTTTGGGG + Exonic
915758508 1:158286973-158286995 AGAGCAAGACTGAGCCTTTGGGG - Intergenic
915920719 1:159973490-159973512 AGAGGCAGAGGGGGCCTTCGAGG + Intergenic
916078181 1:161215235-161215257 GCAGGAAGAGGGGGACTCTGTGG + Intronic
916171250 1:162003099-162003121 GAAGGAAGAGGCAGGCTCTGAGG - Intronic
916521032 1:165563605-165563627 GCAGGAAGATGTAGTCTTTGTGG - Exonic
919236483 1:194851353-194851375 GGGGAAAGAGGGTGACTTTGGGG - Intergenic
919742790 1:200990826-200990848 TGAGGAAGAGGGAAGCTCTGGGG - Intronic
920584603 1:207145499-207145521 GGAGAATGGGGGAGGCTTTGAGG - Intergenic
922192057 1:223328005-223328027 GGAAGAAAAGGTTGCCTTTGTGG - Intronic
922278357 1:224100217-224100239 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
922685617 1:227636713-227636735 GGAGGAAGGAGTAGCCTTGGGGG + Intronic
922724981 1:227918447-227918469 GGAGGAAGGGGGAGGTTTTGGGG - Intergenic
923009364 1:230075862-230075884 AGACTAAGAGGGAGCCATTGTGG + Intronic
923216377 1:231851780-231851802 GGCGGAAGAATGAGCATTTGAGG + Intronic
923653636 1:235896973-235896995 GGAAGAAGGGAGAGCCATTGGGG - Intergenic
923936417 1:238765230-238765252 GGAGGAAGAGGTCACCTGTGGGG + Intergenic
924455672 1:244217164-244217186 GGAGGAAGAAGCAGCCCCTGAGG - Intergenic
924634643 1:245774633-245774655 AGAGGGAGAGGGAGACTGTGGGG - Intronic
924722557 1:246637166-246637188 GGAGGAAGAAGTAGCCTTTGGGG + Intronic
1062977683 10:1697665-1697687 GCATGCAGAGGGAGCCTGTGGGG - Intronic
1064322863 10:14321946-14321968 GGAGGAAGAGGGAGCAAAGGGGG - Intronic
1065808677 10:29420846-29420868 GGAGGAAGAGGCTGCCTTGGCGG - Intergenic
1066292235 10:34025118-34025140 GGAGGAAGGGGGCGCCACTGAGG - Intergenic
1066358649 10:34709648-34709670 GGCGGAAGTGGGAGCCATGGAGG + Intronic
1066952741 10:42137533-42137555 AGAGGGAGAGGGAGACCTTGGGG - Intergenic
1067479198 10:46584404-46584426 GGAGGAAGCGGGAGGCTCTCTGG + Intronic
1067615540 10:47757397-47757419 GGAGGAAGCGGGAGGCTCTCTGG - Intergenic
1067820460 10:49524325-49524347 AGAGGCAGAGGGAGACTCTGAGG - Exonic
1067938110 10:50628254-50628276 GGAGACAGAGGGAGACTTTCTGG - Intergenic
1068962455 10:62879450-62879472 GGAGCATGAGGGAGCCTTCTGGG + Intronic
1069764286 10:70841615-70841637 GGAGGAAGAGGGAGCCTTTGGGG - Intronic
1070173399 10:73950125-73950147 GGAGGCAGATGGATCGTTTGAGG + Intergenic
1070529073 10:77320469-77320491 GAAGGAAGAGGGAGCTTCTGTGG + Intronic
1070658722 10:78289562-78289584 GGATGCAGAGGCAGCATTTGAGG + Intergenic
1070786289 10:79164043-79164065 TGAGGAAGAGAAAGCCTTGGTGG + Intronic
1072221385 10:93330505-93330527 GGAGAAGAGGGGAGCCTTTGGGG - Intronic
1072542175 10:96406589-96406611 GGAGGGAATGGGAACCTTTGAGG - Intronic
1072572838 10:96673503-96673525 GAAGAAAGAGGAAGCCTTTCGGG - Intronic
1072654254 10:97319471-97319493 GGAGGAAGAGGAAGCCGGCGAGG + Exonic
1072656630 10:97334533-97334555 GGAGGAAGAGGAAGCCGGCGAGG - Exonic
1072803161 10:98407458-98407480 GGTGGAAGAGGGAGCCCTCAGGG + Intronic
1073011408 10:100362789-100362811 GGAGGGAGAGAGAGGCTTTCTGG - Exonic
1073044453 10:100628573-100628595 GAAGGCAGAGGGAGACTTTGGGG + Intergenic
1073324653 10:102635201-102635223 GTAGGACGAGGGAAACTTTGAGG + Intergenic
1074064247 10:109998796-109998818 GGATGAAGAAGGTGTCTTTGAGG - Intronic
1074309835 10:112312680-112312702 GGAGGGTGAGGGGGGCTTTGTGG - Intergenic
1074472932 10:113743941-113743963 AGAGGCAGAGGGAGCCTAAGAGG - Intergenic
1074878409 10:117632367-117632389 GGAGGAAGAGGCAGGATCTGAGG - Intergenic
1075456475 10:122588289-122588311 GGAGGAAGTTGGAGTCTCTGGGG + Intronic
1076012113 10:126997478-126997500 GGAGGAAGAGAGAGGGTGTGCGG + Intronic
1076606418 10:131692438-131692460 GAAGGAAGAGGGAGCCACTTGGG - Intergenic
1077638068 11:3856644-3856666 GCAGTAAGAAGAAGCCTTTGGGG + Intronic
1078089967 11:8258940-8258962 GGAGCAGGAGAGAGCCTTTCAGG - Intronic
1078154074 11:8783836-8783858 GGAGGAAGAGCAAGGCTTAGAGG + Intronic
1078960321 11:16259775-16259797 GGAGGAAGAGGGAGTCTTCCAGG + Intronic
1079032666 11:16997245-16997267 GGAGGAGGAGGTAGACTATGGGG - Intronic
1079479441 11:20864103-20864125 AGAGGGAGAGGGAGACTGTGGGG + Intronic
1081361328 11:42182647-42182669 GGTTGATGAGGGAGGCTTTGTGG - Intergenic
1081446069 11:43132728-43132750 TGAGGCAGAGGGATCATTTGGGG - Intergenic
1081536671 11:44001845-44001867 GGAGGAAGAAGGAGCCTGTCGGG - Intergenic
1081567247 11:44267572-44267594 GGAGGAAGCGGGAGCGTTTTGGG - Exonic
1081695022 11:45103594-45103616 GGAGCTTGAGGGGGCCTTTGAGG + Intronic
1081826566 11:46059652-46059674 TGAGGCAGAAGGATCCTTTGAGG - Intronic
1082632317 11:55557194-55557216 GGAGGAAGGAGTAGCCTTGGGGG - Intergenic
1083302410 11:61745858-61745880 GGAGCATGATGGGGCCTTTGAGG + Exonic
1083404698 11:62448517-62448539 TGAGGAAGAGGGAGGCATTGAGG + Intronic
1083622590 11:64056445-64056467 GGAGGAAGGGGGAGCAGCTGCGG + Intronic
1083758027 11:64801839-64801861 GGAGGAAGAAGCAGCCTGAGTGG - Intronic
1083955243 11:65979231-65979253 GGAGAAGGAAGGAGCCTTAGAGG - Exonic
1085073562 11:73571246-73571268 AGAGGGAGAGGGAGACTGTGGGG - Intronic
1085609348 11:77933222-77933244 AGAGGGAGAGGGAGACTGTGGGG - Intronic
1085681083 11:78575439-78575461 GAGGGAAGAGGGAGACTTGGAGG - Intergenic
1085893621 11:80610552-80610574 GGAGAAAGGGGGAGGATTTGTGG - Intergenic
1086249589 11:84797320-84797342 GGAGGAAGATAGAGAGTTTGGGG - Intronic
1086370119 11:86147995-86148017 AGAAGTGGAGGGAGCCTTTGAGG - Intergenic
1087048464 11:93864097-93864119 AGAGGAAGAAGTAGCCTTGGGGG + Intergenic
1088037263 11:105333081-105333103 GTTGGAAGATGGAGCCTCTGAGG + Intergenic
1088353596 11:108917878-108917900 AGATGAAGAGGAAGCCTTTCTGG + Exonic
1088580655 11:111312575-111312597 GGAGGAGGAGGGAGCCATGAGGG - Intergenic
1088716535 11:112554415-112554437 GTTGGAAGAGGTAGGCTTTGAGG - Intergenic
1089031422 11:115333276-115333298 GTAGGCACTGGGAGCCTTTGAGG - Intronic
1089604904 11:119636122-119636144 GGAGAAAGAGGGAGCGATGGGGG - Intronic
1089625025 11:119745760-119745782 GGAGGATGTGGGAGCCACTGAGG + Intergenic
