ID: 1069764293

View in Genome Browser
Species Human (GRCh38)
Location 10:70841633-70841655
Sequence ACCCTCAAGCTGATGGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 1, 2: 8, 3: 56, 4: 402}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069764293_1069764299 5 Left 1069764293 10:70841633-70841655 CCTCCTACCATCAGCTTGAGGGT 0: 1
1: 1
2: 8
3: 56
4: 402
Right 1069764299 10:70841661-70841683 TTCAACATATGAATTTTTGGGGG 0: 28
1: 372
2: 1349
3: 2634
4: 3546
1069764293_1069764296 2 Left 1069764293 10:70841633-70841655 CCTCCTACCATCAGCTTGAGGGT 0: 1
1: 1
2: 8
3: 56
4: 402
Right 1069764296 10:70841658-70841680 GATTTCAACATATGAATTTTTGG 0: 182
1: 925
2: 2225
3: 3438
4: 4626
1069764293_1069764300 30 Left 1069764293 10:70841633-70841655 CCTCCTACCATCAGCTTGAGGGT 0: 1
1: 1
2: 8
3: 56
4: 402
Right 1069764300 10:70841686-70841708 GTAAACATTCAGTCCATTGCAGG No data
1069764293_1069764297 3 Left 1069764293 10:70841633-70841655 CCTCCTACCATCAGCTTGAGGGT 0: 1
1: 1
2: 8
3: 56
4: 402
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764293_1069764298 4 Left 1069764293 10:70841633-70841655 CCTCCTACCATCAGCTTGAGGGT 0: 1
1: 1
2: 8
3: 56
4: 402
Right 1069764298 10:70841660-70841682 TTTCAACATATGAATTTTTGGGG 0: 28
1: 444
2: 1606
3: 3278
4: 4796

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069764293 Original CRISPR ACCCTCAAGCTGATGGTAGG AGG (reversed) Intronic
900429965 1:2596778-2596800 ACCCTGAGGCTGAGGATAGGTGG - Intronic
900814548 1:4833378-4833400 ACCCTCAAGGTGATGGTATTAGG - Intergenic
901326954 1:8372491-8372513 ACACACGACCTGATGGTAGGTGG - Intronic
903916680 1:26769857-26769879 GCCCTGAAGCTGAGGGAAGGAGG + Intronic
904000030 1:27333666-27333688 ACCCTCAAGGTGATGGTATGAGG - Intronic
904868181 1:33599066-33599088 ACCCCCAAGGTGATGGTATTAGG - Intronic
906146665 1:43564671-43564693 ACACTCAAGCTTAGGGGAGGCGG + Intronic
906702993 1:47873197-47873219 ACCTTCAAGGTGATGGTATTAGG - Intronic
907201352 1:52729269-52729291 ACCCCCAAGGTAATGGTATGAGG - Intronic
907976336 1:59434797-59434819 ATCCTCAAGGTGATGGTATTTGG - Intronic
908000691 1:59675838-59675860 ACCCTCAATGTGATGGTATATGG + Intronic
908038421 1:60081354-60081376 ACCCCCAAGGTGATGGTATTAGG + Intergenic
908312302 1:62896959-62896981 ACCCTCATGGGGCTGGTAGGGGG - Intergenic
908612705 1:65880478-65880500 ATCCTCAAGGTGATGGTATTAGG + Intronic
908869563 1:68593497-68593519 ACCCCCAAGGTGATGGTATTCGG + Intergenic
909735820 1:78960682-78960704 ACCCCCAAGGTGATGGTATTAGG + Intronic
909757293 1:79242520-79242542 ACCCTTAAGGTGATGATATGAGG + Intergenic
910056064 1:83034154-83034176 ACCCTCAAGGTGATGGTATTTGG - Intergenic
910544395 1:88397744-88397766 ACCCCCAAGGTGATGGTATTAGG - Intergenic
910551474 1:88480411-88480433 ACCCTCAAGGTGATGGCATTAGG - Intergenic
