ID: 1069764289

View in Genome Browser
Species Human (GRCh38)
Location 10:70841626-70841648
Sequence AGCTGATGGTAGGAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069764289_1069764296 9 Left 1069764289 10:70841626-70841648 CCCTCTTCCTCCTACCATCAGCT No data
Right 1069764296 10:70841658-70841680 GATTTCAACATATGAATTTTTGG 0: 182
1: 925
2: 2225
3: 3438
4: 4626
1069764289_1069764297 10 Left 1069764289 10:70841626-70841648 CCCTCTTCCTCCTACCATCAGCT No data
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764289_1069764299 12 Left 1069764289 10:70841626-70841648 CCCTCTTCCTCCTACCATCAGCT No data
Right 1069764299 10:70841661-70841683 TTCAACATATGAATTTTTGGGGG 0: 28
1: 372
2: 1349
3: 2634
4: 3546
1069764289_1069764298 11 Left 1069764289 10:70841626-70841648 CCCTCTTCCTCCTACCATCAGCT No data
Right 1069764298 10:70841660-70841682 TTTCAACATATGAATTTTTGGGG 0: 28
1: 444
2: 1606
3: 3278
4: 4796

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069764289 Original CRISPR AGCTGATGGTAGGAGGAAGA GGG (reversed) Intronic
No off target data available for this crispr