1089751382 11:120653822-120653844 GGAGGAAGAGGCAGGCTCTGAGG + Intronic
1090042352 11:123302008-123302030 GGAGGGAGAGGGCTCCTTTGAGG - Intergenic
1090242622 11:125194627-125194649 GAAGCAAGAGTGGGCCTTTGGGG - Intronic
1090351920 11:126113303-126113325 GGAGGAACAGGGGCGCTTTGGGG + Intergenic
1090521935 11:127488915-127488937 GGGGGAAGATGGAGGCGTTGTGG + Intergenic
1091317473 11:134624629-134624651 GGAGCAAGAGGGTGACTTTGGGG + Intergenic
1092050142 12:5463461-5463483 CGTGGAGGAGGTAGCCTTTGTGG + Intronic
1092163857 12:6330559-6330581 GGAGGGAGAGGGAGCTGGTGGGG - Intronic
1092295677 12:7198275-7198297 GGAGACTGAGGGAGCCTGTGAGG + Intronic
1092461396 12:8689890-8689912 GGAAGTAGAGAGACCCTTTGAGG - Intronic
1094131340 12:27078920-27078942 GGAGCAAGAGGGTCCCCTTGGGG + Intergenic
1094352810 12:29545405-29545427 TGAGGAAGACGGATCATTTGAGG + Intronic
1094536489 12:31326092-31326114 TGAGGAGGAGGGAGCGCTTGAGG - Exonic
1095126711 12:38487744-38487766 CTAGGAAGAGGGAACCTTGGAGG - Intergenic
1095409735 12:41908816-41908838 GGGGGAAGAGGGAGGGGTTGAGG - Intergenic
1095518093 12:43029306-43029328 GGAGGAACTGGAAGCATTTGAGG + Intergenic
1095827636 12:46546801-46546823 GGTGGAAGAGGGAGCCTAGAAGG + Intergenic
1097008595 12:55936607-55936629 GGAGGAGGAGGGATTCTCTGGGG - Intronic
1097180373 12:57168408-57168430 GACGGCAGAGGGAGCCTCTGAGG + Intronic
1098371092 12:69760398-69760420 AGAGGGAGAGGGAGACTGTGGGG + Intronic
1099284348 12:80697629-80697651 GGAGGAAGAGGGAGAGTGTGGGG - Intergenic
1099862013 12:88233152-88233174 GGAGGAAGAAGTAGCCTTGGGGG - Intergenic
1100733411 12:97499064-97499086 AGAGACAGAGGCAGCCTTTGAGG - Intergenic
1101441644 12:104708587-104708609 GGAGGAAGATGAAGCCTTGGAGG - Intronic
1101957112 12:109221636-109221658 GGAAGGAGCGGGAGGCTTTGGGG + Intronic
1101998490 12:109541856-109541878 GGAGAAAGAGGAAGCCCTAGAGG - Intergenic
1102152828 12:110700368-110700390 GGAGCCAGAGGAGGCCTTTGGGG + Intronic
1102730441 12:115104195-115104217 GGAAGAAGAGAGAGCCTCAGAGG - Intergenic
1103536082 12:121634700-121634722 AGAGGGAGAGGGAGACTGTGGGG + Intronic
1103578196 12:121894433-121894455 GGAGGAAGAGGCTGGCCTTGGGG + Intronic
1103873707 12:124110725-124110747 AGAGTAAGAGGGAGCCTCAGAGG - Intronic
1104068736 12:125327088-125327110 GGAGGGAAAGAGAGCCTTGGTGG - Intronic
1104348209 12:128021645-128021667 GGTGGAAGAGCGTTCCTTTGAGG - Intergenic
1104899813 12:132182757-132182779 GGAGGAAGAGCGAGGCCTGGGGG - Intergenic
1105693009 13:22859897-22859919 AGAGGGAGAGGGAGACTGTGGGG + Intergenic
1105826277 13:24126211-24126233 GGAGCCATGGGGAGCCTTTGCGG + Intronic
1105882282 13:24615312-24615334 GCAGGAAGAGGGAGTTTTTCAGG + Intergenic
1108370165 13:49761241-49761263 AGAGGGAGAGGGAGACTGTGGGG - Intronic
1110195660 13:72785108-72785130 GCAGGAAGTTGGGGCCTTTGGGG - Intronic
1111412318 13:87893287-87893309 GGAGGAAGTGGCAGCCATAGAGG - Intergenic
1111560056 13:89932819-89932841 AGAGGGAGAGGGAGACTGTGGGG + Intergenic
1111963162 13:94833715-94833737 GGACGAAGGGGGCTCCTTTGGGG + Intergenic
1112056356 13:95692100-95692122 AGAGGGAGAGGGAGACTGTGGGG + Intronic
1112146434 13:96705535-96705557 GGAGGAAGAGGGACACTGAGAGG - Intronic
1112201730 13:97283147-97283169 GGAGGAAGAGGTGGCATTAGAGG - Intronic
1112210452 13:97371981-97372003 GGAGGTAGGGTGAGCTTTTGTGG - Intronic
1113973754 13:114211210-114211232 GGATGGAGAGGGAGCCATGGGGG - Intergenic
1114491456 14:23104771-23104793 GGAGGAAGAGCGAGATTTTGAGG + Intergenic
1114549853 14:23526476-23526498 GGAGGAAGAGGGGACCACTGGGG - Exonic
1114631770 14:24163877-24163899 GGAGGAGGAGGGGGCCAGTGGGG + Exonic
1117371173 14:55079642-55079664 GGTGGAAGAGGAAGTCTTTCTGG + Intergenic
1117796455 14:59399055-59399077 GGAAGAAGAGGAAGCCAGTGCGG - Intergenic
1118121581 14:62850597-62850619 TGAGGAGGAGGGAGCAGTTGGGG - Intronic
1118318159 14:64737999-64738021 GGAGGAAGAGCAGGCCTTTCAGG + Intronic
1118487391 14:66226713-66226735 GGAGGAAGAGAGAGCAGGTGGGG + Intergenic
1118833046 14:69452909-69452931 GGAGGAAGTTGGGGCCATTGGGG + Intronic
1119579791 14:75767441-75767463 GCATGAAGAGGTAACCTTTGAGG + Intronic
1122212132 14:100180289-100180311 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1122861970 14:104586776-104586798 AGAGGAAGTGGGAGCCATGGAGG + Intronic
1123488583 15:20762609-20762631 GGATGAAGAGGGCCCCTCTGCGG + Intergenic
1123545079 15:21331682-21331704 GGATGAAGAGGGCCCCTCTGTGG + Intergenic
1124072609 15:26409958-26409980 TGAGGAGGAGGGAGAGTTTGAGG - Intergenic
1124657600 15:31521835-31521857 AGAGCAAGAGGGACCGTTTGGGG - Intronic
1124854985 15:33379026-33379048 GGAGAAAAAGAGAACCTTTGTGG - Intronic
1125416654 15:39460883-39460905 TGAGAGAGAGAGAGCCTTTGTGG - Intergenic
1125758628 15:42082769-42082791 GGAGGAGGAGGCAGCCTTGGAGG + Intronic
1125928335 15:43582008-43582030 GAAGGAAGATGGAGAATTTGGGG - Intronic
1125941501 15:43681843-43681865 GAAGGAAGATGGAGAATTTGGGG - Intergenic
1126362197 15:47858137-47858159 GGAGAAAGTGAGAGTCTTTGAGG - Intergenic
1126667699 15:51090114-51090136 GAAGGAAGAGGCAGCGTCTGTGG + Intronic
1126679323 15:51188324-51188346 GGAGCAACAGGAAGCCATTGTGG - Intergenic
1128347084 15:66861127-66861149 GGAGGAGGAGGAAGAATTTGGGG + Intergenic
1128727993 15:70001854-70001876 GGGGGAAGAGGGAGGTTTAGGGG + Intergenic
1129445575 15:75615515-75615537 GAAGGAAGAGGCAGCCTTGAAGG - Intronic
1130063182 15:80584145-80584167 GGAGGGAGAGGGAGACCTCGAGG + Intronic
1130362669 15:83206560-83206582 GTAGGAAGAGAGAGCTATTGTGG + Intronic
1130372459 15:83296516-83296538 GGAGGAAGAGGAGGCCATTAAGG - Intergenic
1131491466 15:92866896-92866918 GGAAGAAGAGGGAGAGTTGGGGG + Intergenic
1131513673 15:93063794-93063816 GGAGAAAGAGGGAGCTTCTCAGG + Intronic
1131776247 15:95802383-95802405 GGAGGCAGAGTGAGCATTTAAGG - Intergenic
1131931944 15:97452418-97452440 AGAGGAAGACTGAGGCTTTGTGG + Intergenic
1132066569 15:98735877-98735899 GGAGGCAGGAGGAGCCTTGGAGG - Intronic
