ID: 1069764290

View in Genome Browser
Species Human (GRCh38)
Location 10:70841627-70841649
Sequence AAGCTGATGGTAGGAGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 958
Summary {0: 1, 1: 0, 2: 6, 3: 100, 4: 851}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069764290_1069764299 11 Left 1069764290 10:70841627-70841649 CCTCTTCCTCCTACCATCAGCTT 0: 1
1: 0
2: 6
3: 100
4: 851
Right 1069764299 10:70841661-70841683 TTCAACATATGAATTTTTGGGGG 0: 28
1: 372
2: 1349
3: 2634
4: 3546
1069764290_1069764296 8 Left 1069764290 10:70841627-70841649 CCTCTTCCTCCTACCATCAGCTT 0: 1
1: 0
2: 6
3: 100
4: 851
Right 1069764296 10:70841658-70841680 GATTTCAACATATGAATTTTTGG 0: 182
1: 925
2: 2225
3: 3438
4: 4626
1069764290_1069764297 9 Left 1069764290 10:70841627-70841649 CCTCTTCCTCCTACCATCAGCTT 0: 1
1: 0
2: 6
3: 100
4: 851
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764290_1069764298 10 Left 1069764290 10:70841627-70841649 CCTCTTCCTCCTACCATCAGCTT 0: 1
1: 0
2: 6
3: 100
4: 851
Right 1069764298 10:70841660-70841682 TTTCAACATATGAATTTTTGGGG 0: 28
1: 444
2: 1606
3: 3278
4: 4796

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069764290 Original CRISPR AAGCTGATGGTAGGAGGAAG AGG (reversed) Intronic
900814544 1:4833372-4833394 AAGGTGATGGTATTAGGAGGCGG - Intergenic
900855091 1:5175010-5175032 AAGGTGATGGTATTAAGAAGTGG + Intergenic
901186914 1:7379800-7379822 AAGCTGTCCTTAGGAGGAAGAGG - Intronic
901243688 1:7711293-7711315 AACGTGATGGTATTAGGAAGTGG - Intronic
901685642 1:10942003-10942025 GGGCTGAAGGGAGGAGGAAGAGG + Intergenic
902056039 1:13601192-13601214 CAGCTGATGTGAGGAGGAAGAGG + Intronic
902158021 1:14505308-14505330 AAGTGGATGGAAGGAGGAAAGGG + Intergenic
902249697 1:15146222-15146244 AAGCTGAGAGGAGGAGAAAGAGG - Intergenic
902491211 1:16782082-16782104 ATGCTCATGGTAGGCAGAAGAGG - Intronic
903051480 1:20604474-20604496 AAAGTGATGGTATTAGGAAGTGG - Intronic
903482187 1:23661812-23661834 AAGGTGATGGTATTAGGAGGTGG - Intergenic
903531972 1:24037829-24037851 AAGGTGATGGTATTAGGAGGTGG - Intergenic
903836051 1:26203888-26203910 ATGCTGATGGGAGGACGATGGGG - Intergenic
904000026 1:27333660-27333682 AAGGTGATGGTATGAGGAGGTGG - Intronic
904456217 1:30649772-30649794 AAGGAGGAGGTAGGAGGAAGTGG - Intergenic
904456507 1:30651404-30651426 AAGGAGGAGGTAGGAGGAAGTGG - Intergenic
904636989 1:31889748-31889770 AAGGTGATGGTATTAGGAGGTGG - Intergenic
904868175 1:33599060-33599082 AAGGTGATGGTATTAGGAGGTGG - Intronic
905310251 1:37043972-37043994 AGGCTGATGGTGGGTGGAGGAGG + Intergenic
905758131 1:40530006-40530028 AATATGGTGGTAGGAGAAAGAGG - Intergenic
906791372 1:48661223-48661245 AAGCAGGTGGCAGGAGGGAGTGG + Intronic
906848978 1:49227058-49227080 AAGGTGATGGTAATAGGAGGTGG - Intronic
906941934 1:50263060-50263082 CAGATGATAGTAGGAGGATGTGG + Intergenic
907052617 1:51339919-51339941 AAGGTGATGGTATTAGGAGGTGG + Intronic
907201346 1:52729263-52729285 AAGGTAATGGTATGAGGAGGTGG - Intronic
907709488 1:56865511-56865533 AATCTGATGGTATTAGGAAGTGG - Intronic
908114769 1:60929870-60929892 AAACTAGAGGTAGGAGGAAGAGG - Intronic
908392472 1:63696225-63696247 AAGGTGATGGTATTAGGAGGTGG + Intergenic
908846382 1:68328770-68328792 AAGGTGATAGTATTAGGAAGTGG + Intergenic
908869568 1:68593503-68593525 AAGGTGATGGTATTCGGAAGTGG + Intergenic
908893194 1:68868969-68868991 AAACTGCTGGTGGGAGGAGGAGG + Intergenic
909038147 1:70618528-70618550 AAGATGATGGTATTAGGAGGTGG - Intergenic
909354880 1:74697047-74697069 AAGGTGATGGTACTAGGAGGTGG + Intergenic
909757297 1:79242526-79242548 AAGGTGATGATATGAGGAGGTGG + Intergenic
909832402 1:80209182-80209204 AAGGTGATGGTACTAGGAGGTGG + Intergenic
909862473 1:80625642-80625664 CAGAGGATGGTAGGAGGGAGAGG - Intergenic
910097576 1:83541043-83541065 AAGCTGTTGGAAAGATGAAGTGG - Intergenic
910265197 1:85331037-85331059 CAGCTGCTGGTTGGAGGAATTGG + Intronic
910544389 1:88397738-88397760 AAGGTGATGGTATTAGGAGGTGG - Intergenic
910593157 1:88949950-88949972 AAGGTGATGGTATTAGGAGGTGG + Intronic
911377553 1:97069637-97069659 AAGGTGATGGTATTAGGAAGTGG - Intergenic
911500919 1:98683460-98683482 AAGCTGATGATAGTAGGAGGTGG + Intronic
911631228 1:100185706-100185728 AAGGTGATGGTATTAAGAAGTGG - Intergenic
911998238 1:104795555-104795577 AAGATGATGGTATTAGGAAGTGG + Intergenic
912360707 1:109092679-109092701 AAATTGCTTGTAGGAGGAAGGGG - Intronic
912963635 1:114217886-114217908 AAGCTGATGGAAGGACAGAGTGG + Intergenic
913185440 1:116366534-116366556 AAAGTGATGGTAGGAGGTAATGG - Intergenic
913430897 1:118789396-118789418 AAGCTGACTGGAGGTGGAAGTGG + Intergenic
913955965 1:143293640-143293662 AAGCTGGGGGGAGGAGGAAATGG - Intergenic
913981469 1:143521800-143521822 AAGCTGGGGGGAGGAGGAAATGG + Intergenic
914075841 1:144348455-144348477 AAGCTGGGGGAAGGAGGAAATGG + Intergenic
914103337 1:144618041-144618063 AAGCTGGGGGAAGGAGGAAATGG - Intergenic
914458141 1:147855631-147855653 AAGCTTCTGGAGGGAGGAAGAGG + Intergenic
915973542 1:160370646-160370668 AAGCTGGTGGTGGGAGGGGGAGG - Exonic
916376605 1:164161344-164161366 AAGGTGATGGTATTAGGATGTGG - Intergenic
916503299 1:165405571-165405593 CAGATGATGGAAGGGGGAAGAGG - Intronic
916632808 1:166635192-166635214 AAGGGGATGTAAGGAGGAAGAGG - Intergenic
916697644 1:167255875-167255897 ATGCAGATGGGAGGAGGAAATGG + Intronic
917035047 1:170739594-170739616 AAGACAATGGTAGGAAGAAGAGG + Intergenic
917222893 1:172749972-172749994 GAGGTGATGGTAGGATGAGGAGG + Intergenic
917759940 1:178145702-178145724 CAGATGATGATAGGAAGAAGAGG - Intronic
917949393 1:180015094-180015116 AGGCTGAGAGGAGGAGGAAGAGG + Intronic
917963634 1:180165309-180165331 AAGCAGATGAGAGGAGGAGGAGG - Intronic
918222690 1:182450335-182450357 TGGCAGAAGGTAGGAGGAAGGGG - Intronic
918294646 1:183144861-183144883 AAGCAGATGGAAACAGGAAGTGG - Exonic
919066335 1:192696465-192696487 AAGGTGATGGCATTAGGAAGTGG + Intergenic
919218094 1:194587269-194587291 AAGCTGAGGAGAGGAGAAAGAGG - Intergenic
919858533 1:201722255-201722277 GAGCTGAAGGGAGGAGGAAAGGG - Intronic
919897012 1:202015281-202015303 AAGCGGCTGGAAGGAGGAAGAGG + Exonic
920003075 1:202812460-202812482 GAGCAGATGGGAGGAGGAAGAGG - Intergenic
920082285 1:203383567-203383589 GGGATGATGGCAGGAGGAAGAGG + Intergenic
920287998 1:204895342-204895364 AAGCTGGTGGTAGTGGGAAGGGG - Intronic
921140498 1:212300950-212300972 ATGCTGATGGTAGAAGGAAGTGG + Intronic
921917287 1:220626890-220626912 ATGCTGATGCTGGGAGGAAGTGG + Intronic
921931093 1:220754889-220754911 AAGCTGTTGGGAGGTGGAAGAGG + Intronic
922036118 1:221850221-221850243 AAGGTGATGATATCAGGAAGTGG - Intergenic
922823772 1:228503010-228503032 AAGGTGATGGTATTAGGAGGTGG - Intergenic
922860365 1:228811094-228811116 AAGGTGATGGTATTAGGAGGTGG - Intergenic
923492034 1:234492596-234492618 AAGGTGATGGTATTAGAAAGTGG - Intergenic
923529231 1:234800452-234800474 ATGCTCATGGTAGGCAGAAGAGG + Intergenic
923553270 1:234980869-234980891 CGGCTGTGGGTAGGAGGAAGTGG - Intergenic
923843170 1:237696660-237696682 AAGCAGACTGTGGGAGGAAGGGG - Intronic
924183567 1:241463882-241463904 GAGGTGATGGTATCAGGAAGTGG + Intergenic
924398975 1:243657089-243657111 AAGGTGATGGTATTAGGAAGTGG + Intronic
924457768 1:244231816-244231838 ATGCTGGGGGTGGGAGGAAGGGG - Intergenic
924562759 1:245170767-245170789 AAAGTGATGGTAGTAGGAGGTGG - Intronic
924798614 1:247310792-247310814 AAGATGATGGTATTAGGAAGTGG - Intronic
1062775061 10:137308-137330 ACCCTGCTGGTAGGAGGGAGTGG + Intronic
1063375227 10:5550668-5550690 GCGCTGATGGTAGGAGTCAGTGG + Intergenic
1063496967 10:6519162-6519184 GAGCAGATAGTAGGGGGAAGGGG + Intronic
1063889628 10:10616363-10616385 AACCTATTGGTTGGAGGAAGTGG + Intergenic
1064318183 10:14277326-14277348 AAGGTGATGGTATTAGGAAGGGG + Intronic
1064657066 10:17566789-17566811 AAGGTGATGGTATGAAGAGGTGG - Intergenic
1064889934 10:20159690-20159712 AAGGTGATGGGAGGTGGTAGGGG - Intronic
1065071846 10:22032830-22032852 AAGCAGCAGGAAGGAGGAAGAGG + Intergenic
1065722390 10:28639656-28639678 GAGCTGATGGCAGGGGGAAATGG - Intergenic
1065777320 10:29132912-29132934 GAGCTGATGGGAAGAGGAAGAGG - Intergenic
1065792277 10:29271821-29271843 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1065857621 10:29842981-29843003 AAGGTGATGGTATTAGGAAGTGG - Intergenic
1065964592 10:30760951-30760973 AAGGGGATGGTATTAGGAAGGGG + Intergenic
1065967039 10:30779018-30779040 AAGAGGAGGGAAGGAGGAAGGGG + Intergenic
1066177662 10:32926271-32926293 AACATGATGGTATTAGGAAGTGG + Intronic
1066399327 10:35059720-35059742 AAGATTATGGTAGAATGAAGTGG + Intronic
1066653941 10:37682266-37682288 AAGCAGGGGGGAGGAGGAAGTGG + Intergenic
1067038355 10:42934939-42934961 AAGCAGTGGGGAGGAGGAAGTGG + Intergenic
1067659473 10:48223733-48223755 AATCTGATGGCATTAGGAAGTGG + Intronic
