ID: 1069764288

View in Genome Browser
Species Human (GRCh38)
Location 10:70841617-70841639
Sequence TAGGAGGAAGAGGGAGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 1, 2: 2, 3: 51, 4: 440}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069764288_1069764297 19 Left 1069764288 10:70841617-70841639 CCAAAGGCTCCCTCTTCCTCCTA 0: 1
1: 1
2: 2
3: 51
4: 440
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764288_1069764292 -8 Left 1069764288 10:70841617-70841639 CCAAAGGCTCCCTCTTCCTCCTA 0: 1
1: 1
2: 2
3: 51
4: 440
Right 1069764292 10:70841632-70841654 TCCTCCTACCATCAGCTTGAGGG No data
1069764288_1069764291 -9 Left 1069764288 10:70841617-70841639 CCAAAGGCTCCCTCTTCCTCCTA 0: 1
1: 1
2: 2
3: 51
4: 440
Right 1069764291 10:70841631-70841653 TTCCTCCTACCATCAGCTTGAGG No data
1069764288_1069764298 20 Left 1069764288 10:70841617-70841639 CCAAAGGCTCCCTCTTCCTCCTA 0: 1
1: 1
2: 2
3: 51
4: 440
Right 1069764298 10:70841660-70841682 TTTCAACATATGAATTTTTGGGG 0: 28
1: 444
2: 1606
3: 3278
4: 4796
1069764288_1069764296 18 Left 1069764288 10:70841617-70841639 CCAAAGGCTCCCTCTTCCTCCTA 0: 1
1: 1
2: 2
3: 51
4: 440
Right 1069764296 10:70841658-70841680 GATTTCAACATATGAATTTTTGG 0: 182
1: 925
2: 2225
3: 3438
4: 4626
1069764288_1069764299 21 Left 1069764288 10:70841617-70841639 CCAAAGGCTCCCTCTTCCTCCTA 0: 1
1: 1
2: 2
3: 51
4: 440
Right 1069764299 10:70841661-70841683 TTCAACATATGAATTTTTGGGGG 0: 28
1: 372
2: 1349
3: 2634
4: 3546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069764288 Original CRISPR TAGGAGGAAGAGGGAGCCTT TGG (reversed) Intronic
900083835 1:877280-877302 GAGGAGGAGGAGGGAGTCTCGGG + Intergenic
900650750 1:3729062-3729084 GGGGAGGAAGAGGGAGGCTTGGG + Intronic
900736903 1:4304886-4304908 CAGGAAGAAGAGGAAGCCGTGGG - Intergenic
900785847 1:4649995-4650017 GAGGAGCAAGAGGAAGACTTGGG - Intergenic
900898930 1:5503871-5503893 CAGGAGGCAGAGGGAGCCGGGGG - Intergenic
900997368 1:6129861-6129883 AGGCAGGAAGAGGGAGCCCTGGG - Intronic
901249881 1:7770116-7770138 TAGATGGAAGAGGGAGCACTAGG - Intergenic
901642334 1:10699029-10699051 TGGGAGCAAGATGGAGCCTGGGG + Intronic
901877798 1:12176848-12176870 AGGGAGGAGGAGGAAGCCTTTGG + Intronic
903354297 1:22736810-22736832 TAGGAGGATAATGGAGCTTTGGG + Intronic
903658249 1:24961848-24961870 TAGGAGGAAGAGGAGGCAGTGGG + Intronic
903908189 1:26701494-26701516 GAGGAGGAAGGAGGAGGCTTAGG + Intronic
904016618 1:27426337-27426359 AAGAAGGTAGAGGGAGGCTTGGG + Intronic
904060754 1:27708299-27708321 TAGGAAGATGAGGGAAACTTTGG + Intergenic
904420853 1:30390277-30390299 TGGCAGGGAGAGGGAGCATTGGG + Intergenic
905280386 1:36845504-36845526 GAGTTGGAAGAGGGAGTCTTGGG + Intronic
906775496 1:48525819-48525841 TTAGAGGAAGAGGAAGACTTTGG + Intergenic
907042019 1:51269860-51269882 TAGAAGGGAAAGGGAGCCCTGGG - Intronic
907393130 1:54171680-54171702 TAGTAGGAGAAGGGAGACTTAGG - Intronic
907964926 1:59319753-59319775 TGGCAGGCAGAGGGAGCCTGTGG + Intronic
908114765 1:60929860-60929882 TAGGAGGAAGAGGGAGAGAGGGG - Intronic
908345304 1:63226392-63226414 TATTAGGAAGTGGGGGCCTTTGG + Intergenic
908714987 1:67060307-67060329 TAGTAGAAAGAGGAAGCCTCTGG - Intergenic
908846386 1:68328780-68328802 TATTAGGAAGTGGGGGCCTTAGG + Intergenic
909491040 1:76226678-76226700 CAGGAGGAAGAGAGAGAGTTGGG + Intronic
910074108 1:83257131-83257153 TAGGAAGAAAAGTGAGTCTTGGG + Intergenic
910517554 1:88079243-88079265 CAGGAAGAGGAGGGGGCCTTTGG + Intergenic
911047513 1:93640493-93640515 TAGGAGGAAAGGGTACCCTTCGG + Intronic
912071018 1:105809810-105809832 TAGAAGCAAAAAGGAGCCTTGGG + Intergenic
913219279 1:116646322-116646344 TAGGAGGAAGATGGAGAATTGGG + Intronic
914726583 1:150332979-150333001 TGGGAGGAAGAAGGAGTCTTTGG - Exonic
915316986 1:155034279-155034301 GAGGAGGATGAGGGAGCCTGAGG - Intronic
915327203 1:155086585-155086607 TGGAAGGAGCAGGGAGCCTTTGG + Exonic
915349029 1:155213150-155213172 CTGGAGGAAGAGTCAGCCTTGGG - Intronic
915352216 1:155233777-155233799 CTGGAGGAAGAGTCAGCCTTGGG - Intergenic
915354417 1:155247643-155247665 TAGGAGGGAAAGGGACACTTTGG + Exonic
916006917 1:160670681-160670703 CAGTAGGAAGAGGCAGCCTGAGG + Intergenic
916336150 1:163673155-163673177 GAGGAGGAAAAGGGAGCCAAAGG - Intergenic
916459786 1:165011483-165011505 TAGGGAGAGGAGGGTGCCTTGGG + Intergenic
918490453 1:185075658-185075680 CAGGAGGAAGAGAGAGCAGTGGG + Intronic
919233483 1:194806796-194806818 TAGGAGGATGAGGGAATATTTGG + Intergenic
920068691 1:203287397-203287419 AGGGAGGAGGAGGGAGCCTGTGG + Intergenic
920960400 1:210658255-210658277 TGGGAGGAAAAGGGACACTTGGG - Intronic