1132436822 15:101812977-101812999 GGTAGAAGATGGATCCTTTGAGG + Intronic
1202953425 15_KI270727v1_random:58953-58975 GGATGAAGAGGGCCCCTCTGTGG + Intergenic
1132591223 16:727224-727246 GGAGGAAGGCGTGGCCTTTGGGG + Intronic
1132704378 16:1236862-1236884 GGAGGAAGGCGGGGCGTTTGCGG + Intergenic
1132707138 16:1249563-1249585 GGAGGAAGGCGGGGCGTTTGCGG - Intergenic
1132717553 16:1299495-1299517 GGAGGAGGAGGGAGCCCTGGGGG - Intergenic
1133034255 16:3026203-3026225 GGACCCAGAGAGAGCCTTTGAGG + Intronic
1133210300 16:4259979-4260001 GGAGGAAGATGGTGCTTGTGTGG - Intronic
1133730201 16:8572117-8572139 GGAGGAGGAGGTAGGCTTGGAGG + Exonic
1133893247 16:9901681-9901703 CGAGGCAGATGGAGCATTTGAGG - Intronic
1134112282 16:11523163-11523185 GCATGAAGAGGAAGCCTTGGGGG + Intronic
1134117112 16:11557306-11557328 GGGGTATGAGGGGGCCTTTGCGG + Intronic
1134197178 16:12168269-12168291 GGTGGAGGGAGGAGCCTTTGGGG + Intronic
1134649562 16:15898057-15898079 GAAGGAAGAGAGAGAGTTTGGGG - Intergenic
1135075094 16:19386416-19386438 GGAGGAGGAGAGAGGCTTAGGGG - Intergenic
1135575452 16:23582776-23582798 AGAGGGAGAGGGAGACCTTGGGG - Intronic
1135618757 16:23934829-23934851 GGAGGAGGAGGAAGCCAGTGTGG + Intronic
1135959640 16:26985005-26985027 GGGGGAAGAGGGAGGGGTTGAGG - Intergenic
1136459387 16:30400278-30400300 GGAGGAAGAGGGGGCGTGTGGGG + Intergenic
1137070988 16:35904684-35904706 GGAGGAAGAAGTAGCCTTGGGGG + Intergenic
1137403178 16:48170023-48170045 GAAGGGAGAGGGAGCCGGTGTGG + Intronic
1137606413 16:49789616-49789638 CGAGGAAGAAGGAACATTTGTGG + Intronic
1137740683 16:50769785-50769807 GGAGGAAGAGGGAATTTGTGCGG - Intronic
1137803592 16:51283545-51283567 AGAGCAACAGGGAGCCTTTGAGG + Intergenic
1138130937 16:54479266-54479288 TGAGGAAGAAGTAGGCTTTGGGG + Intergenic
1138530214 16:57630733-57630755 AGAGGACCAGGGAGCCTCTGCGG + Intronic
1139394592 16:66630339-66630361 AGAGGGAGAGGGAGACTGTGGGG - Intronic
1139437183 16:66943070-66943092 GAAGGAAGAAGGGGCCTTTGGGG + Intronic
1139915929 16:70428525-70428547 GGAGGAAGGGGCAGGCTTTCTGG - Intronic
1139948430 16:70657293-70657315 GAAGGAAGAGGCAGCCGTGGTGG + Intronic
1140106429 16:71964691-71964713 GGAGGGATAGGGAGCTTTTGGGG - Intronic
1141326975 16:83069717-83069739 GGTGTCAGAGTGAGCCTTTGGGG - Intronic
1141581909 16:85005018-85005040 GGATGAAAGGGGAACCTTTGGGG - Intronic
1141684929 16:85564754-85564776 GCAGGCAGAGGGAGCCTGTGCGG + Intergenic
1142127536 16:88417592-88417614 GTAGGAAGAGGGACCATGTGCGG - Intergenic
1142504010 17:351342-351364 GGAGGCAGTGGGAGCTATTGAGG - Intronic
1142657569 17:1404015-1404037 AGAGGGAGAGGGAGACTGTGGGG + Intergenic
1143130034 17:4672257-4672279 GGAAGAGGAGGAAGACTTTGAGG - Exonic
1143524961 17:7466541-7466563 GGAGGAAGAGGCAGCTGTGGTGG + Exonic
1143591244 17:7886691-7886713 GTGGGGAGAGGGTGCCTTTGGGG + Intronic
1143608824 17:8006139-8006161 GGAGGAAGAGAGAGCCAGTGGGG + Intronic
1143608831 17:8006164-8006186 GGAGGAAGAGAGAGCCAATGGGG + Intronic
1143608845 17:8006212-8006234 GGAGGAAGAGATAGCCAATGGGG + Intronic
1144248343 17:13390880-13390902 GGAGACAGAGGGAGACTTTGGGG - Intergenic
1144254157 17:13449289-13449311 TGAGGCAGATGGATCCTTTGAGG + Intergenic
1144477096 17:15597721-15597743 TGAGGAAGAAGGTGCTTTTGGGG - Intronic
1144625691 17:16843418-16843440 GCAGGTAGAGGGAGCCTCTGCGG + Intergenic
1144748779 17:17633909-17633931 GGAGGAAGAGGGAGCAGGAGCGG - Intergenic
1144880740 17:18429302-18429324 GCAGGTAGAGGGAGCCTCTGCGG - Intergenic
1144921144 17:18765646-18765668 TGAGGAAGAAGGTGCTTTTGGGG + Intronic
1145151495 17:20515085-20515107 GCAGGTAGAGGGAGCCTCTGCGG + Intergenic
1145185153 17:20787583-20787605 GGAGGGAGAGAGAGGCTTTCTGG - Intergenic
1145417944 17:22740509-22740531 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1145937501 17:28723505-28723527 GGAGGAAGGGGGAGGGTGTGGGG + Intronic
1146162845 17:30569335-30569357 GCAGGTAGAGGGAGCCTCTGCGG + Intergenic
1146238357 17:31188796-31188818 GGAGGAAGATGGAGGCTGGGAGG - Intronic
1146564132 17:33897318-33897340 GGAAGGAGAGAGAGGCTTTGGGG - Intronic
1146651503 17:34609662-34609684 TGAGCAATAGGGAGCCTTTAGGG - Intronic
1146815193 17:35936841-35936863 GGAGGAAGAGAAAACCTGTGAGG + Intronic
1147186392 17:38715616-38715638 GGAGGAAGAGGAAGCCGAGGAGG - Exonic
1147708879 17:42448493-42448515 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1148749773 17:49938829-49938851 TCAGGCAGAGGAAGCCTTTGTGG - Intergenic
1148863840 17:50618525-50618547 GGAGGAGGAGGGAGTGTTTGGGG - Intronic
1148909991 17:50936820-50936842 GCAGGAGGAGGGAGGATTTGGGG - Intergenic
1149724122 17:58875279-58875301 GAAGGAAGAAGGAGAATTTGGGG + Intronic
1150069230 17:62138089-62138111 TGAAGAAGCGGGAGCCTCTGCGG - Intergenic
1150074125 17:62178255-62178277 GGAGCATGAGAGAGCTTTTGGGG + Intergenic
1150222020 17:63501086-63501108 GGAGGATGAGGGAGACGATGAGG - Intronic
1150227556 17:63532102-63532124 GGAGGCAGTGGGAGATTTTGGGG + Intronic
1151381708 17:73730211-73730233 GAAGGCAGAGAGAGCCTTTTAGG - Intergenic
1151561600 17:74872843-74872865 GTAGGAGCAGGGCGCCTTTGGGG - Intronic
1151731939 17:75916688-75916710 GGAGGACAAGGAAGGCTTTGTGG + Intronic
1151908652 17:77066610-77066632 AGAGGAAGAAGGTGCCCTTGGGG - Intergenic
1151957160 17:77386211-77386233 GGGGCAGGAGGGAGCCTGTGGGG - Intronic
1152350555 17:79781860-79781882 GCAGGCAGAGGGAGGGTTTGGGG + Intronic
1152514989 17:80817802-80817824 GGAAGAAGAAGGGGCCTTAGGGG + Intronic
1153327900 18:3840469-3840491 GGAAGCAGAGGGAGACTATGTGG - Intronic
1153799587 18:8657657-8657679 GCAGGCACAGGGGGCCTTTGTGG + Intergenic
1154158368 18:11960951-11960973 GCATGAAGATGGAGCCTGTGAGG + Intergenic
1154173005 18:12064104-12064126 GGAGGAAGTGGGAGGCGATGGGG - Intergenic
1155657612 18:28210048-28210070 GGAGGAAGGAGTAGCCTTGGGGG + Intergenic
1155909741 18:31494237-31494259 ATAGGAAGAGGGTACCTTTGGGG + Intergenic
1156171337 18:34490100-34490122 GCAGGAAGAAGGAGACATTGGGG + Intergenic