1068100754 10:52550021-52550043 AATCTGATGGTATTAGGAGGTGG + Intergenic
1068183519 10:53554550-53554572 AATCTGATGGTATTAGGAAATGG + Intergenic
1068429984 10:56919263-56919285 AACCTGAGGGAAGAAGGAAGTGG - Intergenic
1068659980 10:59613636-59613658 AACGTGATAGTATGAGGAAGTGG - Intergenic
1068660074 10:59614561-59614583 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1069274006 10:66566978-66567000 AAGAGGATGGTAGGGGGAGGGGG + Intronic
1069277423 10:66610103-66610125 TAGAGGATGGGAGGAGGAAGAGG + Intronic
1069687011 10:70324798-70324820 GGGCTGATGGGAGGAGGAACTGG + Intronic
1069764290 10:70841627-70841649 AAGCTGATGGTAGGAGGAAGAGG - Intronic
1069774906 10:70920676-70920698 GAGGTGCTGGGAGGAGGAAGAGG - Intergenic
1069797543 10:71062936-71062958 AGGCTGTTGGGAGGAGGCAGGGG - Intergenic
1069882623 10:71603199-71603221 AAGCCCATGGCAGGAGGAGGGGG - Intronic
1070419565 10:76223518-76223540 AATGTGATGGTAATAGGAAGAGG + Intronic
1070533182 10:77355316-77355338 AGACTGATGGAAGGAGGAAGTGG - Intronic
1070653057 10:78252018-78252040 AAGGTGATGGTATGGGGAAGTGG - Intergenic
1070727963 10:78804912-78804934 ATGCTGGTGGTAGGAGGCTGGGG - Intergenic
1071419593 10:85478651-85478673 AAGCTCATGGTATTAGGGAGGGG + Intergenic
1071940674 10:90588150-90588172 AAACTGAGGGTGGGAGGCAGTGG - Intergenic
1072047620 10:91672493-91672515 AAGCAGATGGGAAGAGGGAGTGG + Intergenic
1073089944 10:100927257-100927279 TTGCTGAGGGTGGGAGGAAGAGG - Intronic
1073223555 10:101896719-101896741 ATGCTGATGGCAGTAGGAAAAGG + Intronic
1073238800 10:102039919-102039941 AACCTGAAGGTAGCAGGCAGAGG + Intronic
1073718788 10:106140999-106141021 AAGATGATGGTATTAGGAGGTGG + Intergenic
1073740355 10:106399396-106399418 AAGCTGAAGGCAAGAGAAAGAGG + Intergenic
1074221375 10:111441554-111441576 AAGATGATGGTGTCAGGAAGGGG + Intergenic
1074765714 10:116698734-116698756 GAGGTCCTGGTAGGAGGAAGAGG + Exonic
1075395910 10:122126913-122126935 AAGGTGATGGTATGAGGAGGTGG + Intronic
1075406647 10:122199966-122199988 AAGGTGATGGTATCAGGAGGTGG - Intronic
1075518162 10:123126163-123126185 AATATGATGGTATGAGGAGGTGG + Intergenic
1075554996 10:123424149-123424171 AGGCTGGGGGGAGGAGGAAGTGG + Intergenic
1075759689 10:124846553-124846575 AAGCTGATGGCCTGGGGAAGTGG - Intergenic
1076111202 10:127861062-127861084 AAGGTGATGGTATGAGGAGGTGG + Intergenic
1076236462 10:128867276-128867298 GAGCAGATGGCAGGAGGAGGAGG + Intergenic
1076692849 10:132232597-132232619 AAGTTGGTGATTGGAGGAAGCGG - Intronic
1076852020 10:133097952-133097974 AAGCTGATGATATTTGGAAGCGG - Intronic
1077501759 11:2912589-2912611 CAGCAGGTGGGAGGAGGAAGTGG + Intronic
1077844082 11:6005843-6005865 AAGATGATGGTATTAGAAAGTGG - Intergenic
1079075528 11:17383299-17383321 AAGGTGATGGTATTTGGAAGCGG + Intergenic
1079503129 11:21125003-21125025 AGGGTGATGGTATTAGGAAGTGG - Intronic
1080025034 11:27604509-27604531 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1080450080 11:32371827-32371849 AAGGTGATGGTATTAGGATGTGG + Intergenic
1080742402 11:35078740-35078762 AAGGTGATGGTATGAGCAGGTGG + Intergenic
1080743936 11:35090957-35090979 TAGGTGATGGTAATAGGAAGTGG + Intergenic
1082043330 11:47705233-47705255 AAGAAGATGGAAAGAGGAAGGGG + Intronic
1082896869 11:58201131-58201153 AAACTGATGGTAGTAGGAGGTGG - Intergenic
1083525875 11:63364463-63364485 AAGCTGGAGGTAGGGGGAAATGG - Intronic
1083967349 11:66050967-66050989 AAGGTTTGGGTAGGAGGAAGAGG + Intronic
1084226005 11:67715231-67715253 GAGCATATGGTAGGAGCAAGTGG - Intergenic
1084775484 11:71372088-71372110 AAGCTGATGGTTGCAGAATGGGG - Intergenic
1085583566 11:77678608-77678630 AAGGTGATGGTATTAGGAGGTGG + Intronic
1086020369 11:82221439-82221461 GGGCTGATGGTAGGGGAAAGTGG - Intergenic
1086159947 11:83710793-83710815 AAGCTGAGGGCAGGTGGAATGGG + Intronic
1086213999 11:84355345-84355367 AAGATGATGATATTAGGAAGTGG + Intronic
1086848950 11:91785705-91785727 ATGATGATGGTCAGAGGAAGAGG - Intergenic
1086978300 11:93163192-93163214 AAGTTAATGGTAGGAGAAACTGG - Intronic
1087224705 11:95585329-95585351 AGGAGGATGGGAGGAGGAAGAGG + Intergenic
1087336197 11:96847854-96847876 AAGATGATGGTACTAGGAGGTGG + Intergenic
1087382689 11:97427014-97427036 AAGATGATGCAAGGAGGATGAGG - Intergenic
1087652097 11:100879728-100879750 AAGCTGAAGAGAGGAGGCAGTGG - Intronic
1087698368 11:101407265-101407287 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1087913431 11:103779964-103779986 AAGGTAGTGGTAGGAGGATGGGG - Intergenic
1088590603 11:111399533-111399555 AAGTGGGTGGTAGGGGGAAGGGG + Intronic
1088711155 11:112509945-112509967 GAGGGGATGGGAGGAGGAAGAGG - Intergenic
1088724888 11:112625417-112625439 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1088724997 11:112626624-112626646 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1088840695 11:113625112-113625134 AAGTTGATGGTAGTAGGAGATGG - Intergenic
1088917478 11:114238574-114238596 AAGGTGATGGTATTAGGAAGTGG - Intronic
1089393966 11:118122825-118122847 AAGGTGATGGTAGTAAGAGGTGG + Intergenic
1089560582 11:119341263-119341285 AAGCAGATGGAAAGGGGAAGAGG + Exonic
1089809784 11:121122189-121122211 AAGGTGATGGTATAAGGAGGTGG + Intronic
1090098836 11:123772472-123772494 AAGATGATGGTATTAGGAGGTGG - Intergenic
1090886426 11:130880921-130880943 AAGGTGATGGCAGTAGGAGGTGG + Intronic
1091292621 11:134450328-134450350 GAGCTAAAGGAAGGAGGAAGTGG + Intergenic
1091954351 12:4625985-4626007 GAGCTTAGGGTAGGGGGAAGAGG + Intronic
1091977761 12:4839277-4839299 AGGCTGAGGAGAGGAGGAAGAGG - Intronic
1092585995 12:9901988-9902010 AAGCTGAAGGTTCAAGGAAGTGG - Intronic
1092813091 12:12289410-12289432 AAGGTGAGGGTAGTAGGAGGTGG + Intergenic
1093016264 12:14157496-14157518 AAGGTGATGGTATTAGAAAGTGG + Intergenic
1093331892 12:17853776-17853798 AAGGTGATGGCATTAGGAAGTGG + Intergenic
1093624844 12:21332810-21332832 AAGGTGATGGCAGTAGGAAGTGG - Intronic
1094179528 12:27577050-27577072 AAGCCAGTGGTAGGAGAAAGAGG + Intronic
1094813462 12:34163319-34163341 AAGCAGCTGGGAGGAGGGAGAGG - Intergenic
1095547520 12:43388979-43389001 AAGGTGATGGTATTAGGAGGTGG - Intronic
1095860996 12:46917886-46917908 AAGGTAATGGTATGAGGAGGTGG + Intergenic
1095910006 12:47416673-47416695 AAGGTGATGGTATTAGGAGGCGG + Intergenic
1095942397 12:47735624-47735646 AAGCTGATGGTCCAAGGAGGAGG + Intronic
1096366651 12:51033855-51033877 AAGCTGATCCTTGGAGGCAGGGG + Intergenic
1097276763 12:57819038-57819060 ATGGTGATGACAGGAGGAAGAGG + Intergenic
1098228808 12:68351991-68352013 AAGGTGATGGTAACAGGAGGTGG + Intergenic
1098327045 12:69313728-69313750 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1098603974 12:72367427-72367449 AAGAAGCTGGAAGGAGGAAGGGG - Intronic
1098706151 12:73692356-73692378 ATGGGGATGGGAGGAGGAAGAGG + Intergenic
1098788503 12:74789878-74789900 AAGATGATGAAAGGAGTAAGTGG - Intergenic
1099442261 12:82712934-82712956 AAGCTGAGGGAAGGAAGAGGAGG + Intronic
1100567041 12:95806492-95806514 AAGGTGATGGTATTAGGAGGTGG + Intronic
1100630747 12:96386902-96386924 AAGCTGTTTGTTGCAGGAAGAGG - Intronic
1101231436 12:102745663-102745685 AGGCAGATAGTAGGGGGAAGCGG + Intergenic
1101257522 12:102993137-102993159 AAGCAGAAGCTAGGAGGCAGAGG + Intergenic
1101400692 12:104384210-104384232 AAGGTGATGGTATGAGGAGGTGG + Intergenic
1101546619 12:105719399-105719421 AAGGTGATGGTATTAGGAAGGGG - Intergenic
1101630332 12:106486742-106486764 AAGCTGATTTTAGAAGGAAAGGG - Intronic
1102734852 12:115150350-115150372 AAGGTGATGGTATGAGGAGGAGG - Intergenic
1103017814 12:117509257-117509279 AAGGGGATGGAAGGAGGAGGGGG - Intronic
1103392938 12:120587358-120587380 AAGATGATGGTATTAGGAGGTGG + Intergenic
1103449437 12:121018112-121018134 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1103563364 12:121803932-121803954 AAGGAGAGGGGAGGAGGAAGAGG + Intergenic
1103766738 12:123285637-123285659 AAACTGGTGGTAGGAACAAGAGG - Intergenic
1104353956 12:128068736-128068758 AATGTGATGGTGGTAGGAAGTGG - Intergenic
1104546217 12:129715220-129715242 AAGGTAAGGGGAGGAGGAAGAGG + Intronic
1104695712 12:130862219-130862241 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1104701552 12:130908316-130908338 AAGATGATGGTATCAGGAGGTGG - Intergenic
1105012290 12:132763742-132763764 AAGGTGATGGTATTAGGATGTGG + Intergenic
1105823453 13:24100345-24100367 AAGCTGACAGCAGGAGAAAGTGG - Intronic
1106401843 13:29438608-29438630 AAGCTGATGATATTAGGAGGTGG - Intronic
1106698537 13:32204604-32204626 AAGTTGAAGTTAGGAAGAAGGGG - Intronic
1106987834 13:35376662-35376684 AAACTGATAGGAGGAGGAATAGG + Intronic
1107077707 13:36341155-36341177 AAGCTGACTTTGGGAGGAAGGGG + Intronic
1107176524 13:37405872-37405894 AAGATGATGATAGTAGGATGTGG - Intergenic
1108432447 13:50367776-50367798 AAGTTGATGGTATTAGGAGGTGG - Intronic
1108500051 13:51061436-51061458 AAAATGGGGGTAGGAGGAAGAGG + Intergenic