921742050 1:218696428-218696450 TAGGAATAAGAGGCAGTCTTTGG + Intergenic
922685615 1:227636711-227636733 TTGGAGGAAGGAGTAGCCTTGGG + Intronic
922724983 1:227918449-227918471 GAGGAGGAAGGGGGAGGTTTTGG - Intergenic
922787039 1:228287992-228288014 TTGGAGGAAGAGGCATCTTTGGG - Intronic
923304225 1:232673466-232673488 GAGGAAGAAGATGGAGTCTTTGG + Intergenic
923482122 1:234395429-234395451 GAGGAGGAGGAGGCAGCTTTGGG + Intronic
924167805 1:241303294-241303316 AAGGAGGAAGAGAGAGCAGTGGG - Intronic
924541685 1:244986511-244986533 CAAGAGCAAGAGGGAGCCATTGG + Intronic
924623800 1:245684420-245684442 GTGGTGGATGAGGGAGCCTTTGG + Intronic
924722555 1:246637164-246637186 TTGGAGGAAGAAGTAGCCTTTGG + Intronic
1062763403 10:44658-44680 GAGGAGGAGGAGGGAGTCTCAGG - Intergenic
1063172571 10:3522672-3522694 TATGAGGAACAGGCAGCCATGGG - Intergenic
1063503081 10:6572125-6572147 TAGAAGGAAGAGGGAGCGATGGG - Intronic
1064322865 10:14321948-14321970 CAGGAGGAAGAGGGAGCAAAGGG - Intronic
1064565590 10:16635868-16635890 TAAGAGGGAGAGGTTGCCTTTGG - Intronic
1067344776 10:45429200-45429222 CAGGAGGAAGAGGGAGACCCTGG + Intronic
1067382498 10:45787754-45787776 GAGGAGGCAGCAGGAGCCTTGGG - Intronic
1067687244 10:48473746-48473768 GAGGAGGCAGAGTGAGGCTTTGG - Intronic
1067890196 10:50128302-50128324 GAGGAGGCAGCAGGAGCCTTGGG - Intronic
1069764288 10:70841617-70841639 TAGGAGGAAGAGGGAGCCTTTGG - Intronic
1072037997 10:91581946-91581968 TAGGAAAAGGAGGGAGCCTTGGG - Intergenic
1072891566 10:99329581-99329603 CAGGAGGAAGCTGGTGCCTTCGG - Exonic
1074881823 10:117665543-117665565 CAGGAAGGAGAGAGAGCCTTAGG + Intergenic
1075549145 10:123379371-123379393 CAGGAGGCACAGGGAGCCTTGGG - Intergenic
1075631051 10:124000884-124000906 GAGGAGGCAGAGAGAGCCCTGGG + Intergenic
1076502102 10:130945428-130945450 CAGGAAGAAGAAGGAGCCATAGG - Intergenic
1078043300 11:7889388-7889410 TAGGTGGCAGAGAGAGCCATGGG - Intergenic
1078183069 11:9028701-9028723 GAGGAGGAAGGGGGAGCCATGGG + Intronic
1078459516 11:11503198-11503220 TAGGAGGAACAGTGAGATTTTGG + Intronic
1078936713 11:15957665-15957687 GAGGAGGAAGAGAAAGCCTAAGG + Intergenic
1080457777 11:32431289-32431311 TGACCGGAAGAGGGAGCCTTTGG + Intronic
1082632319 11:55557196-55557218 TTGGAGGAAGGAGTAGCCTTGGG - Intergenic
1082635304 11:55586491-55586513 TTGGAGGAAGGAGTAGCCTTGGG - Intergenic
1083719640 11:64598021-64598043 CAGGAGGAAGATGCAGCCATGGG + Intronic
1083966550 11:66047197-66047219 CAGGAGGAAGTGAGAGCCCTTGG + Intronic
1083997467 11:66279305-66279327 GGGGAGGAGGAGGGAGCCTGGGG - Intronic
1084769248 11:71331965-71331987 TAGGAAGTAGGAGGAGCCTTTGG - Intergenic
1084943252 11:72625551-72625573 GAGGAGGAAAAGGCAGCCTGAGG + Intronic
1085030710 11:73269361-73269383 TAAGATGAGGAGGAAGCCTTAGG - Intronic
1086955767 11:92933386-92933408 TAGAAGGAGGATGTAGCCTTGGG + Intergenic
1087048462 11:93864095-93864117 TCAGAGGAAGAAGTAGCCTTGGG + Intergenic
1088392142 11:109326326-109326348 AAGGAGGCAGAGGGATCCTCAGG - Intergenic
1088541952 11:110921917-110921939 TAGGAGGAAGGAGGGGCCTTAGG - Intergenic
1089446132 11:118553830-118553852 TAGGAGGAAGTGGGAGAATGAGG + Intronic
1089604906 11:119636124-119636146 GAGGAGAAAGAGGGAGCGATGGG - Intronic
1089780414 11:120869736-120869758 CTGGAGGAAGAGGGGGCCTGGGG + Intronic
1089891049 11:121881192-121881214 GAGGAGGAAGAGGAAGAGTTGGG - Intergenic
1090110724 11:123905618-123905640 CTGGAGGAAGAGTCAGCCTTTGG + Intergenic
1090669155 11:128934057-128934079 AAGTAGGCAGAGGGAGCCTCAGG - Intergenic
1091232448 11:133997555-133997577 GAGGAAGAAGAGGGAGACGTCGG - Intergenic
1091317471 11:134624627-134624649 AAGGAGCAAGAGGGTGACTTTGG + Intergenic
1091361340 11:134980862-134980884 TAGGAGGATGAGGAAGTCCTGGG - Intergenic
1091599464 12:1909066-1909088 GAGGAGGTGGGGGGAGCCTTGGG - Intronic
1091660733 12:2381330-2381352 GAAGAGGAAGATGGATCCTTGGG - Intronic
1092145194 12:6210022-6210044 TAGGATGAGGAGGGACACTTTGG + Intronic
1093704761 12:22262362-22262384 GAGGAGGAAGAGGTGGGCTTCGG - Intronic
1094217218 12:27955969-27955991 AAGGAGGAAGAGGGAACTTGGGG - Intergenic
1094316966 12:29145749-29145771 TACTAGGTAGAGTGAGCCTTTGG - Intergenic
1095635802 12:44431923-44431945 TAGGAGGAAGTGAGAGACATTGG - Intergenic
1096103217 12:48981771-48981793 TAGGAGGAAGTGGGAGAGATGGG - Intergenic
1096974212 12:55689465-55689487 AAGGAGGAGGAGGTAGCCTCAGG + Intronic
1096979755 12:55721624-55721646 CAGGAAGAAGAGGGAGCTGTGGG + Intronic
1097548881 12:61041458-61041480 CAGGAGGAAGAGAGAGAGTTGGG + Intergenic
1097952911 12:65452658-65452680 GTGGAGGATGAGGGAGCTTTGGG + Intronic