910898314 1:92092012-92092034 ACCCTCAGTGTGATAGTAGGTGG + Intronic
911105157 1:94124052-94124074 ACCCCCAAGGTGATGGTATTAGG - Intergenic
912242236 1:107923361-107923383 ACCCTGAAGGTGATGGTATTAGG + Intronic
913425909 1:118729386-118729408 ACCCTCAAGGTAATGGTATTAGG + Intergenic
914513180 1:148352399-148352421 ACCCTCAGGAGGATGGTAAGGGG + Intergenic
915651104 1:157311574-157311596 TCCCTCAGGCTAATGGGAGGGGG - Intergenic
916376610 1:164161350-164161372 ACCCCCAAGGTGATGGTATTAGG - Intergenic
916993347 1:170268423-170268445 ACCCCCAAGGTGATGGTAGTAGG + Intergenic
917919077 1:179734685-179734707 ACCCCCAAGGTGATGGTATTTGG - Intergenic
920770941 1:208884694-208884716 ACCCTGATGTTAATGGTAGGAGG - Intergenic
922199725 1:223391855-223391877 ACCCTCAAGGTGATAGTATTAGG - Intergenic
922823778 1:228503016-228503038 ACCCCCAAGGTGATGGTATTAGG - Intergenic
923476862 1:234342193-234342215 ACCCTAAAGGTGATGGTATTTGG + Intergenic
924197185 1:241620378-241620400 ACCCTCAGAGTGATGGTATGAGG + Intronic
924562765 1:245170773-245170795 ACCCCCAAAGTGATGGTAGTAGG - Intronic
924604794 1:245523728-245523750 ACCCACAAGATGATGGTATTTGG - Intronic
1063162552 10:3429875-3429897 ACCCTGATGCTGAAGGGAGGGGG + Intergenic
1063971473 10:11384143-11384165 ACCCCCAAGGTGATGGTATTTGG - Intergenic
1065209441 10:23388752-23388774 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1065338483 10:24679433-24679455 ACCCTCAAGGTGATGGTTTTAGG - Intronic
1065857623 10:29842987-29843009 ATCCTCAAGGTGATGGTATTAGG - Intergenic
1065868946 10:29939803-29939825 AACCTCAAGGTGATGGTATTAGG + Intergenic
1067248148 10:44563580-44563602 ACCCTCAATGTGATGGTACTAGG - Intergenic
1067390619 10:45859800-45859822 ACCCTCAAGGTGATGGTATTAGG + Intergenic
1067500852 10:46804034-46804056 ACCCTCAAGGTGATGGTATTAGG - Intergenic
1067593728 10:47535885-47535907 ACCCTCAAGGTGATGGCATTAGG + Intronic
1067640838 10:48043994-48044016 ACCCTCAAGGTGATGGCATTAGG + Intergenic
1067872659 10:49976272-49976294 ACCCTCAAGGTGATGGTATTAGG - Intergenic
1068100751 10:52550015-52550037 ATCCTCAATCTGATGGTATTAGG + Intergenic
1068183514 10:53554544-53554566 ACCCCCAATCTGATGGTATTAGG + Intergenic
1068524795 10:58116202-58116224 ACCCTCAAGGTGATGGTAGGAGG - Intergenic
1068659636 10:59610940-59610962 ACCCTCAATGTGATGGTATTTGG + Intergenic
1068660080 10:59614567-59614589 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1069764293 10:70841633-70841655 ACCCTCAAGCTGATGGTAGGAGG - Intronic
1069783688 10:70974471-70974493 AGCCCGAAGCTGATGGTAAGAGG + Intergenic
1070338320 10:75474519-75474541 ACCCTCGAGATGATGGTATCAGG - Intronic
1070487182 10:76942340-76942362 ACCCTCAAGGCGATGGTATTAGG - Intronic
1070653062 10:78252024-78252046 ACCCCCAAGGTGATGGTATGGGG - Intergenic