1109052398 13:57500371-57500393 AATGTGGTGGTAGGAGGAGGTGG - Intergenic
1109153342 13:58872404-58872426 AGGCTGAAGGTAGGAGGAAAAGG + Intergenic
1109310360 13:60685759-60685781 AAGATGATGGGCGGAGGGAGGGG - Intergenic
1109796975 13:67328159-67328181 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1110004845 13:70253663-70253685 TAGCTGCTGGGAGGTGGAAGCGG - Intergenic
1110381889 13:74861908-74861930 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1110950636 13:81485711-81485733 AAGGTGATGGTATTATGAAGTGG + Intergenic
1111660358 13:91202362-91202384 AAGGTGATGGTATTAAGAAGTGG + Intergenic
1111874309 13:93874192-93874214 TAGCAGATGGGAGGAGGGAGAGG - Intronic
1112243195 13:97702446-97702468 AAGGTGATGGTATTAGGAAGTGG - Intergenic
1112714970 13:102173810-102173832 AAGCTGAGGGTAGGGGTAGGGGG + Intronic
1112719749 13:102230036-102230058 AAGGTGATGGTATTAGGAGGTGG + Intronic
1113086065 13:106570566-106570588 GACATGATGGTATGAGGAAGTGG - Intergenic
1114369433 14:22069852-22069874 AAGGTAATGATAGGAGAAAGTGG + Intergenic
1115275598 14:31605801-31605823 AAGGAGAAGGGAGGAGGAAGAGG - Intronic
1115320644 14:32076755-32076777 AAGCAGAGGGGAGGAGGGAGCGG + Intronic
1115658533 14:35467190-35467212 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1116054050 14:39840660-39840682 AAGCTGATTGTATTAGGAGGTGG + Intergenic
1116111782 14:40594421-40594443 AATGTGATGGTATTAGGAAGTGG + Intergenic
1116582244 14:46656883-46656905 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1117055619 14:51909452-51909474 AGGCTGATTTTAGAAGGAAGAGG - Intronic
1117678433 14:58178867-58178889 AAGGTGATGGTATTAGGAAGTGG - Intronic
1117864430 14:60130906-60130928 AGCCTGATGGTAGTAGGAGGTGG + Intronic
1118034660 14:61853433-61853455 AAGATGATGGCATTAGGAAGAGG + Intergenic
1118298602 14:64593948-64593970 AAGCTGCTGGGAGGAGGGAATGG + Intergenic
1118437867 14:65787873-65787895 AAGGTGATGGTATTTGGAAGTGG - Intergenic
1118462046 14:65996292-65996314 AAGGTAATGGTATCAGGAAGTGG + Intronic
1118487652 14:66229047-66229069 AAGCTTAAGGTAGAAGAAAGTGG + Intergenic
1118597508 14:67447317-67447339 AAGCTGATGGTATTAGGAAGTGG - Intronic
1119557792 14:75566914-75566936 GAGCAGAGGGAAGGAGGAAGGGG + Intergenic
1119787647 14:77325106-77325128 AGGGTGAGGGTGGGAGGAAGGGG + Intronic
1119876141 14:78061015-78061037 AAGGTGATGGTATTAGGAAGTGG + Intergenic
1120099975 14:80434201-80434223 AAGCACAAGGGAGGAGGAAGTGG + Intergenic
1120498932 14:85269802-85269824 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1120572990 14:86144526-86144548 AAGCTGATGTTTGGAAAAAGAGG + Intergenic
1121447568 14:93988337-93988359 GAGCAGATGGGAGGAGGGAGAGG + Intergenic
1121625283 14:95380940-95380962 AAACTGATGGTATTAGGAGGTGG + Intergenic
1121728763 14:96171980-96172002 AAAATGATGGTGTGAGGAAGTGG - Intergenic
1121761540 14:96449161-96449183 AAGCTGATGGTAGTAGGAGCTGG - Intronic
1121791552 14:96703099-96703121 GAGCTTATGGAGGGAGGAAGTGG + Intergenic
1122204672 14:100142608-100142630 AGGCTGATGGCAGAGGGAAGAGG + Intronic
1122344498 14:101050138-101050160 AAGCTGACCTGAGGAGGAAGTGG - Intergenic
1122376347 14:101262120-101262142 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1123394724 15:19920726-19920748 AAGCTGGGGGTAGGAAGAAATGG + Intergenic
1123812164 15:23938622-23938644 AAGGGAATGGGAGGAGGAAGGGG - Intergenic
1124193119 15:27597710-27597732 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1124855746 15:33386679-33386701 AAGCTGAGGGAAGGGGGAATGGG - Intronic
1124997426 15:34737224-34737246 ATGCTGGTGGAAGGGGGAAGCGG + Intergenic
1125105302 15:35963936-35963958 AAGGTGATGGTAGCAGGAGGTGG - Intergenic
1125116346 15:36096494-36096516 AAGATGATAGTACTAGGAAGTGG - Intergenic
1125245837 15:37638051-37638073 AAACAGAAGGGAGGAGGAAGAGG + Intergenic
1125513531 15:40305582-40305604 AAGCTGAAGGTGGTAAGAAGGGG + Intronic
1125584234 15:40808993-40809015 CAGCTGCTGGGAGGAAGAAGAGG - Intronic
1126372300 15:47960308-47960330 AAGCTGAAGGTATGAGGACAAGG - Intergenic
1126416143 15:48419309-48419331 AGACTGATGGTAGGAGGAGGAGG + Intronic
1127507545 15:59610861-59610883 AAGGGGAGGGAAGGAGGAAGGGG - Intronic
1128027217 15:64448104-64448126 ACACTGGTGGTAGGAGGAAACGG + Intronic
1128702960 15:69817430-69817452 AAGATGATGGTATTAGGAGGTGG - Intergenic
1129053597 15:72803403-72803425 TAGCTCAGGCTAGGAGGAAGAGG - Intergenic
1129056318 15:72822982-72823004 AAGGTGATGGTATTAGGAGGCGG - Intergenic
1129081265 15:73043130-73043152 AAGGTGATGGTATTAGGAAGTGG - Intergenic
1129921929 15:79326709-79326731 AAGGTGATGGTATTAGGAGGTGG + Intronic
1130128496 15:81115454-81115476 AAGAGGAAGGTTGGAGGAAGTGG + Intronic
1130146107 15:81274926-81274948 AAGCAGAGTGTAGGATGAAGTGG + Intronic
1130414309 15:83676711-83676733 AAGGTTATGGTATTAGGAAGTGG + Intronic
1130922980 15:88364611-88364633 AAGCAGTGGGCAGGAGGAAGAGG - Intergenic
1131180365 15:90234905-90234927 AAACTGCTGGGAGGAGGAAGTGG + Intronic
1131409352 15:92193388-92193410 AGACTGAGGGGAGGAGGAAGAGG - Intergenic
1131659248 15:94496765-94496787 AAGGTGATGGTACTAGGAGGTGG + Intergenic
1131805450 15:96117506-96117528 CAGCTGGTGGGAGGAGGAAGTGG + Intergenic
1132683204 16:1152288-1152310 CAGCTGCTGGCAGGGGGAAGGGG + Intergenic
1133864304 16:9627360-9627382 AAGGAGAAGGGAGGAGGAAGGGG + Intergenic
1133885734 16:9825955-9825977 AAGATGATGGAAGGAGTAGGAGG + Intronic
1133924901 16:10184078-10184100 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1135169189 16:20168220-20168242 AGGCTGATGATATCAGGAAGTGG + Intergenic
1135816413 16:25638316-25638338 AGGCAGATGGGAGGAGGATGGGG - Intergenic
1136013366 16:27379213-27379235 AAGATGAGGGTAGGGGGAGGAGG + Intergenic
1137540298 16:49357114-49357136 ACCCTGGTGGGAGGAGGAAGGGG - Intergenic
1137593697 16:49709638-49709660 AAGATGATGGTATTAAGAAGTGG + Intronic
1137619801 16:49868670-49868692 AAGCAGGAGGTGGGAGGAAGAGG + Intergenic
1138336836 16:56260092-56260114 CAGCTGATGTCAGGAGGCAGGGG + Intronic
1138526213 16:57608852-57608874 AAGCTAATGAGAGCAGGAAGGGG - Intergenic
1138646467 16:58429049-58429071 AAAGTGATGGTATTAGGAAGTGG - Intergenic
1138647438 16:58435416-58435438 AATGTGATGGTACTAGGAAGTGG + Intergenic
1138980529 16:62262517-62262539 AAGCTGTTGGTAGAAGAAATGGG + Intergenic
1139579501 16:67864033-67864055 AAGCTGAGGGTTGTGGGAAGAGG - Intronic
1140456921 16:75111133-75111155 CAGCTGATGGGAGGAGGAGAGGG + Intergenic
1140716736 16:77733470-77733492 AAGGTGATGGTATTAGGAGGTGG - Intronic
1140721386 16:77775457-77775479 AAGGTGATGGTATCAGGAGGTGG + Intergenic
1140862049 16:79026445-79026467 AAGCTGATGTGAGAAGGAAGGGG - Intronic
1141030023 16:80579521-80579543 AAGGTGATGGTATTAGGAGGCGG + Intergenic
1141417083 16:83884021-83884043 AAGGTGATGGTATTAGGAAATGG + Intergenic
1141759612 16:86019288-86019310 GAGCTGATGGCATTAGGAAGTGG - Intergenic
1142476671 17:193120-193142 GAGCTGCAGGAAGGAGGAAGGGG + Intergenic
1143271552 17:5679201-5679223 AAGGTGATGGTATTAGGAAGTGG + Intergenic
1143339643 17:6200650-6200672 AAGATGATAGTATGAGGAGGTGG - Intergenic
1143391331 17:6560960-6560982 AAGAAGAGGGGAGGAGGAAGAGG - Intergenic
1143916765 17:10299597-10299619 AGGCTGGGAGTAGGAGGAAGTGG - Intronic
1144044751 17:11445277-11445299 AAGGTGATGGTATTAGGCAGTGG - Intronic
1144671576 17:17135718-17135740 AAGGTGATGGTATCAGGAGGTGG - Intronic
1145019863 17:19421274-19421296 AAGGTGATGGTATCAGGAGGTGG - Intergenic
1145060975 17:19733520-19733542 CAGCCGAAGGTGGGAGGAAGAGG - Intergenic
1145297895 17:21608791-21608813 AAGCTGATGCTCAGAGAAAGGGG + Intergenic
1145300723 17:21634251-21634273 GAGCTGAGGTTAGTAGGAAGTGG - Intergenic
1145349578 17:22069007-22069029 GAGCTGAGGTTAGTAGGAAGTGG + Intergenic
1145352363 17:22094608-22094630 AAGCTGATGCTCAGAGAAAGGGG - Intergenic
1145812726 17:27774254-27774276 AACCTGATAGTAGTAGAAAGGGG + Exonic
1145849342 17:28076473-28076495 AATATGATGGTATTAGGAAGTGG - Intronic
1146624625 17:34425826-34425848 AACCTTAAAGTAGGAGGAAGGGG - Intergenic
1147479169 17:40742546-40742568 TAGGTGATGGTATGAGGAGGTGG - Intergenic
1148203148 17:45763241-45763263 AAGCTGCTGGTAAGAGGAGCAGG - Intergenic
1148374603 17:47131525-47131547 AAGCTGAGGGGAGGGAGAAGGGG + Intronic
1149281850 17:55113918-55113940 ATGTTGATTGTAGGAGGCAGAGG - Intronic
1149358072 17:55864683-55864705 AAGGTGATGGTATTAGAAAGTGG + Intergenic
1149384895 17:56132876-56132898 AAGGTGATGGTATTAGGAGGTGG - Intronic
1150208593 17:63428502-63428524 AATCTGATGTCAAGAGGAAGTGG - Intergenic
1150486892 17:65550290-65550312 AAGCTGGGGGTTGGGGGAAGGGG - Intronic
1150950234 17:69795352-69795374 AAGGTGATGGTATTAGAAAGTGG + Intergenic
1151024869 17:70666523-70666545 TAGAGGATGGGAGGAGGAAGAGG + Intergenic
1152853143 17:82648974-82648996 TACCTGACGGTCGGAGGAAGGGG + Intergenic