1097984834 12:65772030-65772052 TAGGAGGAAGAAGCAGGGTTTGG - Intergenic
1098328544 12:69328045-69328067 AAGGAGGCATAGGGAGACTTTGG + Intergenic
1098952033 12:76649332-76649354 AAGGAGGAAGGGGTGGCCTTTGG - Intergenic
1099284350 12:80697631-80697653 AAGGAGGAAGAGGGAGAGTGTGG - Intergenic
1099862015 12:88233154-88233176 TTGGAGGAAGAAGTAGCCTTGGG - Intergenic
1099868986 12:88322342-88322364 CAGGAGGAAGAGAGAGCATGGGG + Intergenic
1102187767 12:110963183-110963205 CAGGAGGAAGAGGGAGCCCAGGG - Intergenic
1104324895 12:127786483-127786505 TGGGAGGAAGAGTCAGACTTGGG - Intergenic
1104899815 12:132182759-132182781 TTGGAGGAAGAGCGAGGCCTGGG - Intergenic
1106457989 13:29944299-29944321 AAGGAGGGAGAGGGTGCCCTTGG + Intergenic
1106538380 13:30668147-30668169 TTGGAGGAAGAGGATGCTTTGGG + Intergenic
1106665573 13:31847148-31847170 CAGGAGGAGGACGGAGCCCTGGG - Intergenic
1107464674 13:40638683-40638705 GAGGAGGAGGAGGGGGCCTAAGG + Intronic
1108728526 13:53207553-53207575 GAGGAGGAAGAGGAAGCTGTGGG + Intergenic
1109276977 13:60314189-60314211 GAGGAGGAGGAGGTTGCCTTCGG + Intergenic
1109859139 13:68174042-68174064 TATTAGGAAGTGGGGGCCTTGGG - Intergenic
1110195662 13:72785110-72785132 TAGCAGGAAGTTGGGGCCTTTGG - Intronic
1113973756 13:114211212-114211234 TTGGATGGAGAGGGAGCCATGGG - Intergenic
1114197724 14:20493797-20493819 TTTGAGGAAGAGTGAGCCCTAGG - Intergenic
1114781412 14:25542306-25542328 GAGGAGGAAGTGGGAACATTTGG - Intergenic
1115140893 14:30169696-30169718 AAGGAGGAAGAGGGAAAGTTTGG - Intronic
1115862996 14:37710727-37710749 TAGTGGAAAGAGTGAGCCTTTGG - Intronic
1116662693 14:47731811-47731833 CAGGATGAAGAAGGAGCCTAGGG + Intergenic
1117168924 14:53069955-53069977 TAGTAGGAAGAGGGAACCAATGG - Intronic
1117894772 14:60472531-60472553 TAGGAGGGAGAGATAGCATTAGG - Intronic
1118309439 14:64681851-64681873 CAAGAGGAAGAGGGAGGCTGGGG + Intergenic
1118833044 14:69452907-69452929 TAGGAGGAAGTTGGGGCCATTGG + Intronic
1118951789 14:70441952-70441974 TAGGAGGTAGAGGAAGTCTTGGG + Intergenic
1119219997 14:72898844-72898866 GAAGAGGAAGAGGAATCCTTTGG + Intergenic
1119675020 14:76547112-76547134 TAAGGGAAAGAGGCAGCCTTTGG - Intergenic
1119729124 14:76940024-76940046 AAGGAGGAAAAGGCAGCCTCTGG + Intergenic
1119988477 14:79167800-79167822 TAGGGGCAAGAGGGAGCTTTTGG - Intronic
1120901908 14:89582738-89582760 AAGGAGCAAGAGGGAACTTTTGG - Intronic
1121006422 14:90493441-90493463 TATTAGGAGGTGGGAGCCTTGGG + Intergenic
1121085109 14:91139911-91139933 GAGGGGGAAGAGGGAGGCTGTGG + Intronic
1121615185 14:95309056-95309078 AAGGAGGGAGAGGGAGGCTAGGG + Intronic
1122027506 14:98888375-98888397 GAGGAGGAGGAGGGAGCCAGGGG - Intergenic
1122499599 14:102187880-102187902 TAGGAGGTAGAGAGTGCTTTGGG + Intronic
1124073918 15:26423683-26423705 TAGGAGGAATAGGGAGATATTGG - Intergenic
1125522312 15:40355017-40355039 TAGGAGGCAGAAGGAGACTGGGG + Intronic
1125574352 15:40745119-40745141 TTGGAGGAAGAGGCAGCTTCAGG - Exonic
1128727991 15:70001852-70001874 TTGGGGGAAGAGGGAGGTTTAGG + Intergenic
1128792364 15:70442586-70442608 GATGAGGAAGAGGGAGACTAAGG + Intergenic
1130349487 15:83078665-83078687 TTGGAGAAAGAGGGAGTGTTGGG - Intergenic
1130765964 15:86871530-86871552 TAGAAGGAGGAGAGAGCCTGAGG - Intronic
1131491464 15:92866894-92866916 CAGGAAGAAGAGGGAGAGTTGGG + Intergenic
1131930799 15:97438703-97438725 TAGGGGGAAGAGATAGCATTAGG + Intergenic
1132413947 15:101606988-101607010 AGGGAGGTAGAGGGAGCCTAAGG - Intergenic
1132507108 16:316496-316518 TAGAAGGAAGGGGCAGCCTCAGG - Intronic
1132515120 16:362659-362681 AAGGAGCAAGCGAGAGCCTTGGG + Intergenic
1132717555 16:1299497-1299519 GGGGAGGAGGAGGGAGCCCTGGG - Intergenic
1133768598 16:8854793-8854815 CAGGAGGAAGAGGGATTCTGTGG + Exonic
1134293932 16:12927856-12927878 TTGGAGGTGGAGGGAGCTTTAGG + Intronic
1134509296 16:14833767-14833789 TAGGAGGAGGAAGGAGCCTGCGG + Exonic
1134697001 16:16232582-16232604 TAGGAGGAGGAAGGAGCCTGCGG + Exonic
1134974841 16:18562103-18562125 TAGGAGGAGGAAGGAGCCTGCGG - Exonic
1135075096 16:19386418-19386440 AAGGAGGAGGAGAGAGGCTTAGG - Intergenic
1135114642 16:19714446-19714468 GATGAGGAACAGGCAGCCTTGGG - Exonic
1136459385 16:30400276-30400298 GAGGAGGAAGAGGGGGCGTGTGG + Intergenic
1136477716 16:30524054-30524076 GAGGAAGAAGAGGGAGGCTGGGG + Exonic
1136580816 16:31149835-31149857 GAGGAGGGAGAGGGAGGCCTGGG - Intronic
1136674998 16:31895030-31895052 TGGGAGGAAGTGGGAGCCATGGG - Intronic
1137070986 16:35904682-35904704 TTGGAGGAAGAAGTAGCCTTGGG + Intergenic
1137573666 16:49583916-49583938 CAGGAGGAAGTTGGAGCCTGGGG + Intronic