1071009084 10:80916098-80916120 ACCCTCAATTGGATGGTATGAGG - Intergenic
1071276044 10:84056115-84056137 ACCAGCAAGCTGTTGGTAGAAGG - Intergenic
1071379564 10:85044626-85044648 ACCCTCAATTTGATGGTATTAGG - Intergenic
1071518407 10:86314346-86314368 AAACTCCAGATGATGGTAGGTGG + Intronic
1072700614 10:97638681-97638703 GCCCTCAAGCTGAAGGCATGTGG - Intronic
1074209015 10:111311163-111311185 ACCCTCAATGTGATGGTATTGGG - Intergenic
1074459881 10:113627049-113627071 ACCCTCTTGCTGATGGCATGGGG - Intronic
1074610127 10:115013986-115014008 ACCCTCAAGGTGATGGTATTGGG - Intergenic
1074962767 10:118463165-118463187 ACCCTCAAGGTGATGGCATTAGG + Intergenic
1075308418 10:121389883-121389905 ATCCTCAAGCTGATAGTAGAAGG + Intergenic
1075395905 10:122126907-122126929 ACCCCTAAGGTGATGGTATGAGG + Intronic
1075517431 10:123119850-123119872 ACCCTCAATGTGATGGTATTAGG + Intergenic
1075613595 10:123874409-123874431 ACCCACAAGGTGATGGTATTTGG - Intronic
1075657250 10:124170122-124170144 ATCCTCAAGGTGATGGTATTAGG + Intergenic
1076111198 10:127861056-127861078 ACCCTCAAGGTGATGGTATGAGG + Intergenic
1076448789 10:130540437-130540459 ACCCTCAAGATGATGATATTCGG - Intergenic
1077280318 11:1741808-1741830 ACCCCTAAAGTGATGGTAGGAGG + Intronic
1077352040 11:2097555-2097577 ACCCCCAAGCTCATGGTCTGTGG - Intergenic
1078500344 11:11867972-11867994 ACCTTGAAGCTGATGGGAGGAGG - Intronic
1079441291 11:20517492-20517514 ACCCTCAATGTGATGGTATTAGG + Intergenic
1080025028 11:27604503-27604525 ACCCCCAAGGTGATGGTATTAGG + Intergenic
1080450075 11:32371821-32371843 ACCCCCAAGGTGATGGTATTAGG + Intergenic
1080583817 11:33664526-33664548 ACCCCCAAGGTGATGGTATTAGG + Intronic
1082896873 11:58201137-58201159 ACCCTCAAACTGATGGTAGTAGG - Intergenic
1083283716 11:61644155-61644177 ACCCTCAATGTGATGGTATTGGG - Intergenic
1083354554 11:62056518-62056540 ACCCCCAAGGTGATGGTATCAGG + Intergenic
1086859723 11:91911078-91911100 ACCCCCAAGGTGATGGTATTAGG + Intergenic
1087739237 11:101868822-101868844 ACCCCCAATATGATGGTATGAGG - Intronic
1087756923 11:102064027-102064049 ACCCTCAACGTGATGGTAGTTGG - Intronic
1087934522 11:104016997-104017019 ACCCTCGAGGTGATGGTATTAGG + Intronic
1088105604 11:106203714-106203736 ACCCCCAAGATGATGGTATTGGG + Intergenic
1088840700 11:113625118-113625140 ACCCCCAAGTTGATGGTAGTAGG - Intergenic
1089639560 11:119838816-119838838 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1089880158 11:121765984-121766006 ACCATGAAGGTGAGGGTAGGGGG - Intergenic
1090027492 11:123180315-123180337 ACCCTCAAGGTGCTGGTATTTGG + Intronic
1090886422 11:130880915-130880937 ACCCTCAAGGTGATGGCAGTAGG + Intronic
1091176432 11:133562563-133562585 ACCCTGAAGGTGGGGGTAGGGGG - Intergenic
1093331889 12:17853770-17853792 ACCCTCAAGGTGATGGCATTAGG + Intergenic