1156269483 18:35517710-35517732 GGAGGCAAAGGGAGTCTCTGTGG - Intergenic
1156879886 18:42064072-42064094 GGAGGAAGAGGAAGAGTTTGAGG + Intronic
1157102876 18:44745781-44745803 GGAGCAGGAGGAAGCCTTGGAGG + Intronic
1157242972 18:46028346-46028368 GGATGAAGCGGCAGCCTTTTGGG - Intronic
1157319705 18:46624546-46624568 GAAGGAAGAGGAAACCTTTTGGG - Intronic
1158093291 18:53740786-53740808 AGAGGAAGAGGGTACGTTTGGGG + Intergenic
1160322028 18:77905430-77905452 GGTGGAAGAGGCGGCCCTTGGGG - Intergenic
1161259393 19:3328424-3328446 GGAGGATCAGGGTGACTTTGTGG - Intergenic
1161994392 19:7703613-7703635 GGGGGAAGAGGGAGCAGCTGTGG - Intergenic
1162163708 19:8738779-8738801 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1162346202 19:10119472-10119494 GGAGGAAGAGGGACCCGCCGGGG + Intronic
1163317849 19:16553786-16553808 GGGGGAAGAGGAGGCCGTTGTGG + Exonic
1163367248 19:16882355-16882377 GGAGGAAAAGAGAGACCTTGGGG - Intergenic
1163376921 19:16938740-16938762 GGAGGAAGAGGGTGGCTGGGAGG - Intronic
1163430105 19:17262378-17262400 GGAGGCAGGAGGATCCTTTGAGG - Intronic
1163432935 19:17279009-17279031 GGAGGAGGATGAAGCCATTGAGG + Exonic
1164168285 19:22701284-22701306 GGAGGAAGAGGGAGACCGTGGGG + Intergenic
1164237478 19:23349755-23349777 GGAGGAAGGAGTAGCCTTGGGGG - Intronic
1164403121 19:27916583-27916605 GGAGAGAGAAGGAGCCTTTGAGG + Intergenic
1164659479 19:29949905-29949927 AGAGGGAGAGGGAGACTGTGGGG + Intronic
1164838100 19:31371597-31371619 TGAGGTAGAAGGATCCTTTGAGG - Intergenic
1165897708 19:39153211-39153233 GGAGGGACTGGGAGCTTTTGGGG - Intronic
1168257776 19:55175974-55175996 GGAGGAAGGGGAAGCTTTGGAGG - Intronic
1168344211 19:55642576-55642598 GGGGAAAGGGGGAGCCTTGGGGG - Exonic
1168401160 19:56087013-56087035 GCAGGAGGAGGGTGCTTTTGGGG + Intergenic
1168710937 19:58499517-58499539 GGAAGTAGAGGAAGCCTTCGCGG + Exonic
1202702172 1_KI270712v1_random:172728-172750 GAATGAAGAGTGAGGCTTTGGGG + Intergenic
925126547 2:1461248-1461270 GGTGGAGGAAGGAGCCTCTGGGG - Intronic
925247823 2:2400443-2400465 GGAGCACGAGGGAGCGTGTGGGG + Intergenic
925261564 2:2533325-2533347 GGAGCAAAAGGGAGCATTGGAGG - Intergenic
925343658 2:3154340-3154362 GCAGGAAGAGGAAGCCGGTGAGG - Intergenic
925407767 2:3616801-3616823 AGAGGGAGAGGGAGACTGTGGGG + Intronic
925465046 2:4099727-4099749 GGAGCATTAGGGAGCCTTAGAGG - Intergenic
925691110 2:6524424-6524446 AGAGGAATAGAGAGCCTTTCAGG - Intergenic
926316487 2:11714246-11714268 GGAGGAAGAGGCAGAATCTGGGG - Intronic
926445635 2:12938387-12938409 GATGCAAGAGGGAGACTTTGGGG - Intergenic
927705708 2:25295196-25295218 GGAGGAAGGGGCAGCCTCTAAGG - Intronic
927929824 2:27036935-27036957 GGAAGAAGAGGGAGCTATTAAGG + Intronic
928934042 2:36656038-36656060 GGAAGTAGATGGAGCTTTTGTGG - Intergenic
929562018 2:42961980-42962002 GGAGGGGGAGGGGGCCTGTGGGG + Intergenic
930158301 2:48127650-48127672 GGAGGGAGAGGGAGGGGTTGGGG + Intergenic
930604801 2:53482698-53482720 AAAGGAAAAGGGAGCCCTTGGGG - Intergenic
930890071 2:56374308-56374330 GGTGGCAGGGGGAGCCTTTGAGG + Intronic
931197837 2:60069696-60069718 TGAGGCAGAGGGGGCCTTTAAGG + Intergenic
932451166 2:71811744-71811766 GGAGGTAGAAGGAGGGTTTGTGG + Intergenic
932510920 2:72289215-72289237 GCAGGAACAAGGGGCCTTTGAGG + Intronic
932691136 2:73914752-73914774 GGAGGAAGAGGAAGCTGCTGTGG - Exonic
933210739 2:79565593-79565615 GGAGGTAGATAGAACCTTTGAGG + Intronic
933752789 2:85613732-85613754 GGAGGAAGAGGATATCTTTGGGG + Intronic
933949906 2:87319977-87319999 AGAGGAAGAGGCAGGCTGTGGGG + Intergenic
933985567 2:87589369-87589391 GGAGGAAGAAGGAACTTGTGGGG - Intergenic
934173087 2:89556174-89556196 GAATGAAGAGTGAGGCTTTGGGG + Intergenic
934283402 2:91630531-91630553 GAATGAAGAGTGAGGCTTTGGGG + Intergenic
934976349 2:98805544-98805566 GGAGGAGGAGGGAGATTGTGTGG - Intronic
935113006 2:100108971-100108993 GGAGGATGCGGGAAACTTTGGGG - Intronic
935217375 2:100984998-100985020 AGAGCAAGAGGCAGCCTTGGAGG - Intronic
935217899 2:100988930-100988952 GGAGGAACAGGGAGGCCTGGAGG - Intronic
935236246 2:101140677-101140699 GTTGGAAGAGGTTGCCTTTGGGG - Intronic
936122629 2:109760142-109760164 GGAGGATGCGGGAAACTTTGGGG + Intergenic
936222065 2:110611330-110611352 GGAGGATGCGGGAAACTTTGGGG - Intergenic
936308276 2:111361431-111361453 GGAGGAAGAAGGAACTTGTGGGG + Intergenic
936330286 2:111541620-111541642 AGAGGAAGAGGCAGGCTGTGGGG - Intergenic
936370564 2:111898843-111898865 GGAGGAAGCAGGGGCCTCTGGGG + Intronic
936376813 2:111947970-111947992 GCAGGAAGTGTGAGCCCTTGGGG + Intronic
936983600 2:118287442-118287464 GGTGTGATAGGGAGCCTTTGAGG + Intergenic
937100468 2:119264405-119264427 GGAGGAAGTTGGAGCCAGTGTGG - Exonic
938409014 2:131048497-131048519 TGAAGAAGAGAGAGCCTGTGGGG - Exonic
938971788 2:136439471-136439493 GGAGCAAGGGGCTGCCTTTGGGG + Intergenic
939477118 2:142701918-142701940 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
939725879 2:145721002-145721024 GGAGCCACAGGGAGTCTTTGTGG + Intergenic
940224011 2:151382983-151383005 GGTGGAGGAGGGAGACTTTGGGG - Intergenic
940298972 2:152159729-152159751 AGAGGGAGAGGGAGACTGTGGGG - Intronic
941439169 2:165512042-165512064 TGAGGAAGTGTGAGCATTTGTGG + Intronic
941606575 2:167604861-167604883 CAAGGAAGAGTGAGCCTTTCAGG + Intergenic
941619906 2:167765411-167765433 GGAGGAAGTGGGAGCCCCTCAGG + Intergenic
941717261 2:168777157-168777179 GCAGGAAGAGAGAGACATTGGGG - Intergenic
942024515 2:171899239-171899261 AGAGGGAGAGGGAGACTGTGGGG - Intronic
943648494 2:190431698-190431720 AGAGGGAGAGGGAGACTGTGGGG + Intronic
943767632 2:191678917-191678939 GGAGGAGGAGTTAGCCTTTCTGG + Intronic
945316825 2:208378368-208378390 AGAGGGAGAGGGAGACTGTGGGG + Intronic
945435118 2:209809581-209809603 AGAGGAAGAGGGAGCCTCTAGGG - Intronic
945530647 2:210950141-210950163 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
945540534 2:211081034-211081056 GGAGGCAAACGGAGCTTTTGGGG - Intergenic
946250410 2:218407949-218407971 GCAGGCAGAGGGTGCCTTTGAGG + Intergenic