1139428641 16:66899344-66899366 TAGGAGGGAGAGTGAGCTGTTGG + Intergenic
1139437181 16:66943068-66943090 TAGAAGGAAGAAGGGGCCTTTGG + Intronic
1139850773 16:69950711-69950733 CACGAGGAAAAGGGTGCCTTAGG - Exonic
1139879757 16:70173623-70173645 CACGAGGAAAAGGGTGCCTTAGG - Exonic
1140106431 16:71964693-71964715 AAGGAGGGATAGGGAGCTTTTGG - Intronic
1140372767 16:74421925-74421947 CACGAGGAAAAGGGTGCCTTAGG + Intronic
1142091437 16:88213635-88213657 GAGGAGGAGGAGGCACCCTTTGG - Intergenic
1142292317 16:89198818-89198840 GAGGAGGTGGAGGGAGCCGTGGG - Intronic
1142747501 17:1967153-1967175 CAGAAGGAAGAGGGGGCCCTGGG + Intronic
1142878862 17:2869115-2869137 TATGAGGAAGAGGGGCCTTTGGG - Intronic
1143420702 17:6789504-6789526 TGGGAGGAAGAAAGAGTCTTGGG - Intronic
1144368953 17:14571643-14571665 TAGGAAGATGAGGGAAACTTTGG - Intergenic
1144750437 17:17644622-17644644 AGGGAGGAAGTGGGGGCCTTTGG + Intergenic
1145985998 17:29046685-29046707 AAAGAGGGAGAGGGATCCTTGGG + Intronic
1146110476 17:30084661-30084683 GAAGGGGAAGAGGGAGGCTTAGG - Intronic
1146759107 17:35460639-35460661 GCGGAGGAAGAGGGAGCCAGAGG + Intergenic
1147657579 17:42099283-42099305 GAGGAGGAAGAGGGGGGCCTTGG + Intergenic
1148192968 17:45692696-45692718 CAGGAGGAAGATGGACCCTGAGG + Intergenic
1149370734 17:55991482-55991504 GAGGAGGAAGATGAAGCCATAGG - Intergenic
1152956312 18:44989-45011 GAGGAGGAGGAGGGAGTCTCAGG - Intergenic
1153997334 18:10454249-10454271 TTGGAGGGGGTGGGAGCCTTTGG - Intergenic
1154493958 18:14942062-14942084 TAGGAGGATGAGGAAGTCCTAGG + Intergenic
1154508238 18:15064043-15064065 TAGGAGAAAGGGGGAGTGTTAGG + Intergenic
1155657610 18:28210046-28210068 TTGGAGGAAGGAGTAGCCTTGGG + Intergenic
1158179961 18:54703285-54703307 TGGGTGGAAGAAGCAGCCTTGGG - Intergenic
1158610126 18:58932169-58932191 AAGGAGAAAGAGGGAGGCATAGG - Intronic
1159677487 18:71303968-71303990 CAGGAGGAAGAGGGAGCAGGGGG - Intergenic
1160011491 18:75109965-75109987 CAGGAGGAAGATGCCGCCTTAGG - Intergenic
1160011521 18:75110063-75110085 GAGGAGGGAGAGGGAGGCTGGGG + Intergenic
1160535623 18:79589929-79589951 TGGGAGGAAGAGGGAACCTACGG - Intergenic
1161882692 19:6967842-6967864 GAAGAGGAAGAGGGGGCGTTGGG - Intergenic
1162044693 19:7990810-7990832 GAGGAGGAAGAGGGGCCATTGGG + Intronic
1162346200 19:10119470-10119492 TGGGAGGAAGAGGGACCCGCCGG + Intronic
1163511978 19:17740961-17740983 CAGGAAGAGCAGGGAGCCTTGGG + Intergenic
1163899676 19:20090426-20090448 TAGGAGGAAGAGGAGGGATTAGG + Intronic
1164147902 19:22523713-22523735 GAGGAGGAAGAGGTAGCTTTAGG + Intronic
1164237480 19:23349757-23349779 TTGGAGGAAGGAGTAGCCTTGGG - Intronic
1164635201 19:29786484-29786506 CAGGAGGAAGAAGGAGCAGTGGG + Intergenic
1165386053 19:35511259-35511281 CAGGAGGCTGAGGGAGCCTCAGG + Intronic
1165958910 19:39518649-39518671 TTGGAGGTAGGGGGAGCCTGAGG + Intronic
1166614941 19:44235216-44235238 TCGGATGAAGGGGAAGCCTTGGG - Exonic
1166761677 19:45228141-45228163 TAGGAGGTGGAGGGAGGCTGGGG - Intronic
1167146088 19:47681322-47681344 TGGGAGGAAGAGGGGTCCTGGGG + Intronic
1167710432 19:51107190-51107212 CAGGAGGAGATGGGAGCCTTGGG + Intronic
1168344213 19:55642578-55642600 TTGGGGAAAGGGGGAGCCTTGGG - Exonic
1168547149 19:57262761-57262783 TTGGAGGAAGTGGGAGCAGTTGG + Intergenic
925062426 2:903566-903588 CAGAAGGAAGAAGGACCCTTAGG - Intergenic
925831049 2:7895870-7895892 TGGCAGGAAGAGTGGGCCTTGGG - Intergenic
926581016 2:14633009-14633031 TAGGAGGGAGAGGGGTCTTTGGG + Intronic
926627688 2:15106765-15106787 TGGCAGGTAGAGGGAGCATTAGG + Intergenic
926921993 2:17948116-17948138 TGGGAGGAAGAGGGTGCCACTGG - Intronic
927148626 2:20183171-20183193 CAGGAGGGTGAGGGAGCCTGTGG - Intergenic
929512567 2:42576340-42576362 GATGAGGAAGAGGGAACCATGGG + Intronic
929629756 2:43447364-43447386 AAGGAGGCAGAGGGAGATTTGGG - Intronic
930897466 2:56462737-56462759 TATTAGGAGGAGGGGGCCTTTGG - Intergenic
931006830 2:57859262-57859284 TTGGAGGAATAGAGAGCATTAGG + Intergenic
932651302 2:73560862-73560884 TAGGAGGATGAGAGAGACCTTGG + Intronic
933184580 2:79264689-79264711 TATGAGGACGAGGGTACCTTTGG - Intronic
933769095 2:85731932-85731954 AATGAGGAAGAGGGAGGCCTGGG - Intergenic
934935299 2:98460905-98460927 CATGAGGAAGAGGAAGCATTGGG + Intronic
936069548 2:109356545-109356567 AAGGAGGAGGAGGGGGCCTGTGG - Intronic
936919681 2:117674967-117674989 GAGAAGGAAGAGGTAGCCTAGGG + Intergenic
937460806 2:122084033-122084055 TAGAAGGAGGGGGGGGCCTTGGG + Intergenic
938207755 2:129438535-129438557 GGGGAGGGAGAGGGAGCCTGGGG - Intergenic
939119322 2:138097982-138098004 TGAGAGGAAGAGGGTGACTTAGG - Intergenic