1153646385 18:7199683-7199705 AAGATGATGGTATTAGGAGGTGG - Intergenic
1153711069 18:7799334-7799356 AAGTTGATAGTATGAAGAAGGGG - Intronic
1153890306 18:9507989-9508011 AAGGTGATGGTATTAGGAGGGGG - Intronic
1154380309 18:13843656-13843678 AAGCTGATGGTATTAAGAGGTGG - Intergenic
1154495950 18:14961272-14961294 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1155043210 18:22082349-22082371 AATGTGATGGTATTAGGAAGTGG - Intergenic
1155180328 18:23339882-23339904 AAGGTGATGGTAGTAAGAGGCGG - Intronic
1155215071 18:23635953-23635975 AAGCTGGTGGTAGACGGCAGTGG + Intronic
1155899243 18:31367624-31367646 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1156004057 18:32419359-32419381 AGGGTGATGGTATAAGGAAGTGG + Intronic
1156149895 18:34228490-34228512 AAGGTGATGGTATTAGGAAGTGG + Intergenic
1156469232 18:37367142-37367164 AAGGTGTTTGCAGGAGGAAGAGG + Intronic
1156587284 18:38445349-38445371 AAGGGAATGCTAGGAGGAAGAGG - Intergenic
1157183885 18:45521835-45521857 AAGCTGAGGGAGGCAGGAAGGGG + Intronic
1157218068 18:45802046-45802068 GAGCTGGGGGTAGGAGGGAGTGG - Intergenic
1157641935 18:49224508-49224530 AAGGTGATGGTATTAGGAGGTGG + Intronic
1158494978 18:57946841-57946863 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1159044241 18:63353700-63353722 AAACTGATGCTAAGAGAAAGAGG + Intronic
1160464384 18:79064079-79064101 AAGTTAATGGAGGGAGGAAGAGG - Intergenic
1160949632 19:1659197-1659219 AAGCTGAGGGTGGAAGGATGAGG - Intergenic
1161093849 19:2377500-2377522 AAGGTGAGGGGAGGGGGAAGGGG - Intergenic
1161261404 19:3339848-3339870 AAGCTGTGGGTAGGCGGTAGAGG + Intergenic
1163693535 19:18750699-18750721 CTGCTGATAGGAGGAGGAAGAGG + Intronic
1164972280 19:32542835-32542857 AAAGTGATGGTATGAGGAGGTGG + Intergenic
1165882825 19:39055669-39055691 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1166735298 19:45080337-45080359 AAGCTGGAGGGTGGAGGAAGAGG - Intronic
1166848761 19:45747207-45747229 CAGCTGAGGGAAGGATGAAGAGG - Intronic
1167268468 19:48494720-48494742 GAGCTGATGGCAGGGGCAAGAGG + Intronic
1167570094 19:50281574-50281596 AAGCTGAGGGGAGGAGAGAGAGG - Exonic
1168242761 19:55095598-55095620 AAGCTGCTGGGAGAAGGAGGAGG + Exonic
1168358109 19:55714892-55714914 AGGCTGATGGTACTAGGAGGTGG - Intronic
1168700722 19:58437836-58437858 CAGCTGATGGTTGAAGGAACAGG - Intronic
925149561 2:1605958-1605980 AAGCTGATGCTCAGAGGATGAGG - Intergenic
925272085 2:2618029-2618051 AAGCTGAGGGCAGCAGGAAGGGG + Intergenic
925323039 2:2991709-2991731 AAACTGCTGGTAAGACGAAGAGG - Intergenic
925799386 2:7583110-7583132 AAACTGATGGTATTAGGAGGTGG - Intergenic
925832944 2:7914139-7914161 AAGCTGAGGGTAGGCTGGAGCGG - Intergenic
926152100 2:10430979-10431001 AAGGAGGTGGTTGGAGGAAGAGG - Intergenic
927130947 2:20059948-20059970 AAGGTGATGGTATTAGGAGGTGG - Intergenic
928767619 2:34666454-34666476 AAGGTGATAGTATTAGGAAGTGG + Intergenic
928774191 2:34738832-34738854 AAGGTTATAGTAAGAGGAAGGGG - Intergenic
928910573 2:36416802-36416824 AAGCTCATGGGAGGAAGAATTGG - Intronic
929444469 2:41991873-41991895 AAGCAGAGGGGAGGAGCAAGGGG + Intergenic
929448161 2:42016412-42016434 AAGGTGATGGTATTAGGAGGTGG - Intergenic
929803363 2:45123301-45123323 AAGCAGTAGGAAGGAGGAAGAGG + Intergenic
930053909 2:47237536-47237558 AACCTGGAGGTAGGAGGGAGAGG + Intergenic
930547342 2:52785428-52785450 AAGATGATGGTATCAGGAGGTGG + Intergenic
930924149 2:56796085-56796107 AAGGTTATGGTATTAGGAAGTGG - Intergenic
931374872 2:61697871-61697893 AAGGTGATGGAACTAGGAAGAGG - Intergenic
931617027 2:64169844-64169866 CAGCTCCTGTTAGGAGGAAGAGG - Intergenic
931680960 2:64750105-64750127 GAGCTGAGGGGCGGAGGAAGCGG + Intronic
931708997 2:64971424-64971446 AAACTGATGGTGGCAGGAAGAGG + Intergenic
931972800 2:67608314-67608336 AAGGTGATGGTAGTAGGAGGTGG - Intergenic
931987192 2:67753654-67753676 AAGGAGATGGTATTAGGAAGTGG + Intergenic
932008926 2:67955835-67955857 AAGCTGATGGGATGGGGAAAAGG + Intergenic
932186162 2:69698251-69698273 AAGGTGATGGTATTAGGAGGCGG - Intronic
932368489 2:71168383-71168405 AAGGTGATAGTATGAAGAAGTGG + Intergenic
932379405 2:71268859-71268881 AAGCTGGGGGCAGGAGGCAGTGG + Intergenic
932837661 2:75052145-75052167 AAGGTGATGGTATTAGGAGGTGG + Intronic
933998233 2:87685646-87685668 CAGCTGAAGGAAGGAGGAAAGGG + Intergenic
934040591 2:88124894-88124916 AAGCTAATGGAGGGAGGTAGTGG + Intronic
934135872 2:88996010-88996032 CAGCACATGATAGGAGGAAGAGG + Intergenic
934715854 2:96542841-96542863 GAGCTGAGGGTAGCAGGCAGTGG + Intronic
934778258 2:96952464-96952486 GAGCTCCTGTTAGGAGGAAGAGG - Intronic
934930098 2:98415161-98415183 AAGGTGATGATACTAGGAAGCGG - Intergenic
935645797 2:105333216-105333238 AAGGTGATGGTATTTGGAAGTGG + Intergenic
935675400 2:105590782-105590804 AAGGTGATGGTATTAGGAAATGG + Intergenic
935832950 2:107019416-107019438 AATATGATGGTAGTAGGAGGTGG - Intergenic
935940178 2:108229658-108229680 AAACAGATTGTAGGAGGGAGGGG - Intergenic
936014747 2:108949507-108949529 GACCTGATGGCAGCAGGAAGTGG - Intronic
936075178 2:109397221-109397243 GAGCTCAGGGCAGGAGGAAGCGG - Intronic
936295617 2:111265227-111265249 CAGCTGAAGGAAGGAGGAAAGGG - Intergenic
936374182 2:111926858-111926880 ATGCTCTTGGTAGGAGGAGGGGG - Intronic
936599834 2:113884918-113884940 AGGGTGATGGTATTAGGAAGTGG - Intergenic
937253115 2:120536515-120536537 AAGGTGATGGTATTAGGAGGTGG + Intergenic
937297844 2:120820475-120820497 AAGCTGGTGGCAGGAGGAGGCGG + Intronic
937422755 2:121772129-121772151 AAGAAGATGGGAGGAGCAAGAGG + Intergenic
937581272 2:123491567-123491589 AAAATGATAGTAGTAGGAAGTGG - Intergenic
937719361 2:125075508-125075530 AAGGTGAGAGGAGGAGGAAGGGG - Intergenic
937933942 2:127227400-127227422 AAGATGATGGTATGAGGAGGTGG - Intergenic
937933977 2:127227580-127227602 AAGATGATGGTATGAGGAGGTGG - Intergenic
938162931 2:129002785-129002807 AATTTGATGGTATTAGGAAGTGG + Intergenic
938242171 2:129751702-129751724 AAAATGAAGGAAGGAGGAAGAGG + Intergenic
939445335 2:142302940-142302962 AAGCAAAGGGTAGGAAGAAGAGG - Intergenic
939773795 2:146358932-146358954 AAGGTGATGGTATTAGGAGGCGG + Intergenic
940848947 2:158670441-158670463 AAGGTGATGGTATTAGGAGGTGG - Intronic
941890235 2:170572636-170572658 ATGCTGTTGGTGGGAGGAGGAGG - Intronic
941994241 2:171586445-171586467 AAGCTGTTGGCATGAGAAAGAGG + Intergenic
942201204 2:173573176-173573198 AAGGTGATGGTAGTAGCAGGTGG + Intergenic
942287994 2:174440763-174440785 AATGTGGGGGTAGGAGGAAGAGG - Intronic
942428258 2:175881991-175882013 AAGCTGCTGGTAAGATGCAGTGG + Intergenic
942498296 2:176562372-176562394 AAGCTGAAGTTACAAGGAAGGGG - Intergenic
942671683 2:178382721-178382743 AAGCTGTTGGTTTGAGAAAGAGG - Intronic
942812713 2:180017519-180017541 AAGGTGATGGTATTAGGAGGTGG + Intergenic
943101935 2:183497549-183497571 AAGCTTATGGTATTAGGAGGTGG + Intergenic
944382782 2:199130961-199130983 ATGTGGGTGGTAGGAGGAAGTGG - Intergenic
944435902 2:199689309-199689331 AAGTTGTTGATATGAGGAAGAGG + Intergenic
944650908 2:201829362-201829384 GAGATGATGGTGGGAGAAAGTGG + Intronic
944670831 2:201993123-201993145 AAGGTGATGGTATTAGGAGGTGG + Intergenic
944900935 2:204215345-204215367 AAGTTGATGGTATTAGGAAGTGG - Intergenic
945334772 2:208579314-208579336 TAGAGGATGGGAGGAGGAAGAGG + Intronic
945423122 2:209663477-209663499 AAGCTGATGAGCAGAGGAAGGGG + Intronic
946015795 2:216602991-216603013 AAGCTGGAGGGAGGATGAAGAGG - Intergenic
947153683 2:227139006-227139028 AAGGTGATAGTAGGAGGAGATGG + Intronic
947181730 2:227417275-227417297 AAGGTGATGGTATTAGGAGGTGG + Intergenic
947232671 2:227903641-227903663 AAGGGGAGGGTGGGAGGAAGGGG - Intronic
947232679 2:227903658-227903680 AAGGGGAGGGTGGGAGGAAGGGG - Intronic
947232687 2:227903675-227903697 AAGGGGAGGGTGGGAGGAAGGGG - Intronic
948001564 2:234572228-234572250 AAGACGAGGGTTGGAGGAAGTGG + Intergenic
948418217 2:237832599-237832621 AGGCTGTTGGTAGGAGTATGTGG + Intronic
948571911 2:238922998-238923020 AAGCAGGTGGCAGGAGGAGGTGG - Intergenic
1169217112 20:3800345-3800367 AAGCTTGTGGTAGATGGAAGAGG - Intronic
1169301294 20:4443953-4443975 AAGGTGATGGTATTAGGAGGAGG - Intergenic
1170197188 20:13701487-13701509 AAAATGATGGAAGAAGGAAGAGG + Intergenic
1170552525 20:17489954-17489976 AAGGTGAAGGTATTAGGAAGTGG - Intergenic
1171084420 20:22224261-22224283 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1171559717 20:26112435-26112457 GAGCTGAGGTTAGTAGGAAGTGG + Intergenic
1172001287 20:31779696-31779718 AAGCTGAAGGTACGAGAGAGAGG + Intronic
1172329704 20:34066772-34066794 AATGTGATGGTATTAGGAAGTGG - Intronic
1172468090 20:35171998-35172020 CAGGAGATGGGAGGAGGAAGAGG - Intergenic
1172845988 20:37930341-37930363 CAGCTTAGGGAAGGAGGAAGAGG - Intronic
1173020528 20:39264136-39264158 AAGGTGATGGTAAGAGAATGTGG - Intergenic
1173258197 20:41410194-41410216 AAGGTGATGGTAATAGGATGCGG + Intronic