946595218 2:221298708-221298730 CGAGCAAGAGGGATCCTTTTTGG - Intergenic
947669593 2:231927792-231927814 GAGGGAAGAGGGAGGCTTGGAGG - Intergenic
947705886 2:232275147-232275169 GGAGGAAGAGGAAGTCTATTTGG - Intronic
947796876 2:232898801-232898823 GAAGGAAGTGTGAGCCTGTGAGG + Intronic
948080640 2:235202687-235202709 AGAGGAGGAGGGAGCCTGCGTGG + Intergenic
948290720 2:236822341-236822363 GGTGGAAGAGGAAGGCTTGGAGG + Intergenic
948505180 2:238423376-238423398 GCTGGAAGAGGGAGGCTTCGAGG + Intergenic
948723391 2:239917824-239917846 GGAGGATGAGAGAGACCTTGGGG - Intronic
1168842043 20:915860-915882 GGGGGCAGAGGGCGGCTTTGGGG - Intronic
1168881084 20:1206843-1206865 GGAGAGAGAAGGAGCCTGTGAGG - Intronic
1169005197 20:2200940-2200962 GGAGGAGGAGCGAGCGTGTGGGG - Intergenic
1169936648 20:10890915-10890937 AAAAGAAGATGGAGCCTTTGGGG - Intergenic
1170018003 20:11803856-11803878 GGAGGAAGAGAGAATTTTTGAGG - Intergenic
1170542962 20:17407269-17407291 GAAGGAAGAGGCAGCCTCAGGGG + Intronic
1170692187 20:18625781-18625803 GAATGAAGAGGAAGCCTGTGGGG + Intronic
1170816816 20:19720935-19720957 GGAGGAGGCAGCAGCCTTTGGGG - Intronic
1171103450 20:22408772-22408794 TGAAGAAAAGAGAGCCTTTGTGG + Intergenic
1172279777 20:33700777-33700799 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1172861954 20:38061498-38061520 GGAGAAAGAGGGAGCATTGTTGG - Intronic
1172913097 20:38424720-38424742 GGAGGCAGAGAGAGCTTCTGGGG + Intergenic
1173104448 20:40120030-40120052 TGAGGCAGAATGAGCCTTTGGGG - Intergenic
1173302746 20:41818285-41818307 GGTGGAAGAGGAAGCCATGGGGG - Intergenic
1173619516 20:44426078-44426100 GGGGGAAGATGGAGCCATGGAGG + Intronic
1173873895 20:46357823-46357845 AGAGGAAGAGGGAGCCGGTGGGG - Intronic
1174203904 20:48826126-48826148 GGAGAAAGAGGGAGACTCTGGGG - Intronic
1174354297 20:49988057-49988079 AGAGGAAGAGGGAGCCTCGAGGG - Exonic
1174766174 20:53255878-53255900 GGAGGAGGAGGCTGGCTTTGGGG - Exonic
1174815048 20:53680114-53680136 GGTGAAAGAGAGATCCTTTGAGG + Intergenic
1175124360 20:56740452-56740474 GTACTAAGAGGGGGCCTTTGGGG - Intergenic
1175410231 20:58762945-58762967 GAAGGAAGAGGGAGTCCTTTGGG - Intergenic
1175761257 20:61563399-61563421 GGAGAAGGAGGGAGACATTGGGG - Intronic
1175921097 20:62450956-62450978 GGAGGTAGAGGGAGGCCTGGTGG - Intergenic
1177392178 21:20490153-20490175 GGAAGAAGAGAGTGCCTTGGAGG - Intergenic
1177746970 21:25227969-25227991 GGAAGAAAAGGCAGTCTTTGTGG + Intergenic
1179666898 21:42919122-42919144 GGAGGAAGAAGCTGCCTTGGGGG + Intergenic
1179724016 21:43331689-43331711 GCAGGAAGATGGAGGCTTTCTGG - Intergenic
1180090348 21:45531026-45531048 GGAGGTAGCGGGAGCTTCTGAGG + Intronic
1180090464 21:45531290-45531312 GGCGGGAGAGGGAGCCTCCGGGG + Intronic
1180141997 21:45898572-45898594 GGAGGGAGAGGGAGGCTGTGAGG - Intronic
1180142011 21:45898616-45898638 GGAGGGAGAGGGAGGCCGTGAGG - Intronic
1180142024 21:45898660-45898682 GGAGGGAGAGGGAGGCTGTGAGG - Intronic
1180142038 21:45898704-45898726 GGAGGCAGAGGGAGGCCGTGAGG - Intronic
1180142051 21:45898748-45898770 GGAGGCAGAGGGAGGCCGTGAGG - Intronic
1180142096 21:45898924-45898946 GGAGGGAGAGGGAGGCCGTGAGG - Intronic
1181487707 22:23241915-23241937 AGAGGAAGAGGGTGATTTTGTGG - Intronic
1182278340 22:29204395-29204417 GGAGGGAGAGGGAGCCCTTGGGG + Intergenic
1183268229 22:36844133-36844155 GGTGCTAGAGGGAGCCTGTGAGG + Intergenic
1183529308 22:38344239-38344261 GGAGGAAGAGGGAGAGGGTGTGG + Intronic
1183616516 22:38948974-38948996 GGAGAGAGAGGGAGGCTGTGAGG - Intergenic
1183705862 22:39474581-39474603 GGAGGCAGTGGGAGCCCGTGAGG - Intronic
1184217493 22:43077392-43077414 GGAGGGTCAGGGAGGCTTTGTGG - Intronic
1184222279 22:43108926-43108948 GGAGAAAGAAGGACCGTTTGGGG - Intergenic
1185086149 22:48742148-48742170 GAAGGATGAGGGGGCCTGTGGGG - Intronic
1185151143 22:49164592-49164614 GGAGGAAAGGGGAGCTGTTGAGG - Intergenic
950139098 3:10602877-10602899 GGAGGAGGAGGGAGGCTCTGAGG - Intronic
950323492 3:12081710-12081732 GGTGGAAGAGGGGGCATATGTGG - Intronic
951301716 3:21006569-21006591 GCTGGGAGAGGGAGCATTTGGGG - Intergenic
951382139 3:21996391-21996413 GGAGTGACAGGGAGCCTCTGAGG - Intronic
952364539 3:32663475-32663497 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
952558384 3:34559926-34559948 GGAGCAAGAGGGAGCAGGTGGGG + Intergenic
952954078 3:38545797-38545819 GGAGGAGCCTGGAGCCTTTGAGG + Intergenic
953100467 3:39820841-39820863 GGAGCATGAAGGAGCCTTTAGGG - Intronic
953719644 3:45344177-45344199 TGAGAAAGAGGGACCCCTTGTGG + Intergenic
953768359 3:45760945-45760967 AGCGGAAGAGGCAGCCTTGGCGG + Intronic
954034685 3:47844975-47844997 AAAGGAAGAGGGAGTCTGTGGGG + Intronic
954144882 3:48629577-48629599 GGAGGAAGAATGAGCCTTTGTGG - Intronic
954297744 3:49683594-49683616 GGAGGCAGATGAAGCCCTTGTGG - Exonic
954810681 3:53245447-53245469 GGAGGGTGAGGGAGCCTCTCTGG - Intronic
954962578 3:54579319-54579341 GCAGGAAGACGGAGCCAGTGTGG - Intronic
955520593 3:59771973-59771995 GGAGGCAGATGTATCCTTTGTGG - Intronic
955699976 3:61672714-61672736 AGAGGGAGAGGGAGACTGTGGGG + Intronic
957334737 3:78812450-78812472 GGTGAAAGAGGGAGCCTTGTAGG - Intronic
959586199 3:108026880-108026902 AGAGGGAGAGGGAGACTGTGGGG + Intergenic
961484449 3:127207273-127207295 GGAAGCAGAGGGGGCCTCTGAGG + Intergenic
962063018 3:131951538-131951560 AGAGGGAGAGGGAGACTGTGGGG - Intronic
962679066 3:137780257-137780279 GAAGGAACAGGAGGCCTTTGGGG - Intergenic
963081131 3:141394619-141394641 GAAGGAAGAGGAAGGCTCTGGGG - Intronic
963238854 3:142982933-142982955 GAAGCGTGAGGGAGCCTTTGTGG - Intronic
963247004 3:143072923-143072945 GGAGGACAAGGGAGGTTTTGTGG - Intergenic
963271992 3:143294307-143294329 GGAGGAAGGGGGAGCGGTTTAGG + Intronic
963641990 3:147872405-147872427 GGAGGTAGAGGGAACCTCTTGGG + Intergenic
964503445 3:157373527-157373549 AAAGGAATAGGGAGCATTTGGGG + Intronic
964721031 3:159767103-159767125 GGAGAAGGAGGTAGCATTTGAGG + Intronic