939496330 2:142932081-142932103 TAGCGGCCAGAGGGAGCCTTGGG + Intronic
939564833 2:143774748-143774770 TGGGAGGAGGAGGGGGTCTTAGG + Intergenic
941020020 2:160397910-160397932 CAGGAGTAGGGGGGAGCCTTAGG - Intronic
941318543 2:164025788-164025810 TAGGAAGAAGAGGTAGATTTAGG + Intergenic
942043737 2:172087240-172087262 GAGGAGGAGGAGGGAGGCTGAGG - Intronic
942486673 2:176446966-176446988 AAGGAGGAAGAGGGATGTTTAGG - Intergenic
943211033 2:184966413-184966435 GAGGGGGAAGAGGGAGACGTTGG - Intergenic
943530856 2:189078531-189078553 CAGGAGAGAGAGGGAGACTTGGG - Exonic
945055968 2:205869269-205869291 TAGCAGGCAATGGGAGCCTTTGG - Intergenic
945422276 2:209653324-209653346 GAGGATGAAGAGGGTGCCTTTGG + Exonic
946291485 2:218748808-218748830 GAGGAGGAAGAGGAAGTATTAGG - Intronic
946301509 2:218827207-218827229 TGGGAGGAAGGGGGAGACCTGGG - Intronic
946446675 2:219746031-219746053 TAGGATGAACACGGAGCATTAGG + Intergenic
946960191 2:224976816-224976838 AAGGAGGAAGAGGGTGGCATAGG - Intronic
948132506 2:235610982-235611004 AATGAGGAAGACGGTGCCTTAGG - Intronic
948200053 2:236123145-236123167 TAGGAGGCAGAGGCTGCCGTGGG - Intronic
948248429 2:236505797-236505819 TAGGAGGAGGAGGGAGAAGTGGG - Intronic
948293939 2:236847259-236847281 CAGGAGGCAGAGGGAGCCAGAGG + Intergenic
948858819 2:240743128-240743150 GAGGAAGAGGAGGGACCCTTGGG + Intronic
949034187 2:241809035-241809057 TGGGAGGAGGAGCGAGCGTTGGG + Intronic
1168954421 20:1824860-1824882 TAGAAGGAAGAAGGAGACTCTGG + Intergenic
1169341953 20:4803225-4803247 TAAGTGGAAGAGGGAGGCATAGG + Intronic
1169762148 20:9107707-9107729 TAAATGGAATAGGGAGCCTTTGG + Intronic
1170109843 20:12793215-12793237 CAGGAGGAAGAGGGAGATTGAGG + Intergenic
1170542960 20:17407267-17407289 CAGAAGGAAGAGGCAGCCTCAGG + Intronic
1170692185 20:18625779-18625801 TAGAATGAAGAGGAAGCCTGTGG + Intronic
1171533295 20:25866070-25866092 TGGGAGGAAGGGGGAGCTTCAGG + Intronic
1171993388 20:31713863-31713885 CAGGAGGAAGAGGCAGTTTTTGG - Intronic
1172029179 20:31969319-31969341 TAGGAAGTAGAAGGAGCCTGAGG - Intronic
1172845985 20:37930331-37930353 AAGGAGGAAGAGGGAGTCCTGGG - Intronic
1173302748 20:41818287-41818309 AAGGTGGAAGAGGAAGCCATGGG - Intergenic
1173460927 20:43242985-43243007 TAGGAAGAGGAGGAAGCCTTGGG - Intergenic
1173644620 20:44625758-44625780 GAGGAGGAAGAGGAGGCTTTGGG + Intronic
1173873897 20:46357825-46357847 GAAGAGGAAGAGGGAGCCGGTGG - Intronic
1174203906 20:48826128-48826150 TGGGAGAAAGAGGGAGACTCTGG - Intronic
1176169496 20:63690565-63690587 TAGGAGGGAGAGGCAGCCTTTGG - Intronic
1178111510 21:29374415-29374437 TAAGAGGAAGGGGAAACCTTGGG - Intronic
1178295289 21:31404895-31404917 TAGGAGGAACAGGGAGCTGTTGG - Intronic
1178444236 21:32623982-32624004 TAGAAGGGGGATGGAGCCTTAGG + Intergenic
1179051486 21:37892265-37892287 TAAGAGTGAGAGGGAGCCCTGGG + Intronic
1179055077 21:37923989-37924011 TAGGAGGTAAAGGATGCCTTGGG - Intergenic
1179583249 21:42358362-42358384 CAGGAGGTGGAGGGAGCCTGGGG + Intergenic
1179586072 21:42375098-42375120 GAGGAGGAAGAAGGAGGCTTAGG - Intronic
1179666896 21:42919120-42919142 TTGGAGGAAGAAGCTGCCTTGGG + Intergenic
1180058276 21:45370947-45370969 CAGGAGGGAGAGGGGGCCCTGGG + Intergenic
1180180522 21:46116809-46116831 CAGAAGGTAGAGGGAGCCTCGGG + Exonic
1180820569 22:18824378-18824400 TAGGAGGAAGATGGAGAATTGGG + Intergenic
1181206793 22:21258850-21258872 TAGGAGGAAGATGGAGAATTGGG + Intergenic
1181462630 22:23094567-23094589 AAGGAGGTAGAGGGGGGCTTGGG - Intronic
1181670861 22:24424899-24424921 TGGGAGGAAGAGGGAGACCCAGG + Intronic
1182278338 22:29204393-29204415 CTGGAGGGAGAGGGAGCCCTTGG + Intergenic
1182663683 22:31942862-31942884 TAGCAGGAAGAGGAAGGCCTGGG + Intronic
1182709251 22:32310406-32310428 TGGAAGGCAGAGGAAGCCTTGGG - Intergenic
1182759018 22:32706954-32706976 TAGGAGGAAGATGGTCTCTTGGG - Intronic
1182907328 22:33949466-33949488 TGGGAGGAGGAGGAAGCATTGGG + Intergenic
1183066919 22:35369661-35369683 AAGGATGAAGAGGGAGCCCCCGG + Intergenic
1183597601 22:38822037-38822059 GAGGAGGAAGAGGGAGGCATGGG + Exonic
1183706879 22:39479598-39479620 GAAGAGAAAGAGTGAGCCTTTGG - Intronic
1184047214 22:41978919-41978941 GAGGAGGAGGAGGGAGCCAGGGG + Intronic
1184782768 22:46657380-46657402 TAGGAGGAAGAGGCAGGGATGGG + Intronic
1185210068 22:49565701-49565723 GAGGAGGAAGGGAGGGCCTTGGG - Intronic
1203220131 22_KI270731v1_random:36573-36595 TAGGAGGAAGATGGAGAATTGGG - Intergenic
1203270695 22_KI270734v1_random:50253-50275 TAGGAGGAAGATGGAGAATTGGG + Intergenic
949404903 3:3703818-3703840 CAGGAGGAAGAGAGAGAGTTGGG + Intronic