1173374834 20:42473992-42474014 AACCTCATGGCAGGGGGAAGAGG + Intronic
1173448715 20:43143259-43143281 AAGTTGAAGGGAGGAGGGAGAGG - Intronic
1174700654 20:52605147-52605169 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1175153823 20:56955783-56955805 AAGCTTAGTGGAGGAGGAAGTGG + Intergenic
1175427566 20:58878514-58878536 AATCTTATGGGAGGAGGCAGTGG + Intronic
1175502107 20:59457881-59457903 AAACTGAGGGTAAGAGGAACTGG + Intergenic
1175573875 20:60045736-60045758 CAGGGGAGGGTAGGAGGAAGAGG + Intergenic
1175806485 20:61831977-61831999 AAGGAGATGGAAGGAGGAAGTGG - Intronic
1176246831 20:64101562-64101584 AAGCTGATGGTATCAGGAGAGGG - Intergenic
1176926434 21:14755275-14755297 AAGATAATGGTATGAGGAAGTGG + Intergenic
1177369466 21:20182481-20182503 AATGTGATAGTATGAGGAAGTGG - Intergenic
1177530495 21:22352441-22352463 AAGGTGATGGTATTTGGAAGTGG - Intergenic
1177709018 21:24746733-24746755 AATATGATGGTATTAGGAAGGGG + Intergenic
1177781755 21:25629551-25629573 AAAGTGATGGTAGTAGGATGTGG - Intergenic
1177934537 21:27327543-27327565 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1178095720 21:29212729-29212751 AAGATGATGGTATGAGGAGGTGG + Intronic
1178360626 21:31946455-31946477 AAGCTAAGGGCAGGAGGATGGGG - Intronic
1178839035 21:36123895-36123917 AAGATGATGGTATTAGAAAGTGG + Intergenic
1178966749 21:37127230-37127252 AAGGCGATGGTAATAGGAAGTGG - Intronic
1179158836 21:38875254-38875276 AAGCCTATGGCAGGAGGAACAGG + Intergenic
1179240705 21:39588671-39588693 AAGGTGATGGTATTAGGAGGTGG - Intronic
1179254044 21:39699691-39699713 AAGTTGATGGTATTAGGAGGTGG - Intergenic
1179637742 21:42724217-42724239 AAGGTGGTGGAAGCAGGAAGGGG + Intronic
1180766061 22:18346443-18346465 AAGCTGAGGGTCCGAGGAATGGG + Intergenic
1180780252 22:18515935-18515957 AAGCTGAGGGTCCGAGGAATGGG - Intergenic
1180812968 22:18773256-18773278 AAGCTGAGGGTCCGAGGAATGGG - Intergenic
1181199146 22:21207572-21207594 AAGCTGAGGGTCCGAGGAATGGG - Intergenic
1181326257 22:22049461-22049483 GAGCTGAGGGGAGGAGGAAATGG + Intergenic
1181405267 22:22679972-22679994 AAGCTGTGGGTTGGAAGAAGAGG - Intergenic
1181882217 22:25990071-25990093 AAGCTGATGAGAGGGAGAAGGGG - Intronic
1182194388 22:28500183-28500205 GAGCTTGGGGTAGGAGGAAGTGG - Intronic
1182394614 22:30026376-30026398 AGGCTGATGTTTGGAGGGAGAGG + Exonic
1182475032 22:30572660-30572682 GGGGTGATGGTGGGAGGAAGTGG - Intronic
1182567393 22:31210555-31210577 AGGCTGGAGGTAGGAGGAAGTGG + Intergenic
1182714069 22:32341055-32341077 AATGAGATGGTAGGAGGCAGCGG + Intergenic
1182868331 22:33624493-33624515 AAGGTGAGGGTGGGAGGAAATGG + Intronic
1182890865 22:33817893-33817915 AAGCTGAAGGAGGGAGGAAAGGG + Intronic
1183210248 22:36446896-36446918 AAGGTGATGGTGTTAGGAAGTGG - Intergenic
1184401388 22:44276642-44276664 AAGGAGATGGTGGGAGGCAGCGG + Intronic
1185131684 22:49043074-49043096 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1203227679 22_KI270731v1_random:87334-87356 AAGCTGAGGGTCCGAGGAATGGG + Intergenic
949260763 3:2099912-2099934 GAGGTGAGGGTAGGAGGACGTGG + Intronic
949415998 3:3814570-3814592 AAGGTGATGGTATTAAGAAGTGG + Intronic
949565009 3:5236335-5236357 AAAATGCTGGGAGGAGGAAGAGG - Intergenic
949589890 3:5483097-5483119 AAGGTGATGGTATTAGGAGGTGG - Intergenic
949834397 3:8252314-8252336 TAGATGGTGGGAGGAGGAAGAGG + Intergenic
950096422 3:10333357-10333379 AATTTGATGGGATGAGGAAGTGG - Intronic
950109822 3:10411904-10411926 ATGCAGATGGTGGGTGGAAGTGG - Intronic
950235808 3:11319384-11319406 AAAGTGCTGGTAGGAGGAGGAGG - Intronic
950467606 3:13164366-13164388 AAGGTGATGGAAACAGGAAGAGG - Intergenic
950611466 3:14129726-14129748 CAGCTGATGTGAGCAGGAAGGGG + Intronic
950912694 3:16611449-16611471 GAGGTGATGGTATTAGGAAGTGG + Intronic
950961730 3:17115064-17115086 AAGATGATGGTATTAGGAGGTGG + Intergenic
951116346 3:18867283-18867305 AATGTTATGGTATGAGGAAGTGG - Intergenic
951247850 3:20361743-20361765 AAGGTGATGGTATTAGGAGGTGG - Intergenic
951347447 3:21563084-21563106 AAGTTGATGGTAGTAGCAGGTGG + Intronic
951627889 3:24686522-24686544 AAGATGATGGTATGAGGAGATGG - Intergenic
951743779 3:25954065-25954087 AAGCAGAGGGCAGGAGCAAGTGG - Intergenic
951752713 3:26055217-26055239 AAGGTGATAGTATGAGGAGGTGG - Intergenic
951934637 3:28008420-28008442 AAGGTGATGGTATTAGGAGGTGG + Intergenic
951966101 3:28387033-28387055 GAGCTGATGCTGGGCGGAAGGGG - Intronic
952509087 3:34036142-34036164 AAGTTGTTTGGAGGAGGAAGGGG + Intergenic
952585666 3:34889084-34889106 AATGTGATGGTATTAGGAAGTGG - Intergenic
952657990 3:35809372-35809394 AGGCTGATGGTAGGAGAGAGAGG - Intergenic
952863197 3:37831888-37831910 AAGGTGATGGTATTAGGAGGTGG - Intergenic
953057139 3:39396989-39397011 GAGGTGATGGTAGGATGAGGAGG + Exonic
953242322 3:41160549-41160571 AAGGTAATGGTATTAGGAAGTGG + Intergenic
953710752 3:45268290-45268312 AAGCAGATAGTAAGGGGAAGAGG - Intergenic
954376417 3:50196240-50196262 AAGCTGCTGGTAGGGACAAGAGG - Exonic
954416879 3:50397648-50397670 CTGCTGAGGGTTGGAGGAAGGGG - Intronic
954621940 3:52001454-52001476 AAGCTCCTGGTAGAAGGAAAGGG + Intergenic
955127057 3:56123212-56123234 AAGGTGATGGTATTAGGAAGTGG + Intronic
955155305 3:56411309-56411331 AAGCAGATGGAAGGTGGCAGAGG - Intronic
955466579 3:59243313-59243335 AAGGTGATGGTATTAGGAGGCGG + Intergenic
955754014 3:62209691-62209713 AAGCTCAGGGTAGGCCGAAGGGG + Intronic
956146065 3:66191943-66191965 AATCTGATGGTATTAGGAAATGG + Intronic
956249379 3:67219691-67219713 AGGCTAATGGTAGGAGTCAGGGG + Intergenic
956271587 3:67453531-67453553 AAGGTGATGATATTAGGAAGTGG - Intronic
956489648 3:69757140-69757162 CAGCTGATAGTTGGGGGAAGTGG - Intronic
956840207 3:73132730-73132752 AATGTGATGGTATTAGGAAGTGG - Intergenic
956960864 3:74399283-74399305 AAGTGGAGGGTGGGAGGAAGGGG - Intronic
957168727 3:76709908-76709930 GAGCTGTTGGCAGAAGGAAGTGG - Intronic
957520107 3:81308392-81308414 AATGTGATGGTATTAGGAAGTGG + Intergenic
957604843 3:82383444-82383466 AATTTATTGGTAGGAGGAAGGGG + Intergenic
958004839 3:87797857-87797879 AAGCTGATGGTGGGACAAAAAGG + Intergenic
958069883 3:88596780-88596802 AATGTGATGGTAGTAAGAAGTGG + Intergenic
958594909 3:96210135-96210157 AAGGTAACAGTAGGAGGAAGTGG + Intergenic
958903247 3:99912954-99912976 AATGTGATGGTATTAGGAAGTGG + Intronic
959470870 3:106748285-106748307 TAGCTTATGGTAGGACAAAGGGG - Intergenic
959826188 3:110798951-110798973 AAGCTGACAGAAGGAGTAAGAGG - Intergenic
960511133 3:118550806-118550828 AGACTGAAGGTAGGAGGAAGGGG - Intergenic
960585997 3:119322446-119322468 AAGCTGCCCGGAGGAGGAAGGGG - Intronic
961251779 3:125513105-125513127 AAGGTGATGGTATTAGGAGGTGG + Intronic
961902523 3:130226780-130226802 AATGTGATGGTATGAGGAGGTGG - Intergenic
963348711 3:144126878-144126900 AAGGTGATGGTATTAGGAGGTGG - Intergenic
963906164 3:150774909-150774931 AAGGTGATGGGAGGGGGAGGGGG + Intergenic
964190319 3:153993189-153993211 AACAGGATCGTAGGAGGAAGGGG + Intergenic
964203633 3:154146303-154146325 AAGGTGATGGTATTAGGAGGTGG - Intronic
964238865 3:154567608-154567630 AAGCTGATGGAGTGAGGAGGTGG - Intergenic
964487396 3:157199967-157199989 AAGCTGATTGTGGTGGGAAGTGG + Intergenic
964535436 3:157716253-157716275 AGGCTGAGGGTAGGAAGAGGAGG + Intergenic
964734496 3:159902808-159902830 ACTTTGATGGAAGGAGGAAGTGG - Intergenic
964805812 3:160608494-160608516 TAGGTGATGGTATTAGGAAGTGG + Intergenic
964949412 3:162269752-162269774 TAAATGAAGGTAGGAGGAAGAGG + Intergenic
965256646 3:166422847-166422869 AAGCTGGTGGTAGGGGCAAGAGG + Intergenic
965407382 3:168287069-168287091 ATGATGATGGGAGGAGGAAAGGG + Intergenic
965606322 3:170501077-170501099 ATGTTGAGGGTAGGAGGATGTGG + Intronic
965806394 3:172546717-172546739 CAGCTGATGGTAGTAAGAGGTGG - Intergenic
965933895 3:174081562-174081584 AATTTGATGGTATTAGGAAGTGG - Intronic
966145695 3:176809272-176809294 AAGGTGGTGGAAGGAGGGAGAGG - Intergenic
966436412 3:179889241-179889263 GAGCTGATGGAAGGTGGCAGGGG + Intronic
966666747 3:182480155-182480177 TATCTGAAGGGAGGAGGAAGTGG + Intergenic
966942005 3:184753555-184753577 AAGGTGATGGGAGAAGGAGGTGG + Intergenic
967168898 3:186808449-186808471 AAGGTGATGGTATCAGGAGGTGG - Intergenic
967670366 3:192226604-192226626 AAGGTGATGGTAACAGGAAGTGG + Intronic
969848198 4:9936151-9936173 AAACTGATGGTATCAGGAGGTGG + Intronic
969868074 4:10088112-10088134 AAGGTGATGGGAGAAGGTAGTGG - Intronic
969939194 4:10713411-10713433 AAGATGGTGCTAGGAGGAAGGGG + Intergenic
970158297 4:13163692-13163714 AAGGTGATGGTATTAGGAGGTGG + Intergenic
970974004 4:22022103-22022125 AATATGATGGTATTAGGAAGTGG + Intergenic
971103767 4:23498828-23498850 AAGGTGATGGTATTAGAAAGTGG - Intergenic
971504068 4:27347526-27347548 AAGGCGATGGTAGTAGGAAGTGG - Intergenic
971670052 4:29544862-29544884 AAGGTGATGGTATTAAGAAGTGG + Intergenic