1097904158 12:64903175-64903197 AACCACAAGCTGATGGAAGAGGG - Intergenic
1098228802 12:68351985-68352007 ACCCCCAAGGTGATGGTAACAGG + Intergenic
1098269405 12:68755211-68755233 ACCCGCAAGGTGATGGTATTGGG - Intronic
1099230855 12:80022926-80022948 ACCCTCAAGGTGATAGTATTAGG - Intergenic
1099792261 12:87350558-87350580 ACCCTCAACATGATGGTATTAGG - Intergenic
1100122930 12:91390113-91390135 ACCCCCAAGGTGATGGTATTCGG - Intergenic
1100252383 12:92840864-92840886 ACCCTCAAGGAGATGGTATTAGG + Intronic
1100406586 12:94277308-94277330 ACCCCCAAGGTGATGGTACTTGG - Intronic
1100567035 12:95806486-95806508 ACCCCCAAGGTGATGGTATTAGG + Intronic
1100610069 12:96184592-96184614 ACCCCCAAGGTGATGGTATTGGG + Intergenic
1100722980 12:97378336-97378358 ACCCCCAAGCTAATGGTATTTGG + Intergenic
1101158919 12:101954037-101954059 ACCCCCAAGGTGATGGTGGTGGG - Intronic
1101400686 12:104384204-104384226 ACCCCCAAGGTGATGGTATGAGG + Intergenic
1102734856 12:115150356-115150378 ACCCTCAAGGTGATGGTATGAGG - Intergenic
1102812927 12:115839909-115839931 ACCCTCAAGGTGATGGTATTAGG - Intergenic
1104327711 12:127815885-127815907 ACCCCCAAGGTGATGGTATTAGG + Intergenic
1104695716 12:130862225-130862247 ACCCTGAAGGTGATGGTATTAGG - Intergenic
1104701558 12:130908322-130908344 ACCCCCAAGATGATGGTATCAGG - Intergenic
1105012285 12:132763736-132763758 ACCCCCAAGGTGATGGTATTAGG + Intergenic
1105517641 13:21104607-21104629 ACCCTCAGTGTGATGGTAGCAGG - Intergenic
1105891958 13:24688409-24688431 TTCCTCAAGCAGATGGTGGGGGG + Exonic
1105937336 13:25114750-25114772 TCCCTCTAGCTGAGGGTGGGCGG - Intergenic
1106034702 13:26033238-26033260 ACCCTCAAGATGATATTAGGAGG + Intergenic
1107174157 13:37380382-37380404 AACCCCAAGATGATGGTAGTTGG - Intergenic
1107299566 13:38950728-38950750 ACCCCCAAGGTGATGGTATTAGG + Intergenic
1107375002 13:39794799-39794821 ACCCTAAAGCTGATAGTTAGTGG + Intergenic
1108254148 13:48594533-48594555 ACCCCCAAGGTGATGGTATTTGG + Intergenic
1109796971 13:67328153-67328175 ACCCTCAAGGTGATGGTATTAGG + Intergenic
1110461538 13:75750778-75750800 ACCCTGATGCTGATGGTCTGTGG + Intronic
1110759539 13:79216128-79216150 ACTCTCAATCTGATGGTATTAGG - Intergenic
1111450099 13:88404182-88404204 TCCCCCAAGCTGATGTTAGGTGG - Intergenic
1111802515 13:92997802-92997824 ACCTTCAATATGATGGTAGTAGG - Intergenic
1112034369 13:95483856-95483878 ACCCCCAAGGTGATGGTATTGGG + Intronic
1112243198 13:97702452-97702474 ACCCTCAAGGTGATGGTATTAGG - Intergenic
1112719743 13:102230030-102230052 ACCCCCAAGGTGATGGTATTAGG + Intronic
1113335659 13:109373606-109373628 ACCCTCAATATGATGGTATTGGG - Intergenic
1113565822 13:111319116-111319138 ACCCTCAAGATGATGGGATTAGG - Intronic
1113829025 13:113280117-113280139 ACCCCCAAGGTGATGGTATCAGG + Intergenic
1114677715 14:24455284-24455306 ACCCCCATGCTGAAGGTAGTGGG - Intergenic