950108657 3:10404497-10404519 GAGGATTAAGAGAGAGCCTTCGG + Intronic
950281723 3:11713768-11713790 TAGCAGGAACAGGTAACCTTAGG + Intronic
951657618 3:25027290-25027312 TAGTAGGAAGAGTGAGTCCTGGG + Intergenic
951720791 3:25695658-25695680 TTGGGGGAAGAGGGAACCTGTGG + Intergenic
952386382 3:32844301-32844323 TAGGAGGAAGAGGGGATTTTAGG + Intronic
952697115 3:36278991-36279013 CAGGAGGAAGAGAGAGAGTTAGG + Intergenic
953496436 3:43391487-43391509 CAGGAGGCACAGGGATCCTTGGG - Intronic
953535403 3:43773469-43773491 TGTGAGGAGGAGGGAGCCTCTGG + Intergenic
954082475 3:48220729-48220751 TAGGAGGAAGGGGCAGCCATGGG + Intergenic
954557775 3:51531841-51531863 TTGGAGGAAGACGTAGCCTTGGG + Intergenic
954709546 3:52498558-52498580 CAGAAGGAAGCGGGAGCTTTGGG - Intronic
955374401 3:58382522-58382544 TGGGAGGAAGAGGTAGACTTAGG - Exonic
955885718 3:63596314-63596336 GAGGGGGAAGGGGGAGCATTGGG - Intronic
956575522 3:70748540-70748562 CAAGAGGAAGAGGGAGACATTGG - Intergenic
957868234 3:86051733-86051755 CAGGAGGAAGAGAGAGCCGAGGG + Intronic
958809096 3:98839039-98839061 GGAGAGGGAGAGGGAGCCTTGGG + Intronic
960445178 3:117739561-117739583 AAGGAGGATGAGGGAGCCGCTGG - Intergenic
960973345 3:123154643-123154665 TTGGGGGCAGAGGGAGCTTTGGG - Intronic
962867791 3:139461926-139461948 TAGTAGGAAGAGGCAGGCCTAGG - Intronic
963320277 3:143803196-143803218 CAGGAGGAAGAGGGGGGATTAGG - Intronic
963861322 3:150313452-150313474 CAAGAGGCTGAGGGAGCCTTGGG - Intergenic
964922302 3:161912016-161912038 TATGAGGAAGAGGGAGAGATGGG + Intergenic
965376173 3:167926990-167927012 TAGGAGGAAGAGGGTGCCGGGGG - Intergenic
965872777 3:173280676-173280698 TTGGAGGAAGTAGTAGCCTTGGG - Intergenic
966118619 3:176496355-176496377 TAGGAGGAAGAGGTAGGAGTAGG - Intergenic
968611538 4:1559349-1559371 GAGGAGGACGAGGGAACCCTGGG + Intergenic
969719757 4:8887006-8887028 TAGGAGCCAGAAGGAGACTTGGG - Intergenic
970682204 4:18523000-18523022 TCAGAGGCAGAGAGAGCCTTGGG + Intergenic
970794335 4:19893140-19893162 TTGGAGGAAGGAGTAGCCTTAGG - Intergenic
970951691 4:21764421-21764443 GTGGAAGAAGAGTGAGCCTTGGG + Intronic
971199614 4:24500101-24500123 TAGGAGGTAGGTGGGGCCTTTGG + Intergenic
971352060 4:25863301-25863323 GAGAAGGAAGAGGGAGCCGGAGG - Intronic
971944620 4:33257302-33257324 TTGGAGGAGGAGGAAGCATTGGG - Intergenic
972242726 4:37210794-37210816 TAGGAGCAAGAGGGAGACAGAGG + Intergenic
972644584 4:40955207-40955229 TAGGAGAAGGAGCCAGCCTTGGG + Intronic
972911680 4:43824183-43824205 CAGGAGCAAGAGGGAGCATGTGG + Intergenic
973015053 4:45127675-45127697 CAGGAGGAAGAGAGAGCATGGGG - Intergenic
973052588 4:45612876-45612898 TTGGAGGAAGGGGTAGCCTTGGG - Intergenic
974013507 4:56628245-56628267 CAGAAGGAAGAGCGAACCTTCGG - Intergenic
975279557 4:72545266-72545288 TAGGATGAAGAGGGAAGATTTGG - Intronic
975680818 4:76874182-76874204 TATAGGGAAGGGGGAGCCTTTGG + Intergenic
975747133 4:77485751-77485773 AAGGAGGAAGAAGGAGGATTGGG + Intergenic
975758004 4:77590272-77590294 TAGGAGGAAAAAGCAGCCTAAGG + Intronic
976403703 4:84637442-84637464 CAGGAGGAAGAGGGAGAGTGAGG + Intronic
976683012 4:87778256-87778278 TAGGAAGAAGAGGGAACAGTTGG - Intergenic
977738617 4:100448676-100448698 GAGGAGCAATAGGGAGCCATTGG - Intronic
978667563 4:111203750-111203772 TAGGATCAAGAGGGATTCTTGGG + Intergenic
978757076 4:112314197-112314219 TAGAAGGGAGTGGGAGCCTGTGG + Intronic
980174413 4:129327157-129327179 CAGGAGAAAGAGGGATCGTTTGG - Intergenic
981535090 4:145791354-145791376 TATGTAGAAGATGGAGCCTTTGG - Intronic
982061666 4:151610546-151610568 AAGGAGGTAGAAGGAGCTTTGGG - Intronic
982929528 4:161385828-161385850 TAGGATGAAGAGAGAGTCCTTGG + Exonic
984714855 4:182916731-182916753 TAGGAGGGAGGGGGAGCCATGGG + Intronic
984756841 4:183332542-183332564 GAGGAGGAAGAGCGATCCATGGG - Intergenic
985440432 4:189979834-189979856 GAGGAGGAGGAGGGAGTCTCAGG - Intergenic
985649457 5:1100584-1100606 GAGGAGGAAGACGGCGCCCTCGG + Intronic
986095496 5:4549882-4549904 TAGGAGTAAAAGGGAGCCATCGG + Intergenic
986271274 5:6233013-6233035 TAGCTGGAGGAGGGAGCCCTGGG + Intergenic
987028202 5:13949653-13949675 TTGGAGGAAGAGAGCGGCTTGGG + Intergenic
987085532 5:14464083-14464105 GAGAAGGAACAGGGAGCCTGAGG + Intronic
987400456 5:17470235-17470257 TAGGTGGAGGAGTGAGCATTAGG - Intergenic
988982492 5:36585221-36585243 TGGGAGGAGGTGGGAGCCTTCGG - Intergenic
989703428 5:44298221-44298243 TAAGAGGTGGAGGGGGCCTTCGG + Intergenic
989783119 5:45294003-45294025 CAGGAAGAAGAGGCAGCCGTAGG - Intronic
989981706 5:50653751-50653773 CAGGAGGAAGAGGGAGATTCTGG - Intergenic
990916859 5:60915917-60915939 TAGGAGGTAGATGGAGCCTGTGG - Intronic