971743260 4:30546933-30546955 AAGGTGATGGTATCAGGAAATGG + Intergenic
972102399 4:35438109-35438131 AAGGTGATGGTATTAGGAGGGGG - Intergenic
972142324 4:35976203-35976225 AAGATGATGGTATTAGGAGGTGG - Intronic
972166011 4:36284942-36284964 AAGGTGATGGTATTAGGAGGTGG - Intronic
972496021 4:39635535-39635557 AAGCTGATGGCAGTAGGGATGGG + Intronic
973836860 4:54818509-54818531 AAGCTGACAGTGGGAGAAAGTGG + Intergenic
973855041 4:55002809-55002831 AAGCTGATGGTAATAGGAGGTGG + Intergenic
973955685 4:56060716-56060738 AAGGTGATGGTATTAGGAAGTGG + Intergenic
974031738 4:56782507-56782529 AAGGTGATGGTAGTAGGAGGTGG - Intergenic
974087638 4:57278458-57278480 AAGCTGAGGGTAGGAGATTGTGG - Intergenic
974304617 4:60117625-60117647 AAGGTGATGGTAGTAGGAAGTGG - Intergenic
974511515 4:62848227-62848249 AAGGTGATGGTATTAGAAAGTGG - Intergenic
974542534 4:63256713-63256735 AAGGTGATGGTGTTAGGAAGTGG + Intergenic
975653801 4:76620895-76620917 AAGCAGATGAAAGGATGAAGGGG + Intronic
975923803 4:79424550-79424572 AAGGTGATGATAGCAGAAAGTGG - Intergenic
976067647 4:81207329-81207351 GATGTGATGGTAGGAGGAAAAGG + Intronic
976586609 4:86804350-86804372 AAGCAGATGGTTTGAGGAAGAGG - Intronic
976606539 4:86988644-86988666 AAGCTGATGGTAGCTTGATGGGG - Intronic
976695271 4:87912631-87912653 GATCCGATGGAAGGAGGAAGGGG - Intergenic
977075820 4:92447853-92447875 AAGGTGATGGTATTAGGAGGTGG - Intronic
977189487 4:93981754-93981776 AAGCAGATGGGAGGAGAAAGAGG - Intergenic
977364736 4:96053850-96053872 AAGCTGATGGTGAGAGGAGAGGG - Intergenic
977366572 4:96076444-96076466 AAGGTGATGGTATTAGGAAGTGG + Intergenic
977377747 4:96228680-96228702 AATGTGATGGTATCAGGAAGTGG - Intergenic
977421291 4:96803211-96803233 AAGGTGATGGTATTTGGAAGTGG + Intergenic
977509415 4:97943222-97943244 AAGGTGATGGTATTAGGAGGTGG - Intronic
977996227 4:103499989-103500011 AATATGATGGTATCAGGAAGTGG + Intergenic
978373705 4:108053454-108053476 AAGCTGGAGGTGGGAGGAAAGGG + Intronic
978376568 4:108080697-108080719 TAGCTGATTGTGGGAGGAGGTGG - Intronic
978473982 4:109105047-109105069 ATCCTGGTGGTAGGGGGAAGTGG + Intronic
979116972 4:116836980-116837002 AAGGTGATGGTAGTAGGAGTTGG + Intergenic
980731972 4:136835485-136835507 AAAGTGATGGTAGTAGGAGGTGG + Intergenic
980856290 4:138444412-138444434 AAGTAGATCTTAGGAGGAAGGGG + Intergenic
981001061 4:139829450-139829472 CAGCGGATGTTATGAGGAAGGGG + Intronic
981023078 4:140049225-140049247 AGGGAGATGGTAGGAGGAAGAGG - Intronic
981321192 4:143393943-143393965 AAGATAATGTTAGAAGGAAGGGG + Intronic
981373116 4:143983396-143983418 AATCTAATGGGAGGAGGGAGAGG + Intergenic
981382210 4:144086670-144086692 AATCTAATGGGAGGAGGGAGAGG + Intergenic
981498743 4:145423427-145423449 AAGGTGATGGTAGTAAGAGGTGG + Intergenic
981542426 4:145859734-145859756 AACCAGATGGCAGGGGGAAGAGG + Intronic
981917564 4:150051569-150051591 AAGGTGATGGTATTAGGAGGTGG + Intergenic
982069342 4:151681938-151681960 AAGGTGATGGTGTGAGGAAATGG - Intronic
982428710 4:155297724-155297746 ATGGTGAGAGTAGGAGGAAGTGG + Intergenic
982647579 4:158043743-158043765 AAACTGAGGATAGGAGGAGGTGG - Intergenic
983021456 4:162681116-162681138 CAGGTGATAGTATGAGGAAGTGG - Intergenic
983083948 4:163420902-163420924 CAGAGGATGGGAGGAGGAAGAGG - Intergenic
983118733 4:163852850-163852872 AAGGTGATGGTATTAGGAGGTGG + Intronic
983366890 4:166802626-166802648 AAGCCGATGGTACCAGGAGGTGG - Intronic
983800119 4:171917598-171917620 AAGCTGTTTGTTGGTGGAAGTGG - Intronic
984435969 4:179710497-179710519 AAGGTGATGGTATTAGAAAGTGG - Intergenic
985150529 4:186942778-186942800 AAGGTGATGGTATTAGGAGGTGG + Intergenic
986001707 5:3635565-3635587 AAGGTGATGATATGAGGAGGTGG + Intergenic
986844194 5:11733930-11733952 AAGGTGATGGTACTAGGAGGAGG + Intronic
986865343 5:11980459-11980481 AAGGTGATGATATCAGGAAGTGG + Intergenic
987204804 5:15614040-15614062 AAGGTGATGGTATAAGGAGGTGG - Intronic
987372252 5:17203947-17203969 GAGCTGAATGTTGGAGGAAGAGG - Intronic
987659756 5:20856488-20856510 AAGGTGATGGTAGCTGGACGTGG - Intergenic
987868731 5:23582651-23582673 AAGAGGATGCTAGTAGGAAGTGG + Intergenic
988497886 5:31760053-31760075 AAGCAGATGGGAGGAGGAGTGGG + Intronic
988739864 5:34059651-34059673 AAGCTGATGGTGTTAGCAAGAGG - Intronic
990177802 5:53127069-53127091 CTGATGATGGTAGGAAGAAGAGG + Intergenic
991259865 5:64655408-64655430 AAGGTGATGGTATTAAGAAGTGG - Intergenic
991293894 5:65060948-65060970 CAGCTGATGGGAGCAGGGAGAGG + Intergenic
991559440 5:67933967-67933989 AAGGTGATGGTATTAGGAGGTGG + Intergenic
991953730 5:71971833-71971855 AAGGTGATGGTATTAGGAGGTGG - Intergenic
992157949 5:73973182-73973204 AAGGTGATGGTATTAGGAGGTGG - Intergenic
992526380 5:77614915-77614937 AAGTACATGGCAGGAGGAAGAGG + Intronic
992546414 5:77818102-77818124 TAGCTGAGGCTGGGAGGAAGAGG - Intronic
993587922 5:89755353-89755375 AAGATGATGGTAATAGAAAGTGG + Intergenic
993974402 5:94458976-94458998 AAGCTGAGGGGAGGAGGGAATGG - Intronic
994090453 5:95805375-95805397 AAGGTGATGGTATTAGGAAGTGG - Intronic
994090928 5:95808949-95808971 GAGCTGAAGGTAGGAGAGAGAGG - Intronic
994280337 5:97894130-97894152 AAGTTGATGGTATTAGAAAGTGG - Intergenic
995103290 5:108342931-108342953 AAGATGATAGTATTAGGAAGTGG + Intronic
995437398 5:112152423-112152445 AAGGTGATGGTATCAAGAAGTGG + Intronic
995487234 5:112651592-112651614 AAGCAGGTGGCAGGAGAAAGAGG - Intergenic
995687397 5:114785421-114785443 AAGCTCAGGGTCTGAGGAAGTGG - Intergenic
995716632 5:115087160-115087182 AAGTTGATGGTATTAGGAGGTGG + Intergenic
995732574 5:115262214-115262236 AATCTAATGGTAGGCGAAAGAGG - Intronic
996240928 5:121200450-121200472 AAGGTGATGGTATGAGGAGGTGG - Intergenic
996752216 5:126900340-126900362 AAGGTGATGGTATTAGGAAGTGG + Intronic
997385781 5:133471406-133471428 AAGGTGATGGTATTAGGATGTGG + Intronic
997411554 5:133694928-133694950 AAGCTGATGGTATTAGGAAGTGG - Intergenic
997418207 5:133745424-133745446 AAGCTGCTGGTGGGGGGTAGAGG + Intergenic
997589232 5:135062794-135062816 AAGCTGCAGCTAGGAGGAGGGGG - Intronic
997828088 5:137125446-137125468 AAGATGATGGTATTAGGAGGTGG + Intronic
998007394 5:138666051-138666073 TAGCTGATGGGATGAGAAAGAGG - Intronic
998139812 5:139693364-139693386 AGGCTGCTGGTGGGAGGGAGGGG + Intergenic
998195469 5:140065967-140065989 AAGGTGATGGTATTAGGAGGTGG + Intergenic
998227184 5:140336108-140336130 AGGCTGAGGGTATGAGGAATGGG - Intronic
999075267 5:148789611-148789633 AAGCTGAAGGGACGAGGAGGTGG + Intergenic
999622891 5:153490447-153490469 AAGGTGAGGATGGGAGGAAGGGG + Intronic
999662307 5:153878281-153878303 CAGCTGATGGCAGGATGAGGAGG - Intergenic
999725164 5:154430918-154430940 CGCCTGAGGGTAGGAGGAAGAGG + Intergenic
999962712 5:156774516-156774538 AATGTGGTGGTAGTAGGAAGTGG - Intergenic
1000050369 5:157557838-157557860 AAGGTGATGGTATTAGGAGGTGG - Intronic
1000096297 5:157973728-157973750 AAGCAGATGTTAGGAAGAATTGG + Intergenic
1000129719 5:158284631-158284653 AAGGTCATGGTAGGAGAAATAGG - Intergenic
1000405946 5:160888595-160888617 AAGCAGAGGGGAGGAGGCAGAGG + Intergenic
1000500794 5:162047136-162047158 AATGTGATGGTATTAGGAAGTGG - Intergenic
1000524455 5:162339206-162339228 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1001014184 5:168125856-168125878 CAGATGATGGGAGGAGGCAGGGG + Intronic
1001291597 5:170466815-170466837 AAGGTGATGGTACTAGGAGGTGG - Intronic
1001414987 5:171539426-171539448 AGGCTGCTGGAAGAAGGAAGGGG - Intergenic
1001552643 5:172615268-172615290 AGGCTGAGGGATGGAGGAAGTGG + Intergenic
1002196101 5:177502406-177502428 AAGCTGCTGGTAGGATGAATGGG + Intronic
1002365930 5:178710866-178710888 AAGGTGATGGTATCATGAAGTGG - Intergenic
1002485625 5:179534046-179534068 GGGCTGAGGGGAGGAGGAAGTGG + Intergenic
1003191322 6:3877843-3877865 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1003306303 6:4932441-4932463 AAGGTGATGGTCTGAGGAGGTGG - Intronic
1003356654 6:5379534-5379556 CAGCTGCGGGAAGGAGGAAGGGG - Intronic
1003389891 6:5704369-5704391 AAGATGATGGTCTGAGGAGGTGG - Intronic
1003491737 6:6628262-6628284 AAGGGGAGGGAAGGAGGAAGGGG - Intronic
1003613005 6:7630225-7630247 AAGGTGATGGCATGAGGAGGTGG + Intergenic
1003636030 6:7832292-7832314 AAGGTGATGGTATTAGGAGGTGG + Intronic
1003687633 6:8320283-8320305 AAGATGATGGCATGAGGAGGTGG - Intergenic
1003914309 6:10771285-10771307 AGGTGGATGGTAGGAGGAACAGG + Intronic
1004169761 6:13286850-13286872 AGGCTGATGGCAGGAGGTGGAGG + Intronic
1004536214 6:16504961-16504983 GAGCTGATTGCAGGAGGAGGAGG - Intronic
1004826336 6:19425436-19425458 AATATGATGGTATTAGGAAGGGG - Intergenic
1004982571 6:21042540-21042562 CAGGTGGTGGTAGAAGGAAGTGG - Intronic
1005166612 6:22929385-22929407 AGGCTGGGGGAAGGAGGAAGTGG - Intergenic
1005518620 6:26578279-26578301 AGGATGATGGGAGGAGGATGAGG - Intergenic
1005914408 6:30340205-30340227 AACAAGATGGCAGGAGGAAGGGG + Intronic