1114768682 14:25404173-25404195 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1115456819 14:33613496-33613518 AGCCTCAAGCTGTGGTTAGGAGG - Intronic
1115658539 14:35467196-35467218 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1116054046 14:39840654-39840676 ACCCTCAAGCTGATTGTATTAGG + Intergenic
1116111779 14:40594415-40594437 ACCCTCAATGTGATGGTATTAGG + Intergenic
1116582238 14:46656877-46656899 ACCCCCAAGGTGATGGTATTAGG + Intergenic
1116995202 14:51316319-51316341 ACCCTCAATGTGATGGTACTTGG + Intergenic
1117533009 14:56677108-56677130 ATCCTCAAGGTGATGGTATTTGG - Intronic
1117678438 14:58178873-58178895 ACCCCCAAGGTGATGGTATTAGG - Intronic
1118034657 14:61853427-61853449 ACCCTCAAGATGATGGCATTAGG + Intergenic
1118437872 14:65787879-65787901 ACCCCCAAGGTGATGGTATTTGG - Intergenic
1118597511 14:67447323-67447345 ACCTCCAAGCTGATGGTATTAGG - Intronic
1118752569 14:68817513-68817535 ACCCTTAAGCTGAGGCCAGGAGG + Intergenic
1120278323 14:82407184-82407206 ACCCACAATGTAATGGTAGGGGG + Intergenic
1120498938 14:85269808-85269830 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1120710804 14:87791100-87791122 ACCCTCAAGGTGATGGTATCAGG + Intergenic
1121100323 14:91245701-91245723 GCCCTCACTCTGTTGGTAGGGGG + Intronic
1121627853 14:95399785-95399807 ACCCGCAAGGTGATGGTATTAGG - Intergenic
1121761543 14:96449167-96449189 ACCCTTAAGCTGATGGTAGTAGG - Intronic
1124644831 15:31431021-31431043 ACCCCCAAGGTGATGGTATTTGG + Intronic
1125105307 15:35963942-35963964 ATCCCCAAGGTGATGGTAGCAGG - Intergenic
1125380073 15:39078040-39078062 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1126136667 15:45399373-45399395 ACCCTTGAGATGATGGTAGTAGG + Intronic
1126183378 15:45807735-45807757 ACCCTCAAGTTGACGGTATTAGG - Intergenic
1126416140 15:48419303-48419325 ATCCTCAGACTGATGGTAGGAGG + Intronic
1126573881 15:50179594-50179616 ACCCTCAATGTGATGGTATTAGG + Intronic
1127972438 15:63971950-63971972 ACCCCCAAGGTGATGGTATTAGG + Intronic
1128702966 15:69817436-69817458 ACCCCCAAGATGATGGTATTAGG - Intergenic
1130429631 15:83833469-83833491 ACCCTCAAGTTGATGGTACTAGG - Intronic
1131232868 15:90672149-90672171 ACCCCCAAGGTGATGGTATTAGG + Intergenic
1131236612 15:90702407-90702429 ACCCTCAGGGTGATGGTATTTGG + Intergenic
1131669721 15:94607092-94607114 AGCCTAAAGCTGTTTGTAGGAGG + Intergenic
1132367500 15:101268174-101268196 ACCCCCAAGGTGATGGTATTGGG + Intergenic
1132723790 16:1330157-1330179 ACCCTCAGGCTGGTGGGAGGCGG + Intergenic
1132935028 16:2475641-2475663 ACCCCCAAGCGGGTGGTCGGTGG - Intronic
1135036178 16:19079008-19079030 ACTCTCAAGTTGATAGAAGGTGG + Exonic
1135204596 16:20472484-20472506 ACCCTCAACTTGATGGTATTTGG - Intronic
1135214293 16:20551327-20551349 ACCCTCAACTTGATGGTATTTGG + Intronic