965234197 3:166093926-166093948 GGAGGCAGAGGGAGAGATTGGGG + Intergenic
966175470 3:177133667-177133689 GGAGGCAGATGGATCATTTGAGG + Intronic
967139369 3:186541323-186541345 GAAGGAAAAGGGACCCTTTTAGG - Intronic
967524099 3:190472702-190472724 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
968042587 3:195600478-195600500 AGAGGGAGAGGGAGACCTTGGGG + Intergenic
968129112 3:196182099-196182121 GGAGGGAGAGGAAGCCTGGGAGG - Intergenic
968214174 3:196873933-196873955 TGAGGCAGAAGGATCCTTTGAGG - Intronic
968303626 3:197634278-197634300 GGAGGGAGACGGAGGCTGTGAGG + Intergenic
968417469 4:452666-452688 GTGGGAAGAGGGTACCTTTGGGG + Intronic
968635676 4:1677428-1677450 AGAAGAGGAGGGAGCCCTTGGGG - Intronic
968708707 4:2096526-2096548 GGAGGAGGAGGGACTCTTGGTGG - Intronic
968756278 4:2417976-2417998 GGAGGGAGAGGGGCCCGTTGTGG + Intronic
968974042 4:3811840-3811862 GGGGTCAGGGGGAGCCTTTGAGG + Intergenic
969256704 4:6007386-6007408 GGAGGGAGAGGGAGCCTTCTGGG - Intergenic
969444743 4:7238274-7238296 GGAGGTAGAGGGAGTCTGGGGGG + Intronic
969501505 4:7556254-7556276 GGAGGAAGAGTGGGCTTGTGAGG + Intronic
969584424 4:8083872-8083894 TGTGGAAGAGGGAGCCTTTTGGG - Intronic
969849080 4:9942562-9942584 TGAGGAAGAGGGGGCCAGTGGGG + Intronic
970472909 4:16394296-16394318 AGAGGGAGAGGGAGACTGTGGGG + Intergenic
970692346 4:18633848-18633870 AGAGGGAGAGAGAGCCTATGAGG + Intergenic
970794333 4:19893138-19893160 GGAGGAAGGAGTAGCCTTAGGGG - Intergenic
970968426 4:21953738-21953760 AGAGGAAGAGGTGGCCTTAGAGG + Intergenic
972304574 4:37819831-37819853 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
972552804 4:40148446-40148468 AGAGGGAGAGGGAGACTGTGGGG + Intronic
972674648 4:41248566-41248588 AGGGCAAGAGGGAGCTTTTGTGG + Intergenic
972911682 4:43824185-43824207 GGAGCAAGAGGGAGCATGTGGGG + Intergenic
973052586 4:45612874-45612896 GGAGGAAGGGGTAGCCTTGGGGG - Intergenic
973274222 4:48291768-48291790 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
977375087 4:96192437-96192459 TGAGGAAGAGGTAGCGTTGGAGG - Intergenic
978852739 4:113357765-113357787 GGAAGACGATGAAGCCTTTGAGG + Exonic
980174411 4:129327155-129327177 GGAGAAAGAGGGATCGTTTGGGG - Intergenic
980576830 4:134693899-134693921 GAAGAAAGAGGGGGCCTTGGAGG - Intergenic
980729910 4:136811995-136812017 GGGGGAAGGGGGAGCCTTTCTGG + Intergenic
980883529 4:138738796-138738818 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
981581412 4:146252042-146252064 GCAGGTAGATGGAGCCTTTGGGG + Intergenic
981628028 4:146783435-146783457 GGAGGAAAATGGAGCATATGTGG + Intronic
982134069 4:152257290-152257312 GGAGGGGGAGGGGGCATTTGTGG + Intergenic
983000027 4:162402823-162402845 GGAGGAAGGGGCAGGATTTGGGG - Intergenic
983448700 4:167884491-167884513 GGAGTAAGAGGAAGTTTTTGGGG - Intergenic
983652068 4:170045754-170045776 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
984714857 4:182916733-182916755 GGAGGGAGGGGGAGCCATGGGGG + Intronic
984813882 4:183819540-183819562 AGAGGGAGAGGGAGACTGTGGGG + Intergenic
984977364 4:185241471-185241493 AGAGGGAGAGGGAGACTGTGGGG + Intronic
985649459 5:1100586-1100608 GGAGGAAGACGGCGCCCTCGGGG + Intronic
985965874 5:3338490-3338512 GGAGGACGAGGAAGCCATCGTGG - Intergenic
985982444 5:3482125-3482147 AGTGGAAGAGGCACCCTTTGAGG - Intergenic
986370896 5:7078977-7078999 GGACGGAGAGGGAGCATTTCTGG + Intergenic
986455782 5:7916379-7916401 GCAGGATGAGGGAGCCCTAGAGG - Intergenic
986975795 5:13392401-13392423 GCAGGAAGAGGAAGCATTTGTGG - Intergenic
988075299 5:26344819-26344841 GGAGTAAAAGGAAGTCTTTGAGG - Intergenic
988854060 5:35209968-35209990 GGAGCAAGAGGAAGCCTTTTCGG - Intronic
989042314 5:37241498-37241520 GAAAGAAGAGGGAAACTTTGGGG + Intronic
989417472 5:41196467-41196489 GGAGAAGGAGGGAGCTTTTTGGG + Intronic
989789536 5:45380324-45380346 GTATTAAGAGGGAGCCTTTTGGG - Intronic
991198540 5:63962246-63962268 GGAGGAAGAGGGAGACTGAAAGG - Intronic
991403391 5:66277537-66277559 GCAGGAGGAGGCTGCCTTTGAGG + Intergenic
991732002 5:69598610-69598632 GGAGGAATAGGGATCTTTTAAGG + Intergenic
991808436 5:70453754-70453776 GGAGGAATAGGGATCTTTTAAGG + Intergenic
991862949 5:71029247-71029269 GGAGGAATAGGGATCTTTTAAGG - Intergenic
991959002 5:72022868-72022890 GGAGGAAGAGGGAGCCTTTGGGG - Intergenic
992150938 5:73902418-73902440 AGTGGAAGAGGGAGACTTTAGGG - Intronic
993881046 5:93361457-93361479 GGAGGAAGAGAGAGTATCTGTGG + Intergenic
994380236 5:99061785-99061807 GAAGGAAGAGAGAGCCTATGAGG + Intergenic
995162016 5:108993534-108993556 AGAGGGAGAGGGAGACTGTGGGG + Intronic
995236401 5:109833671-109833693 AGAGGGAGAGGGAGACTGTGGGG + Intronic
995561603 5:113387990-113388012 GGAGGAAGGGTGGGCCTCTGTGG - Intronic
995801049 5:115995438-115995460 GGAGGAAGAGAGAGGCACTGCGG - Intronic
995994320 5:118282021-118282043 AGAGGGAGAGGGAGCCCGTGGGG - Intergenic
996016348 5:118538149-118538171 GGAGGAAGATGGAGGCTGGGAGG + Intergenic
996386446 5:122914105-122914127 AGAGGAAGAGGGAGACCGTGGGG + Intronic
996919360 5:128749706-128749728 GGAGGCAGAGGCGGCCTTTGTGG - Intronic
997256357 5:132431275-132431297 GGAGTTGGAGGGAGACTTTGGGG + Intronic
997727329 5:136132815-136132837 GGAGGGAGAGGGAGCCCGGGAGG - Intergenic
997839526 5:137226493-137226515 GGAGGATGAGGTGGCCTCTGTGG - Intronic
998302710 5:141040319-141040341 GGAGGAAGAGGGAGTGTCTGAGG + Intergenic
998325158 5:141273661-141273683 GGAGGTAGAGGCAGATTTTGAGG - Intergenic
999230166 5:150057188-150057210 GGAGGAAACGGGAGCCTGTGAGG - Intronic
1000010115 5:157223153-157223175 GGAGGAAGAGGAAGTAGTTGAGG + Intronic
1000095912 5:157970696-157970718 CGAGGCAGACGGATCCTTTGAGG - Intergenic
1000299872 5:159946466-159946488 GGAGAAATGGGGAGGCTTTGCGG - Intronic
1001089418 5:168726425-168726447 GGAGGAAGAGGGAGGCAGGGAGG + Intronic
1002028930 5:176414148-176414170 GGAAGAGGAGGGAGGCCTTGTGG - Intronic
1002364159 5:178697156-178697178 AGAGGAAGCGGGTGCCTTAGAGG + Intergenic