1006101264 6:31687708-31687730 TAGCCGATGGGAGGTGGAAGAGG - Exonic
1006367343 6:33623151-33623173 AAGCTGAGGGAAGGAGGAGAGGG + Intronic
1007239659 6:40415953-40415975 AATCTGAAGGTTGGAGGTAGAGG + Intronic
1007610769 6:43147396-43147418 AACCTGAGGGAAGGAAGAAGGGG - Intronic
1007952544 6:45885149-45885171 AATGTGATGGTATTAGGAAGTGG + Intergenic
1008246910 6:49187414-49187436 AAGCTGAAGATAGGAGGATGAGG - Intergenic
1008462633 6:51793501-51793523 CAGGTGGTGGGAGGAGGAAGAGG - Intronic
1009845157 6:69125399-69125421 AAGCTGAGAGTATGAGGAGGTGG + Intronic
1009902297 6:69822224-69822246 AAGCTGATGGTATCAGGAGGTGG + Intergenic
1010026783 6:71227904-71227926 ATGTTGATGGTAGGAACAAGAGG - Intergenic
1010466632 6:76174860-76174882 AGGCAGATGGAAAGAGGAAGTGG + Intergenic
1011276786 6:85639717-85639739 AAACTGAGGCTAGGAGGAGGAGG - Intronic
1011436348 6:87341964-87341986 AAGCTGATGTTTGGTGGCAGAGG + Exonic
1011749102 6:90437613-90437635 AAGCTGGTGGGAGGAGGGAATGG - Intergenic
1012398455 6:98825312-98825334 AAGGTGAGGCTAGGAGGAAGGGG + Intergenic
1013535125 6:111056944-111056966 AAGGTGATGGTAGGGCGATGGGG + Intergenic
1013805257 6:113989530-113989552 AAGGTGATGGTATCAGGAGGTGG - Intronic
1013961670 6:115908434-115908456 AGGCTGTTGGTAAAAGGAAGAGG + Intergenic
1014412724 6:121146963-121146985 AGGGTGATGGAGGGAGGAAGGGG - Intronic
1014767815 6:125427192-125427214 AAGCTGATGGCAAAAGGATGAGG + Intergenic
1015307452 6:131725527-131725549 AAGGTGATGGTATTAGGAGGTGG - Intronic
1015613344 6:135049362-135049384 AAGGTGATGGTATTAGGAGGTGG - Intronic
1015656535 6:135525039-135525061 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1015975577 6:138787195-138787217 AAGGTGATGGTAGGAGGAGATGG + Intronic
1016019412 6:139220044-139220066 AAACTGATGGTATTAGGAAGTGG + Intergenic
1016026674 6:139294466-139294488 CAGGTGATGGTATGAGGAGGTGG + Intergenic
1016439804 6:144071272-144071294 AAAGTGATGGTATTAGGAAGTGG + Intergenic
1017087298 6:150725291-150725313 AAGGTGATGGTATTAGGAGGGGG - Intronic
1017223396 6:151992316-151992338 AGGCTGAGGGCAGGAGGAAATGG - Intronic
1017287628 6:152695066-152695088 AAGGTGATGGTAGGAAGAGGTGG + Intergenic
1017370927 6:153707560-153707582 AGGGTGAAGGGAGGAGGAAGAGG - Intergenic
1017515350 6:155151468-155151490 TAGGTGATGGTATTAGGAAGTGG - Intronic
1017863565 6:158422596-158422618 AAGCGGAAGGCAGAAGGAAGAGG + Intronic
1018041840 6:159931413-159931435 AGGCTGGAGGGAGGAGGAAGTGG + Intergenic
1018154017 6:160968866-160968888 TAGGTGATGGTATGAGGAGGTGG + Intergenic
1018347734 6:162920134-162920156 GAGCTAATGGGAGGAGGAAAGGG + Intronic
1018494421 6:164335230-164335252 AAGGTGATGGTATTAGGAAGCGG + Intergenic
1018689958 6:166336926-166336948 AATGTGATGGTATGAGGAGGAGG - Intronic
1018856863 6:167681118-167681140 AAGGTGCTGGTATTAGGAAGCGG + Intergenic
1018913561 6:168118656-168118678 AAGGGGATGGTATTAGGAAGTGG + Intergenic
1018996707 6:168715734-168715756 AGGATGATGGGAGGAGGAGGAGG + Intergenic
1019739644 7:2666215-2666237 CTGCTGGTGGCAGGAGGAAGGGG - Intergenic
1020622783 7:10537928-10537950 AAGCTGATGGTCAGAATAAGTGG + Intergenic
1020684221 7:11273497-11273519 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1020981048 7:15069586-15069608 AAAGTGATGGTATTAGGAAGTGG - Intergenic
1021464627 7:20928256-20928278 AAGCTGATGGAAGCAGAAAAAGG + Intergenic
1021823174 7:24518375-24518397 AATGTAATGGTAGGATGAAGAGG - Intergenic
1021952204 7:25785987-25786009 AAGATGATGGTATTAGGAGGTGG + Intergenic
1022216431 7:28267198-28267220 AAGCTGAGGGGAGGAGGAATGGG - Intergenic
1022407211 7:30101596-30101618 AAGGTGATGGTATCAGGAGGTGG - Intronic
1022840663 7:34161039-34161061 AAGCTGAAGGTTGGAGGAAGAGG - Intergenic
1022849430 7:34245027-34245049 AGGCTGATAGGAGGAAGAAGAGG - Intergenic
1023026341 7:36053859-36053881 AAGAAGAATGTAGGAGGAAGAGG - Intergenic
1023313804 7:38914918-38914940 AGGCTGATGGTAAGAGGAAAGGG + Intronic
1023883785 7:44336263-44336285 AAGGAGATGGTTTGAGGAAGGGG + Intergenic
1024250729 7:47503980-47504002 AAGGTGATGGTAGCTGGAAATGG - Intronic
1024259026 7:47560155-47560177 AAGGTGATGGTATGAGGAGCTGG + Intronic
1024391913 7:48823624-48823646 AAGGTGATGGTATTAGGATGTGG - Intergenic
1024425961 7:49226871-49226893 GAAGTGATGGTATGAGGAAGTGG + Intergenic
1024451034 7:49543101-49543123 AATGTGATGGTATTAGGAAGTGG + Intergenic
1024522777 7:50321149-50321171 AGACTGATGGTAGAAGGAAGGGG + Intronic
1024760837 7:52594597-52594619 AAGATGATGATATTAGGAAGTGG + Intergenic
1025927063 7:65968668-65968690 CACCTGATGGTGGGAGGCAGAGG - Intronic
1026108628 7:67440566-67440588 AAGATGATGGTATTAGGAGGTGG + Intergenic
1026277707 7:68894658-68894680 AAGGTGATGGTGTTAGGAAGTGG + Intergenic
1026425054 7:70282602-70282624 AAGGTGATGGTATTAGGAGGTGG - Intronic
1027375412 7:77543285-77543307 AAGTAGATGGTAGGAGCTAGAGG + Intronic
1027438464 7:78192813-78192835 GAGCTGATGAAAGCAGGAAGGGG + Intronic
1027679173 7:81197613-81197635 CAGCTGAGGGGAGGAGGCAGGGG + Intronic
1029054720 7:97730150-97730172 AAGGTTATGGTATTAGGAAGTGG + Intergenic
1030265443 7:107616165-107616187 AGACTGAAGGCAGGAGGAAGGGG + Intronic
1031051369 7:116949490-116949512 AAGTGGATGGAAGGAGGCAGTGG + Intergenic
1031516988 7:122712926-122712948 AAGGTGATGGTATTAGGAGGTGG - Intronic
1031681040 7:124675094-124675116 AAGCTGATGGTATTAGTAGGTGG + Intergenic
1031738345 7:125395999-125396021 AGGCAGAGGGTGGGAGGAAGGGG + Intergenic
1032696206 7:134338651-134338673 AAGGTGATGGTAATAGGAAGTGG - Intergenic
1032881333 7:136093556-136093578 AATTTGATGGTATTAGGAAGTGG - Intergenic
1033018683 7:137699257-137699279 AAGGTGATGGTATCAGGAAGTGG - Intronic
1033209041 7:139446729-139446751 AAGCCGATGGTCGGAGGAGGCGG - Intergenic
1033639272 7:143245641-143245663 AAGGTGATGGTATTAGGAAGTGG + Intronic
1033730622 7:144175448-144175470 AATGCGATAGTAGGAGGAAGTGG + Intergenic
1033876364 7:145823389-145823411 AAAGTGATGGTATTAGGAAGTGG - Intergenic
1034089736 7:148352693-148352715 AAACTGATGGTAGGAGTATGGGG + Intronic
1034227660 7:149496413-149496435 GAGCTGATGGTAAGAGGAGCCGG + Intronic
1034232042 7:149537998-149538020 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1034462114 7:151203726-151203748 AGGCTCATGGTAGGTGGCAGTGG + Intronic
1034752738 7:153586340-153586362 CAGCCTATGGTAGGAGGCAGGGG - Intergenic
1036129466 8:6095506-6095528 AAGGAGATGGAAGGAGGAGGTGG - Intergenic
1036149020 8:6280956-6280978 CAGGTGATGGTAGTAAGAAGAGG - Intergenic
1036621927 8:10429819-10429841 AAGTGGGTGGTGGGAGGAAGGGG + Intergenic
1037659586 8:20915369-20915391 AAGTTGATGAGAGGAGGAGGGGG + Intergenic
1038127453 8:24690616-24690638 AAGGTGATGGTAGGAAGGTGGGG + Intergenic
1038154283 8:24973106-24973128 AAGGTGATGGTATTAGGAAGGGG - Intergenic
1038220871 8:25606345-25606367 AAGCTAATGATAGGAGCAAAGGG - Intergenic
1038483740 8:27919163-27919185 AAGGGGATGGGAAGAGGAAGAGG + Intronic
1039093995 8:33863784-33863806 AAGATGATGGTATTAGGAGGTGG + Intergenic
1039464063 8:37770893-37770915 AAGGTGATGGGAGGAGGGAGCGG + Intronic
1039755752 8:40520060-40520082 ATGGAGATGGTCGGAGGAAGGGG - Intergenic
1040389224 8:46935339-46935361 AAAGTGATGGTATTAGGAAGTGG + Intergenic
1040645918 8:49396475-49396497 AAGCTAATGGAAGGATGCAGGGG - Intergenic
1040659548 8:49554832-49554854 AAGGTGATGATCTGAGGAAGTGG - Intergenic
1040825189 8:51612561-51612583 AAGGTGATGGTATTGGGAAGTGG + Intronic
1041036772 8:53799694-53799716 AAGGTGATGGTATTAGGAGGTGG + Intronic
1041149857 8:54920163-54920185 AAGGTGATGGTATGAGAAGGTGG + Intergenic
1041316662 8:56570513-56570535 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1041487603 8:58396235-58396257 AAGGTGATGGTATTGGGAAGCGG + Intergenic
1041700470 8:60783542-60783564 AAGCTTTTGGTAGGAAGAAAAGG + Intronic
1041733073 8:61082585-61082607 AAGCTGGTGGTAGGAGGGTGGGG + Intronic
1041748064 8:61231005-61231027 AAGGTGATGGTATTAGGAGGTGG - Intronic
1041873736 8:62664114-62664136 AAGCTTCTGCTAGGAGAAAGGGG - Intronic
1041954439 8:63542050-63542072 AAGAGGAAGGCAGGAGGAAGGGG - Intergenic
1042114324 8:65414632-65414654 AAGGTGATGGTATGTGGAGGTGG - Intergenic
1042190279 8:66178820-66178842 CAGCGAATGGGAGGAGGAAGGGG + Intergenic
1042221316 8:66477533-66477555 AATGTGATGGTATTAGGAAGTGG + Intronic
1042378856 8:68089123-68089145 CAGCTGAGGGTGGGAGGCAGGGG - Intronic
1043256292 8:78141900-78141922 AAGAAGATGGGAGGAGGAGGAGG - Intergenic
1043371915 8:79604620-79604642 AAGGTGATGGTACTAGGAGGTGG - Intergenic
1043556842 8:81439864-81439886 AAGTTGATGGTATTAGGAGGTGG + Intergenic
1044124718 8:88444094-88444116 AAGCTGATGGTATTAAGAGGTGG + Intergenic
1044438283 8:92191252-92191274 AAGAGGATGGGAGCAGGAAGAGG + Intergenic
1044548131 8:93482228-93482250 AAGATGATGGTAGTAAGAGGTGG + Intergenic
1044579760 8:93813131-93813153 AAGAGGAAGATAGGAGGAAGAGG - Intronic