1135307543 16:21379915-21379937 ACTCTAAAGCTGAGGGTCGGGGG + Intergenic
1135654778 16:24238367-24238389 ATCCTCAATGTGATGGTAGTTGG - Intergenic
1136304287 16:29359035-29359057 ACTCTAAAGCTGAGGGTCGGGGG + Intergenic
1137626116 16:49909848-49909870 ACCCTCAATGTGATGGTATTTGG - Intergenic
1139749577 16:69101220-69101242 ACCCTCTAGCTGCTGTGAGGAGG - Intergenic
1140092677 16:71850846-71850868 CCCCTCACCCTGATGGTCGGGGG - Exonic
1141417078 16:83884015-83884037 ACCCCCAAGGTGATGGTATTAGG + Intergenic
1141632343 16:85295074-85295096 ACCCTCGAGGTGATGGTATTAGG - Intergenic
1143339649 17:6200656-6200678 ACCCCCAAGATGATAGTATGAGG - Intergenic
1144044753 17:11445283-11445305 AACCTCAAGGTGATGGTATTAGG - Intronic
1144585511 17:16485290-16485312 ACCCCCAAGGTGATGGTATCGGG + Intronic
1144671582 17:17135724-17135746 ACCCCCAAGGTGATGGTATCAGG - Intronic
1146592294 17:34137907-34137929 AACCCCAAGCTGATGGTATTAGG - Intronic
1150189430 17:63222240-63222262 ACCCCCAAGGTGATGGTATTAGG - Intronic
1151522382 17:74639637-74639659 ACCATGAAGCTGATGGTATTGGG - Intergenic
1151880411 17:76891345-76891367 ACCCTCAATGTGATGGTATTAGG - Intronic
1151914227 17:77105601-77105623 ACCCTCATGTTCATGGTTGGAGG + Intronic
1152941932 17:83177353-83177375 ACCCTCAAGGTGATGGCATTTGG + Intergenic
1153646391 18:7199689-7199711 ACCCCCAAGATGATGGTATTAGG - Intergenic
1155003545 18:21708086-21708108 CCCCTCAAGGTGATGGTATTAGG - Intronic
1155620045 18:27768073-27768095 ACCCTCCAGCATATGGTATGTGG + Intergenic
1156149890 18:34228484-34228506 ACCCCCAAGGTGATGGTATTAGG + Intergenic
1156241320 18:35257391-35257413 ACCCCCAAGGTGATGGTATTAGG + Intronic
1157923657 18:51740285-51740307 ACCCCCAAGGTGATGGTATTTGG + Intergenic
1158555447 18:58471159-58471181 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1160118977 18:76109946-76109968 ACTCTCAAGGTGATGGTATTAGG - Intergenic
1160245913 18:77159352-77159374 ACCCTCAAAGGGATGGTAGTAGG + Intergenic
1160670396 19:359854-359876 ACCCTCAAGGTGATGGTATTAGG - Intergenic
1163295136 19:16406854-16406876 ACCCCCAAGATGATGGTATTAGG + Intronic
1164760452 19:30724700-30724722 ACCCGCAATGTGATGGTAAGAGG + Intergenic
1165882831 19:39055675-39055697 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1166220527 19:41361421-41361443 ACCCTCCAGCTGATGGATGAGGG - Intronic
1166589235 19:43982202-43982224 ACCCTCAATGTGATGGTAATAGG + Intronic
1168358115 19:55714898-55714920 ACCCCCAGGCTGATGGTACTAGG - Intronic
1168648905 19:58080294-58080316 ACCCACAATCTGATGATATGTGG - Intronic
926412636 2:12620425-12620447 AAGCTCAAGCTGATGGCAGTTGG + Intergenic
926946333 2:18191611-18191633 ACCCCTAAGCTGATGGTATTAGG + Intronic
927576795 2:24207516-24207538 ACCCTGAAGCTGGGGGTCGGTGG + Intronic