1003136694 6:3439799-3439821 GGAGGAAGAGGGAGCCAAGAAGG + Intronic
1004152305 6:13133259-13133281 AGAGGGAGAGGGAGACTGTGGGG - Intronic
1004152313 6:13133288-13133310 AGAGGGAGAGGGAGACTGTGGGG - Intronic
1004184132 6:13407412-13407434 GGAGGAAGATGTAGTCTTTGAGG - Intronic
1004540409 6:16544356-16544378 AGAGGAAGGGGGAGGCCTTGAGG - Intronic
1005929661 6:30474482-30474504 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1006418906 6:33921418-33921440 TGAGGAAGAGGGAGCCATGTGGG + Intergenic
1006554004 6:34850447-34850469 GGAGGTAGAAGGAGACATTGGGG - Intronic
1006945919 6:37784456-37784478 GGAGGGAGAGGGAGGCGGTGGGG + Intergenic
1007078960 6:39085341-39085363 GGAGGAAGGGGCAGCCAGTGAGG - Intronic
1007103459 6:39267482-39267504 GGATGATGGAGGAGCCTTTGAGG + Intergenic
1007237437 6:40401005-40401027 AGAGGATGTGGGAGCCTCTGGGG - Intronic
1007272876 6:40651486-40651508 AGAGCAAGAGGGAGGCATTGTGG + Intergenic
1007274039 6:40660642-40660664 CGAGGAAGAGGGAGTCTTGCTGG + Intergenic
1007569571 6:42879943-42879965 GGAGCAAGAGTGAGTGTTTGGGG + Exonic
1008502602 6:52198908-52198930 GGGGGAAGAGGGAGATTTAGAGG + Intergenic
1008911300 6:56736502-56736524 GGAGAAAGAGGTAGCCCTGGAGG - Intronic
1009474282 6:64068972-64068994 GGAGGAAGAGGGAGACTTGATGG + Intronic
1010832857 6:80552346-80552368 GGAGGAACAGGGATAGTTTGGGG - Intergenic
1011297077 6:85837949-85837971 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1011509083 6:88080371-88080393 GGAGTGAGAGGAAGCCTTTGAGG + Intergenic
1011597008 6:89025748-89025770 GGAAGAGCACGGAGCCTTTGAGG - Intergenic
1011836416 6:91436572-91436594 GGAGAGAGAGGGAGCCTTCAGGG + Intergenic
1012428527 6:99141377-99141399 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1012501599 6:99894663-99894685 GGAGGAAAAGAGAGAGTTTGAGG - Intergenic
1012628230 6:101430781-101430803 GGAGGAAGAGGATGCCATGGTGG + Intronic
1014738043 6:125118387-125118409 GGAGAAAGAAGGATCCTTGGAGG + Intergenic
1014903351 6:126996097-126996119 GGAGAAAGAGGGAGTGTATGGGG + Intergenic
1016292765 6:142541991-142542013 GGAGGAAGGAGTAGCCTTGGGGG - Intergenic
1016304997 6:142674824-142674846 GGAGGAAGAGGGAAGCTAAGTGG - Intergenic
1017015981 6:150099835-150099857 GGAGGAAGGAGTAGCCTTGGGGG - Intergenic
1017058575 6:150459721-150459743 GGAGGGAGAGGGAGGAATTGAGG - Intergenic
1017097306 6:150815943-150815965 GGAGGCAGGGGGAGGCTTTTGGG + Intronic
1017211184 6:151858376-151858398 AGAGGAAGAGCTAGCCTTTTTGG + Intronic
1017857115 6:158359526-158359548 GGAGAAAGATGGAGGCTTGGAGG + Intronic
1017870125 6:158479983-158480005 GGAGGAAGAGGGAGGGGTGGAGG - Intronic
1018528319 6:164737033-164737055 AGAGGGAGAGGGAGACTGTGGGG + Intergenic
1018727813 6:166627208-166627230 GGAGGCGGAGGGAGCGATTGTGG - Intronic
1018899829 6:168045487-168045509 GAAGAAAGAGGGAGCCTGGGGGG - Intergenic
1019826851 7:3291702-3291724 GAGGGAATTGGGAGCCTTTGAGG - Intergenic
1020448498 7:8295531-8295553 GGATGCAGAGGGAGTCTTTCTGG + Intergenic
1020899808 7:13990454-13990476 GGAGGAGGAGGGAGTGCTTGGGG + Intronic
1021991710 7:26147496-26147518 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1023329841 7:39103369-39103391 GGAGGGAGATGGAGTCTTGGTGG + Intronic
1024063693 7:45716472-45716494 GGAGCCACAGGGAGCCTGTGAGG + Exonic
1024246816 7:47477059-47477081 GCAGGCATAGGGTGCCTTTGTGG - Intronic
1024742910 7:52374199-52374221 GGAGGAAGAGAGAGCGAGTGGGG + Intergenic
1024768885 7:52694671-52694693 GCAGGGAGAGGGAACATTTGTGG + Intergenic
1024839595 7:53570483-53570505 GGAGAAAGATGTAGCCTGTGAGG + Intergenic
1025793499 7:64717324-64717346 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1026765546 7:73157264-73157286 GGAGGAAGGGGGACCCACTGAGG - Intergenic
1026796600 7:73369720-73369742 AGAGGAAGAGGCAGGCTTGGAGG - Intergenic
1026916346 7:74122153-74122175 GGAGGGGCAGGGAGCCTTGGGGG - Exonic
1027042019 7:74966957-74966979 GGAGGAAGGGGGACCCACTGAGG - Intronic
1027081622 7:75235397-75235419 GGAGGAAGGGGGACCCACTGAGG + Intergenic
1027524263 7:79246701-79246723 GGAGGTAGAGGGAGAGTTAGGGG + Intronic
1027543757 7:79500620-79500642 GGAGGCAGAGGGAGTCTATGGGG - Intergenic
1028106615 7:86886481-86886503 GGAGACAGAGGTACCCTTTGAGG + Intronic
1029204391 7:98860240-98860262 GGAGGAGGAAGGAGACTTTCAGG + Exonic
1029390207 7:100269978-100270000 GGAGGAAGGGGGACCCACTGAGG + Intronic
1029420512 7:100469564-100469586 GGTGGGAGAGGGAGCCTTGGAGG - Intronic
1029490218 7:100866671-100866693 GGAGGAAGAGGAGGCCACTGTGG + Exonic
1029515000 7:101018512-101018534 GGAGGAAGAGGGAGCCCTGGCGG - Intronic
1030723127 7:112893227-112893249 GGAAGAAGAAGGCGCCTTTTAGG - Intronic
1031813277 7:126399487-126399509 GAAGCAATAGAGAGCCTTTGAGG + Intergenic
1032056505 7:128688801-128688823 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1032094778 7:128932566-128932588 GGAAGGAGAGGGAGCACTTGGGG - Intergenic
1032157097 7:129477207-129477229 GGAGGGGGAGGGAGACTGTGGGG + Intronic
1032875214 7:136031426-136031448 GTAGGAGGAGGGAGACTATGTGG + Intergenic
1033048210 7:137981228-137981250 GGAGGAAAAGGGAGCCTGGGTGG + Intronic
1033332951 7:140430979-140431001 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1034646465 7:152652071-152652093 GGGTGAAGTGGGAGCCTGTGAGG + Intronic
1035246441 7:157565486-157565508 GCCGGAAGAGGGTGCCTGTGTGG - Intronic
1035460531 7:159035839-159035861 GGAAGGACAGGGAGCGTTTGCGG - Intronic
1035544343 8:468205-468227 GGAGCAAGCAGGAGCCTTGGGGG + Intronic
1036036916 8:5029793-5029815 GGAGGAAGAGAGAGCCAGGGGGG - Intergenic
1036730703 8:11261582-11261604 GGAGGAGGAGGCGGCCTTCGTGG - Intergenic
1037943298 8:22971043-22971065 GGAGGAAGATGGAGGATTTCAGG - Intronic
1038238514 8:25785322-25785344 GGAGGAAGGGGAAGTATTTGTGG + Intergenic
1038700963 8:29848974-29848996 GGAGCAAGAGTGAGCTTTGGAGG + Intergenic
1040053025 8:43033970-43033992 AGAGGGAGAGGGAGACTGTGGGG + Intronic
1040093536 8:43420487-43420509 AGAGGGAGAGGGAGACTGTGGGG + Intergenic