1044738595 8:95303327-95303349 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1044738600 8:95303358-95303380 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1044864892 8:96561370-96561392 AAGCTGAGGGGAGGAAGAACAGG + Intronic
1044926289 8:97211548-97211570 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1045087943 8:98707771-98707793 AAGCTTATTGTGGGAAGAAGAGG - Intronic
1045530224 8:102977594-102977616 AATCTGAGCGTAGGAAGAAGTGG + Intronic
1045910441 8:107401063-107401085 AAGCTGATTGTAGGAGCACCAGG - Intronic
1045988717 8:108281027-108281049 AATCTGTCAGTAGGAGGAAGAGG + Intronic
1046792738 8:118339441-118339463 ATGGGGATGGTAGGTGGAAGGGG + Intronic
1047051207 8:121115571-121115593 AAGGTGGTGGTAGTAGGAGGTGG + Intergenic
1047438449 8:124855418-124855440 AAGCTGAGGGACGGAGGGAGAGG + Intergenic
1047441057 8:124879151-124879173 AATGTGATGGTATGAGGAGGTGG - Intergenic
1047463831 8:125093289-125093311 AAGGTGATGGTATTAGGAGGTGG - Intronic
1047846190 8:128807974-128807996 AAGGTGATGGTAAGAGGAGGTGG + Intergenic
1048049160 8:130801009-130801031 AAGGTGATGGTATTAGGAGGTGG - Intronic
1048448790 8:134513093-134513115 CAGCTGATGGTGGAAGGGAGAGG + Intronic
1048698735 8:137059691-137059713 AAGCTTATGGTTGGAGGTAAGGG - Intergenic
1048823238 8:138398621-138398643 AAGCTGCATGTGGGAGGAAGTGG + Intronic
1049250169 8:141583993-141584015 AAGGTGATGGTATGAGGCGGTGG + Intergenic
1050103955 9:2146285-2146307 AAGGTGATGGTATTAGGAGGTGG - Intronic
1050175334 9:2864191-2864213 CAGAGGATGGGAGGAGGAAGAGG + Intergenic
1050259258 9:3823960-3823982 AAGCTGACAGTTGGAGGAGGGGG - Intergenic
1050266063 9:3891086-3891108 AAGAAGAAAGTAGGAGGAAGAGG + Intronic
1050272278 9:3959109-3959131 AAGGTGATGGTATCAGGAAGTGG + Intronic
1050606323 9:7305040-7305062 TACTTGAGGGTAGGAGGAAGAGG - Intergenic
1050628784 9:7536983-7537005 AAGGTGGTGGTAGGAGTGAGGGG - Intergenic
1050796780 9:9556292-9556314 AAGTTGAAGAAAGGAGGAAGAGG + Intronic
1050816222 9:9815733-9815755 TAGCGGATGGAAGGAGGTAGGGG + Intronic
1051168789 9:14296493-14296515 AATCTGATGGTATTAGGAGGTGG + Intronic
1051222102 9:14859685-14859707 AAGATGTTGGGAGGAAGAAGTGG - Intronic
1051284486 9:15482370-15482392 CAGCTGTTGGTGGGAGGAGGAGG - Intronic
1051722103 9:20047777-20047799 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1052252252 9:26412152-26412174 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1052341688 9:27370128-27370150 AGGCTGATGGTACTAGGAGGTGG + Intronic
1053199086 9:36140608-36140630 AGGCTGATGCTTGGGGGAAGGGG + Intronic
1053570646 9:39301953-39301975 ATGCTTCTGGCAGGAGGAAGGGG + Intergenic
1053836596 9:42142870-42142892 ATGCTTCTGGCAGGAGGAAGGGG + Intergenic
1054092268 9:60860970-60860992 ATGCTTCTGGCAGGAGGAAGGGG + Intergenic
1054113681 9:61136563-61136585 ATGCTTCTGGCAGGAGGAAGGGG + Intergenic
1054126499 9:61317059-61317081 ATGCTTCTGGCAGGAGGAAGGGG - Intergenic
1054594013 9:67045624-67045646 ATGCTTCTGGCAGGAGGAAGGGG - Intergenic
1054865433 9:69995727-69995749 AAGGTGATGGTATGAGGAGATGG + Intergenic
1055702950 9:78966156-78966178 AAGATGATGGTAATAGGAGGTGG + Intergenic
1055723737 9:79204792-79204814 AAGGTGACGGTATGAGGAAGTGG + Intergenic
1055754417 9:79542692-79542714 AAGCAAATGGAAGGAGGAATTGG - Intergenic
1055768835 9:79694151-79694173 AAGCGAATGGAAGGAGAAAGAGG + Intronic
1056094705 9:83241071-83241093 AATCTTATGGCAGGAAGAAGAGG + Intergenic
1056219301 9:84435602-84435624 AAGGTGATGGTATTAGGCAGTGG - Intergenic
1056330181 9:85514546-85514568 AGGCTGATGGGAGCAGGCAGGGG - Intergenic
1056335306 9:85562863-85562885 AAGGTGATGGTATTAGGAGGCGG + Intronic
1056418864 9:86404155-86404177 AAGGTGATGGTATCAGGAGGTGG + Intergenic
1056693337 9:88826369-88826391 AAGGGGATGGTATTAGGAAGTGG + Intergenic
1056980579 9:91307073-91307095 AAGTTGAGGGTAGCAGGGAGGGG + Intronic
1057146483 9:92762813-92762835 ATGCACTTGGTAGGAGGAAGAGG + Intronic
1057945656 9:99325885-99325907 AAGGCGATGGTATTAGGAAGGGG - Intergenic
1057957358 9:99421852-99421874 AAGGTGATGGTATTAGGAAGTGG + Intergenic
1058634754 9:107025732-107025754 AAGCGGATGATAGGATCAAGTGG - Intergenic
1058735559 9:107890871-107890893 AAGGTGATGGTATTTGGAAGTGG - Intergenic
1059392158 9:114006067-114006089 AAGCTGGTGGTGGGAGGGAGAGG + Intronic
1059417091 9:114168879-114168901 GAGCTGGTGGTAGGAGGTAGGGG - Exonic
1059465170 9:114464564-114464586 AAGCTGATAGTATTAGGAGGTGG - Intronic
1059519118 9:114923256-114923278 AAGATGGTGGCAGGAGGAGGAGG - Intronic
1059933999 9:119289491-119289513 AAGCTGATGGCATGAGTTAGAGG + Intronic
1060027353 9:120184496-120184518 AAGGTGATTGTGGGAGGATGCGG - Intergenic
1060091837 9:120749823-120749845 AAGGTGATGGTATTAGGACGTGG - Intergenic
1060711723 9:125872404-125872426 AAGTTGATGGTAAGATGATGGGG + Intronic
1060832738 9:126727874-126727896 AAGGTGGTGGGAGGAGAAAGAGG - Intergenic
1061152902 9:128838901-128838923 AAGCTGCTGGGAGGATCAAGTGG - Intronic
1061362570 9:130153032-130153054 AAGATGATGGTATGAGGAGGTGG - Intergenic
1061466833 9:130787202-130787224 AGGCTCATGGTAAGAGGATGGGG + Intronic
1185689458 X:2141444-2141466 AAGAAGATGGGAGGAGGGAGAGG + Intergenic
1185885660 X:3780344-3780366 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1186146235 X:6627045-6627067 AAAATGATGGTAGTAGAAAGTGG - Intergenic
1186173048 X:6897826-6897848 AAGGTGATAGTATCAGGAAGTGG - Intergenic
1186302587 X:8216767-8216789 ATGCTGAGGGGAGGAGGAGGAGG - Intergenic
1186468829 X:9805433-9805455 AAGGTGATGGTATTAGGAGGTGG + Intronic
1186610241 X:11131693-11131715 AAGGTGATGGTATTAGGACGTGG - Intergenic
1188057947 X:25563404-25563426 ATGGTGATGGGAGGAGCAAGGGG + Intergenic
1188481224 X:30638790-30638812 AAACTGATGGTAGAAGGAAGAGG - Intergenic
1188714593 X:33446415-33446437 AAGCTGATGGTATTAGGTCGTGG + Intergenic
1189170202 X:38901706-38901728 AAGGTGATGGCATTAGGAAGTGG + Intergenic
1189236235 X:39489444-39489466 AAGCTGATGATGGAGGGAAGTGG - Intergenic
1189381309 X:40504372-40504394 AACCTGATGTCAGGATGAAGTGG - Intergenic
1189489254 X:41456925-41456947 AAGATGATGGTATTAGGAGGTGG + Intronic
1191845592 X:65545242-65545264 AAGGTGGTAGGAGGAGGAAGAGG + Intergenic
1191937406 X:66440275-66440297 CAGGGGATGGAAGGAGGAAGAGG - Intergenic
1192101869 X:68273057-68273079 AATCTGATGATAGCAGGTAGTGG + Intronic
1192434091 X:71131996-71132018 AAGCAGATGGTAGGAGAGATCGG - Intronic
1193037532 X:76968842-76968864 ATGTGTATGGTAGGAGGAAGGGG - Intergenic
1194005893 X:88491428-88491450 AAATTGATGGTATTAGGAAGTGG - Intergenic
1194314422 X:92357450-92357472 AAGGTGATAGTATTAGGAAGTGG + Intronic
1194598322 X:95887884-95887906 AACCTGATGGGAGGAGGGAGAGG - Intergenic
1194690251 X:96975878-96975900 AAGGTGATGGTATCAGGAGGTGG - Intronic
1194796910 X:98223228-98223250 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1195079639 X:101358714-101358736 AAGCTGTCTGTAGGAGGAAGTGG + Intronic
1195651992 X:107294629-107294651 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1195920586 X:109979413-109979435 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1196354548 X:114775170-114775192 AAGCTGAAGATAAGAGGCAGAGG - Intronic
1196407579 X:115380806-115380828 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1196465639 X:115969131-115969153 AAGCTGAAGGTCAGAGGAAGGGG + Intergenic
1197168697 X:123407636-123407658 AAGGTGATGGTATTAGGAAGTGG - Intronic
1197373650 X:125655900-125655922 AAGCAGAAGGTAGGGAGAAGGGG - Intergenic
1198098498 X:133403474-133403496 AAGGTGATGGTATTAGGAGGTGG - Intronic
1198170595 X:134101669-134101691 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1198174588 X:134142901-134142923 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1198463956 X:136888228-136888250 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1198793440 X:140370701-140370723 AATGTGATGGTATGAGGAAGTGG + Intergenic
1198802469 X:140461594-140461616 AAGATGATGGTATTAGGAAGTGG + Intergenic
1199065111 X:143407064-143407086 AATCTGGTGGGAGGAGAAAGGGG - Intergenic
1199211399 X:145215696-145215718 AAGGTGATGGTATTAGGAGGTGG + Intergenic
1199407082 X:147474789-147474811 AAGATGATGGTATTAGGAGGTGG - Intergenic
1199550857 X:149059972-149059994 AAGGTGATGGTATTAGGAAGTGG - Intergenic
1199652491 X:149960317-149960339 AAGGTGATGGTATTAGGAAATGG - Intergenic
1200180882 X:154150086-154150108 AAGGTGATGGTATTAGGAGGTGG - Intronic
1200186525 X:154187200-154187222 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1200192177 X:154224338-154224360 AAGGTGATGGTATTAGGAGGTGG - Intronic
1200197932 X:154262142-154262164 AAGGTGATGGTATTAGGAGGTGG - Intronic
1200326020 X:155240128-155240150 AAGGTGATGGTATTAGGAGGTGG - Intergenic
1200622480 Y:5468980-5469002 AAGGTGATAGTATTAGGAAGTGG + Intronic
1201567365 Y:15380393-15380415 GAGCTGAGGGTAGGGGGAAATGG + Intergenic