990953509 5:61321294-61321316 TAGGAGGAAAAGGGACGCTGGGG - Intergenic
991120167 5:63004043-63004065 TAGGGGGGAGAGGTAGCATTAGG - Intergenic
991354579 5:65754663-65754685 TGGGAGGAAGAGGGATGCATGGG - Intronic
991931059 5:71752677-71752699 TGGGAGGAAGTTGAAGCCTTTGG - Intergenic
991950224 5:71939858-71939880 TAGAAGGCAGAGACAGCCTTTGG + Intergenic
991959004 5:72022870-72022892 TTGGAGGAAGAGGGAGCCTTTGG - Intergenic
993350867 5:86848501-86848523 GAGGAGGAAGAGATAGCATTAGG + Intergenic
993368255 5:87059143-87059165 GAGGAGGAAGAGATAGCATTAGG + Intergenic
994089859 5:95800452-95800474 AAGGAGAAAGAAGGAGCCTGGGG - Intronic
994388271 5:99158938-99158960 TTGGTGGAAGTGGGAGCCTATGG + Intergenic
995511778 5:112917849-112917871 TAGGAGGAATAGGGAGTGATTGG + Intronic
996005598 5:118417680-118417702 TAGAAGAAACAGGGATCCTTTGG - Intergenic
996163631 5:120197617-120197639 TATGAGAAAGAGCCAGCCTTTGG + Intergenic
996695109 5:126385775-126385797 TAGAAGGCAGAGGGAGCAATGGG + Intronic
998367908 5:141642973-141642995 TGGAAGGAACTGGGAGCCTTGGG - Intronic
998390863 5:141786263-141786285 TAGGCACAAGACGGAGCCTTGGG - Intergenic
998396598 5:141822524-141822546 CAGGAGAAAGATGGAGCCATAGG - Intergenic
998549503 5:143063736-143063758 TAGAAGAATGAGGTAGCCTTTGG - Intronic
999381559 5:151124740-151124762 TAAGAGGCAGAGGGGGCCTCGGG - Intronic
1001547989 5:172582375-172582397 TAGGTGGGAGAGGGAGCCTGGGG + Intergenic
1001548647 5:172586569-172586591 TATGAGGAAGAGCGAGGCTGGGG + Intergenic
1003067720 6:2917938-2917960 TAGCAGGAAGAGCCAGCTTTGGG + Intergenic
1003474698 6:6470644-6470666 AATGAGGAAGAAGAAGCCTTAGG - Intergenic
1005253875 6:23978953-23978975 TGGGAGGAAGATGGACACTTAGG - Intergenic
1005280695 6:24270676-24270698 GAGGAGGAAGATGTAGCCATAGG - Intronic
1005824195 6:29622737-29622759 GAGGGGGAAGAGGGAGATTTGGG - Intronic
1005824529 6:29624816-29624838 GGGGAGGAAGAGCCAGCCTTGGG + Intronic
1005960664 6:30690790-30690812 GAGGAGGAAGGTGGAGCCGTAGG - Intronic
1006186338 6:32183649-32183671 CGGAAGGAAGAGGGAGCCGTTGG + Exonic
1006300437 6:33191129-33191151 TAGGGGGAAGAGGGATCCTCTGG - Intronic
1006921630 6:37631443-37631465 TGGTAGGGAGAGGGAGCCCTTGG + Exonic
1006923035 6:37638651-37638673 CAGGAGGTTGAGGGAGCCTGCGG + Exonic
1007692101 6:43709111-43709133 GAGGGGGAGGAGGGAGACTTGGG - Intergenic
1007700481 6:43763360-43763382 TGGGAGGTAGGGGGCGCCTTGGG + Intergenic
1007813703 6:44505048-44505070 TAGGAAGAAGAGGTGGCCTTGGG - Intergenic
1008562269 6:52734840-52734862 TAGGAGCAAGAGGCAGAGTTTGG + Intergenic
1012398918 6:98828594-98828616 AGGCAGGAAGAGGAAGCCTTAGG - Intergenic
1013154330 6:107478588-107478610 TAGGAGGCTGAGGGAGGCTTGGG - Intergenic
1013378350 6:109541026-109541048 AAGAAGGAAGAGGGAGCCAGGGG - Intronic
1014194721 6:118541181-118541203 TAGGATCAAGAGGATGCCTTTGG - Intronic
1014827552 6:126063897-126063919 TAGGAGCAAGAGTGAGGCATGGG + Intergenic
1016292767 6:142541993-142542015 TTGGAGGAAGGAGTAGCCTTGGG - Intergenic
1016439808 6:144071282-144071304 TATTAGGAAGTGGGGGCCTTTGG + Intergenic
1016752949 6:147651262-147651284 TTGTAGGAACAGGAAGCCTTTGG + Intronic
1017015983 6:150099837-150099859 TTGGAGGAAGGAGTAGCCTTGGG - Intergenic
1017694716 6:157003135-157003157 TAAGAGCAAGAGGAAGCCATTGG + Intronic
1017954699 6:159168782-159168804 AAGGAGGAATAGGGAGACCTGGG + Intergenic
1018425237 6:163673948-163673970 CAGGAGGAAGAGCGAGGGTTGGG + Intergenic
1018446334 6:163862261-163862283 GAGGAAGCAGAGGGAGCCTTCGG + Intergenic
1021600334 7:22357355-22357377 CGGGAGGAAGAGGGCACCTTGGG + Intergenic
1022531623 7:31070351-31070373 GAGGAGGAAGAGGAGGCCTGTGG + Intronic
1025048133 7:55710087-55710109 CAGGAGGAGAAGGGAGCCTGAGG - Intergenic
1026018187 7:66687634-66687656 TAGGTGGATGACAGAGCCTTGGG + Intronic
1026727680 7:72882304-72882326 CAGAAGGAAGAGGGAACATTGGG + Intronic
1026910646 7:74089881-74089903 GAGGGGGGAGATGGAGCCTTGGG + Intronic
1026916348 7:74122155-74122177 GAGGAGGGGCAGGGAGCCTTGGG - Exonic
1027116159 7:75483423-75483445 CAGGAGGAAGAGGGAACATTGGG - Intronic
1027275668 7:76552275-76552297 CAGGAGGAAGAGGGAACACTGGG + Intergenic
1027291808 7:76721994-76722016 TAGGAAGAAAAGTGAGTCTTGGG + Intergenic
1027543759 7:79500622-79500644 AAGGAGGCAGAGGGAGTCTATGG - Intergenic
1029721375 7:102366829-102366851 CAGGAGGAAGAGGGAACATTGGG + Intronic
1030611800 7:111697902-111697924 TATGAGGAAGAGAGAGACTGTGG + Intergenic
1032240932 7:130158276-130158298 TGGAAGGAAGAGGGGGCCTCAGG - Intergenic
1032781384 7:135167616-135167638 GAGGAAGAAGAGGTAGCCTACGG + Intronic