1040839688 8:51772030-51772052 GGAGGAAGAGGGGGCCACAGTGG - Intronic
1041160816 8:55041965-55041987 GGAGGAAGAGAGAGAGTATGAGG + Intergenic
1041348423 8:56925032-56925054 GGGGGAACAAGAAGCCTTTGAGG - Intergenic
1042158572 8:65869238-65869260 GGAGGAAGGAGTAGCCTTAGGGG - Intergenic
1042376550 8:68058665-68058687 GGAGGCAGATGGATCATTTGAGG - Intronic
1042956698 8:74258829-74258851 GGAGGAAGGGTGAGACTCTGGGG + Intronic
1043506849 8:80910933-80910955 GGAGGAAGGAGTAGCCTTGGGGG + Intergenic
1043961769 8:86424800-86424822 AGAGGGAGAGGGAGACTGTGGGG + Intronic
1044872743 8:96635908-96635930 GCAGTATGAGGGAGACTTTGGGG + Intergenic
1045972461 8:108094437-108094459 GGAGGAACAGGGAGGGTTGGGGG + Intergenic
1046628791 8:116603177-116603199 GGAGCAAGAGGGAGCCTTCTGGG - Intergenic
1046978657 8:120312320-120312342 AGAGGAAGAGGAAGCATATGTGG - Intronic
1047078042 8:121426736-121426758 GGGGGTAAAGGGAGCCTTAGAGG + Intergenic
1047586296 8:126277600-126277622 CTAGGAAGAGGAAGGCTTTGGGG - Intergenic
1048580807 8:135728655-135728677 AGAGCAGGAGGGAGCCCTTGGGG - Intergenic
1048774068 8:137925920-137925942 AGAGGAAGAGGGAGCCACAGTGG + Intergenic
1048791929 8:138112344-138112366 GAGGGAGGAGGGAGGCTTTGGGG - Intergenic
1048804736 8:138229550-138229572 TGTGGAAAAGGCAGCCTTTGTGG + Intronic
1049401712 8:142430670-142430692 GGAAGAAGAGGGAGGCTTGTGGG + Intergenic
1049587839 8:143440228-143440250 GGAGGAGGAGGAAGCCTTCGAGG + Exonic
1049688060 8:143946874-143946896 GGAGGAAGAGACCACCTTTGGGG - Intronic
1050572034 9:6949831-6949853 GGAGGGAGAGGGAGACCGTGGGG + Intronic
1050639027 9:7645700-7645722 GGAGAAAGATGTAGCCTGTGAGG - Intergenic
1050915932 9:11132732-11132754 GGAGGAAGAGGGAGCAAAGGGGG - Intergenic
1051234115 9:14980440-14980462 AGAGGAGGAGGGAGCGTTTTAGG - Intergenic
1052337272 9:27332849-27332871 GTAGAAAGAGCAAGCCTTTGCGG - Intronic
1052493008 9:29190007-29190029 AGAGGAAGAGGGAGACCGTGGGG + Intergenic
1053164427 9:35834600-35834622 GGAGCAAGGGGGAACTTTTGGGG + Exonic
1055060915 9:72067742-72067764 GGAGGAAAAAGGGGCCATTGTGG + Intronic
1055888261 9:81092385-81092407 GAAGGAAGAGGCAGAGTTTGGGG + Intergenic
1056222136 9:84460393-84460415 AGTGGTAGAGGGAGGCTTTGGGG - Intergenic
1057482719 9:95458132-95458154 AGAGGAAGGGGTAGCCGTTGGGG + Exonic
1057716352 9:97498894-97498916 AGAGGGAGAGGGAGACTGTGGGG + Intergenic
1057945007 9:99318805-99318827 AGAGGAAGAGGGAGCTTCTGAGG - Intergenic
1058229430 9:102407747-102407769 GGAGAAAGATGTAGCCTTGGAGG - Intergenic
1058678692 9:107423004-107423026 TGAGTCAGAGGGACCCTTTGGGG - Intergenic
1058719086 9:107747349-107747371 GGAGGATGAGGAGGGCTTTGAGG + Intergenic
1058747285 9:108003926-108003948 GGAGGACCAGGGAGCTTTTGGGG - Intergenic
1058890720 9:109358419-109358441 TTAGGAAGTGGGGGCCTTTGGGG + Intergenic
1060416887 9:123437059-123437081 AGATGAAGAGGGAGCCTCTGGGG + Intronic
1060625399 9:125107832-125107854 AGAGGGAGAGGGAGACTGTGGGG - Intronic
1060893042 9:127200623-127200645 GGGGAAAGAGAGAGCCTCTGAGG - Intronic
1061161731 9:128899323-128899345 GGAAGGGAAGGGAGCCTTTGAGG - Intronic
1061368031 9:130182620-130182642 GGAGGCTGAGGAAGCCGTTGAGG - Intronic
1061890473 9:133616686-133616708 GGAGGAAGAGGAGGGATTTGTGG - Intergenic
1061928642 9:133820747-133820769 GGAGGAAGAGGGAACCCTCAGGG + Intronic
1062090590 9:134676600-134676622 AGTGGAAGAAGGAGCCTTTCGGG - Intronic
1062492449 9:136812885-136812907 GGAGGTAGAGGAAGCTTTGGAGG - Intronic
1062521969 9:136961678-136961700 GGAGGAAGAAGGAGGGTTGGGGG + Intergenic
1062720873 9:138043345-138043367 CGAGGTACAGGGAGCCTCTGTGG + Intronic
1185561361 X:1062746-1062768 GGAGGAAGAGTGAGAAGTTGTGG - Intergenic
1185612850 X:1402637-1402659 GGAGAAAGAGGCTGCATTTGGGG - Intergenic
1185631433 X:1518522-1518544 GGGGGACTAGGGAGCTTTTGGGG - Intronic
1185652207 X:1656155-1656177 GGAGGAAGATGGAGGCTGGGAGG - Intergenic
1185980737 X:4774984-4775006 ATGGGAAGAGGGTGCCTTTGGGG - Intergenic
1186987091 X:15028833-15028855 AGAGGAAGAGGGAGACCTGGTGG + Intergenic
1188878913 X:35468271-35468293 TGAGGCAGAGGGATCCTCTGTGG + Intergenic
1189570197 X:42286613-42286635 AGAGGGAGAGGGAGACTGTGGGG + Intergenic
1189655527 X:43240668-43240690 GGTGGAAGAGGGTGCCCTTTGGG - Intergenic
1190520931 X:51279267-51279289 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1191136268 X:57068412-57068434 AGAGGAAGAGTGAGCTCTTGGGG - Intergenic
1191637186 X:63392412-63392434 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1192034213 X:67545787-67545809 GGAGGAAGTGGGAGCCCCCGAGG - Exonic
1192144058 X:68669180-68669202 GGAGGAAGCGGGTTCCTTTTAGG - Intronic
1192230261 X:69259826-69259848 GCAGGGACAGGGAGCATTTGTGG - Intergenic
1193509679 X:82383634-82383656 GAAGTGAGAGGGAGCCTCTGAGG - Intergenic
1195067452 X:101250517-101250539 GGGTGAAGTGGCAGCCTTTGGGG + Exonic
1195257705 X:103105275-103105297 GGAGGGAGAGGGAGACCGTGGGG + Intergenic
1197754058 X:129982831-129982853 GGAGTAAGAGGGAGCCCGGGTGG + Intronic
1197770545 X:130086544-130086566 GGAGGAGGAGGGAGGCGTTCTGG + Intronic
1198097114 X:133390908-133390930 GGCGGGAGAAAGAGCCTTTGGGG - Intronic
1198460897 X:136862162-136862184 GGAGGGAGAGGGTGAGTTTGGGG + Intronic
1198652859 X:138882853-138882875 GGATGAAGAGGGAGGCTTGAGGG - Intronic
1199494194 X:148435071-148435093 GGAGCACTAGGGAGCCTTTGGGG + Intergenic
1199586267 X:149420139-149420161 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1199895110 X:152119912-152119934 GGAGGATGAGGGTGCTGTTGGGG + Intergenic
1200108200 X:153725860-153725882 GGAGGACGTGGTGGCCTTTGCGG + Exonic
1201264947 Y:12197150-12197172 GGAGGATGAGAGAGGCCTTGGGG - Intergenic
1201335635 Y:12878133-12878155 AGAGGGAGAGGGAGACTGTGGGG - Intergenic
1201438418 Y:13984900-13984922 AGAGGAAGAGGTGGCCTGTGGGG - Intergenic
1201438453 Y:13985020-13985042 GGAGGAAGAGGTGGCCTGTGGGG - Intergenic
1201446120 Y:14057688-14057710 GGAGGAAGAGGTGGCCTGTGGGG + Intergenic
1201446155 Y:14057808-14057830 AGAGGAAGAGGTGGCCTGTGGGG + Intergenic