1032811372 7:135421637-135421659 TTGGAGGAAGAGGGAGAATTTGG - Intronic
1034197478 7:149259489-149259511 TTGGAGGATGAGGGAGCCACAGG + Intergenic
1034244437 7:149633953-149633975 TAGGAGGAAGAGGGGACTCTGGG + Intergenic
1034333472 7:150304592-150304614 GAGGAGGAAGAAGGAGAGTTTGG - Intronic
1034664571 7:152805298-152805320 GAGGAGGAAGAAGGAGAGTTTGG + Intronic
1034995818 7:155576744-155576766 TATCAGGAAGAGGGAGCGTCCGG - Intergenic
1035120936 7:156566258-156566280 TAGGAAGAAGAGGCTGCCTTTGG - Intergenic
1035544341 8:468203-468225 TTGGAGCAAGCAGGAGCCTTGGG + Intronic
1036036918 8:5029795-5029817 CAGGAGGAAGAGAGAGCCAGGGG - Intergenic
1036806925 8:11841416-11841438 TAGGAGGAAGAGGGCGAGTCAGG + Intergenic
1036830771 8:12018009-12018031 TAGGAGGCAGAGGTAGCAGTGGG + Intergenic
1037946109 8:22990610-22990632 GAGGAGGAAGAGGGTGGGTTGGG + Intronic
1038289659 8:26237460-26237482 TAGGAGGAAGAGAGAGCGGGAGG - Intergenic
1038330160 8:26601717-26601739 TAGGAGGACGAGAGAGACCTTGG + Intronic
1038590764 8:28835316-28835338 AAGGAGGCAGACTGAGCCTTTGG + Exonic
1039587472 8:38719303-38719325 TAGGAGGAAGAAGAGTCCTTGGG + Intergenic
1039897372 8:41725730-41725752 GAGGAGGAGGGAGGAGCCTTGGG - Intronic
1041260745 8:56018960-56018982 CAGGAGGCAGAGGGAGCCAAGGG + Intergenic
1041392674 8:57360618-57360640 AAGGAGGAAGAGGGAGCAGGGGG - Intergenic
1041721910 8:60983831-60983853 TAGGAGGAAGTGGGGGTCTCTGG - Intergenic
1041957112 8:63568514-63568536 TAGGAGGAAGAGACAACATTCGG - Intergenic
1042079072 8:65030175-65030197 TAGTGGGGAGAGGGTGCCTTAGG - Intergenic
1042158574 8:65869240-65869262 TTGGAGGAAGGAGTAGCCTTAGG - Intergenic
1042274146 8:66985699-66985721 TGGGAGGAAGAAGGAGTCTTTGG + Intronic
1042873408 8:73418556-73418578 TAGTGGTAAGAGGTAGCCTTTGG + Intergenic
1043506847 8:80910931-80910953 TTGGAGGAAGGAGTAGCCTTGGG + Intergenic
1044123640 8:88429930-88429952 TAGGAGGCAGGGGTAGCATTAGG + Intergenic
1046817047 8:118596568-118596590 TTGGAGGAAGCGCCAGCCTTTGG + Intronic
1047410006 8:124616624-124616646 TAGGAGAGAAAGGGATCCTTTGG + Intronic
1048580809 8:135728657-135728679 TAAGAGCAGGAGGGAGCCCTTGG - Intergenic
1049738031 8:144220478-144220500 TAGGAGGAAGAGGGAGCATAAGG - Intronic
1050010361 9:1179567-1179589 TAGGAGGCACAGGGAGACTCAGG + Intergenic
1050288788 9:4131558-4131580 CAGGAGGAAGGGAGAGCCATGGG - Intronic
1050396413 9:5202721-5202743 TAGAAGGAAGAGGGGGACCTTGG - Intergenic
1050451704 9:5788421-5788443 AAGAAGGAAGAGGAATCCTTTGG + Intronic
1050617297 9:7415607-7415629 AATGAGGAATAGGGAGGCTTAGG - Intergenic
1050915934 9:11132734-11132756 CAGGAGGAAGAGGGAGCAAAGGG - Intergenic
1052634352 9:31082223-31082245 TAAGAGAAAGAGGGAGGATTGGG - Intergenic
1052996051 9:34552122-34552144 TGGGTGGCAGAGGGAGCCTGAGG - Intronic
1055479548 9:76696406-76696428 TCGGAGGGTGAGGGAGGCTTGGG - Intronic
1056691325 9:88810995-88811017 TATAAGGAGGAGGGAGCCTGAGG - Intergenic
1057525326 9:95794452-95794474 TAGTATGAAGAGGGAGCTGTGGG + Intergenic
1059425074 9:114215919-114215941 TAGGAGCATGAGGGGGACTTTGG + Intronic
1060323396 9:122587931-122587953 AAGGAGCATGAGGGAGCTTTCGG + Intergenic
1061201847 9:129142632-129142654 TAGGAGGAAGCAGGAGCCCCAGG - Intronic
1061551028 9:131334821-131334843 TGGGAGGGAGAGGGTGCCTGGGG + Intergenic
1062516757 9:136940705-136940727 CAGGAGGCCGAGGGGGCCTTGGG + Exonic
1062521967 9:136961676-136961698 CAGGAGGAAGAAGGAGGGTTGGG + Intergenic
1062728923 9:138097635-138097657 TAGGGGGATGAGGGAACCGTGGG + Intronic
1185922789 X:4112766-4112788 TAGGAGGAAGATGGAGATATGGG + Intergenic
1186078911 X:5909140-5909162 GAGGAGAATGTGGGAGCCTTTGG - Exonic
1186301519 X:8204758-8204780 CAGGAGGCAGAGGGAGCCACAGG + Intergenic
1187850084 X:23583113-23583135 AAGAAGGAAGAGGGAGATTTTGG + Intergenic
1187994173 X:24907241-24907263 GAGGGGGAAAAAGGAGCCTTGGG + Intronic
1188111619 X:26200642-26200664 CATGAGGAAGAGAGAGCCTGAGG + Intergenic
1188447983 X:30276845-30276867 TAACAGGAAGAGTTAGCCTTAGG + Intergenic
1190164707 X:48063509-48063531 CAGGAGGGAGGGGGAACCTTGGG + Intronic
1190595875 X:52052361-52052383 TGGCAGGAAGGGGGAGCCCTAGG + Exonic
1190612949 X:52201712-52201734 TGGCAGGAAGGGGGAGCCCTAGG - Exonic
1195801875 X:108721566-108721588 TAAGAGGAAGAGTGTGCATTGGG + Intergenic
1196546752 X:116972488-116972510 TAGGAGGAAGAGGGAAAGATGGG - Intergenic
1196886424 X:120250737-120250759 TCGGAAGAGGAGGGCGCCTTTGG + Exonic
1196897608 X:120353149-120353171 TATGAGGAAAAGGGATACTTAGG - Intergenic
1199383101 X:147193441-147193463 CAGGAGGAAGAGAGAGGCTGGGG - Intergenic
1199494192 X:148435069-148435091 AAGGAGCACTAGGGAGCCTTTGG + Intergenic