928033229 2:27798953-27798975 ACCCTCAAGGGGAGGGCAGGGGG - Intronic
929448167 2:42016418-42016440 ACCCCCAAGGTGATGGTATTAGG - Intergenic
930194861 2:48499082-48499104 ACCCCCAAGGTGATGGTATTAGG - Intronic
930831645 2:55750045-55750067 ACCCTCATGGTGATGGTACTAGG + Intergenic
930976548 2:57469141-57469163 ACCCTCAAGGTGATAGTACTAGG - Intergenic
931972804 2:67608320-67608342 ACCCTCAAGGTGATGGTAGTAGG - Intergenic
932186165 2:69698257-69698279 ATCCTCAAGGTGATGGTATTAGG - Intronic
933141254 2:78794588-78794610 ACCCCCCAGCTCATGGAAGGAGG - Intergenic
933376364 2:81484560-81484582 ACCCCCAAGATGATGGTATTAGG + Intergenic
934521260 2:95021518-95021540 ACCCCCAAGATGATGGTATCAGG + Intergenic
935553196 2:104479856-104479878 ATCCCCAAGGTGATGGTATGAGG + Intergenic
935572566 2:104677171-104677193 ACCCTCAAGGTGATGGTATTTGG - Intergenic
935645794 2:105333210-105333232 ACCCTCAAGGTGATGGTATTTGG + Intergenic
935675397 2:105590776-105590798 ACCCACAAGGTGATGGTATTAGG + Intergenic
935813461 2:106823954-106823976 ACCCTCAAGGTGATGTTATTAGG - Intronic
935832956 2:107019422-107019444 ACCCCCAATATGATGGTAGTAGG - Intergenic
937035705 2:118779925-118779947 CCCCTCAATGTGATGGTAGGAGG + Intergenic
937933946 2:127227406-127227428 ACTCCCAAGATGATGGTATGAGG - Intergenic
937933981 2:127227586-127227608 ACTCCCAAGATGATGGTATGAGG - Intergenic
938689936 2:133778220-133778242 TCCCTAAAGATGTTGGTAGGAGG + Intergenic
938803632 2:134786354-134786376 ACCCTCAAGATGCTGGTATTAGG + Intergenic
939552885 2:143637125-143637147 ACCCTCAATGTGATGGTATTTGG - Intronic
939668275 2:144977560-144977582 ATCCTCAAGCTGTTGGCATGAGG - Intergenic
939773789 2:146358926-146358948 ACCCCCAAGGTGATGGTATTAGG + Intergenic
939949819 2:148456397-148456419 ACCCCCAAGGTGATGGTATTAGG - Intronic
940131674 2:150388967-150388989 ACCCCCAAGGTAATGGTATGAGG + Intergenic
940848953 2:158670447-158670469 ACCCCCAAGGTGATGGTATTAGG - Intronic
942812707 2:180017513-180017535 ACCCCCAAGGTGATGGTATTAGG + Intergenic
944135533 2:196395107-196395129 ACCCCCAAGGTGATGATAGTAGG - Intronic
944329235 2:198445656-198445678 ACCCCCAAGGTGATGGTATTGGG + Intronic
944670827 2:201993117-201993139 ACCCTTAAGGTGATGGTATTAGG + Intergenic
945225184 2:207526728-207526750 ACCCTCAATGTGATGGTATTAGG + Intergenic
945282279 2:208047243-208047265 ACCCTCAAGGTGAAGGTATTAGG + Intergenic
945852934 2:215031386-215031408 ACCCCCAAGATGATGGTATTAGG + Intronic
946796778 2:223362767-223362789 ACCCTCAAGGTGATGGTATTAGG + Intergenic
946878166 2:224150898-224150920 ACCACCAAGGTGATGGTATGAGG + Intergenic
947113715 2:226747305-226747327 ACCCTCAACATGATGGTATTAGG + Intronic
947136882 2:226984515-226984537 ACCCTCAATGTGATGGCATGTGG - Intronic
947153678 2:227139000-227139022 ACCCCCAAGGTGATAGTAGGAGG + Intronic
947181724 2:227417269-227417291 ACCCCCAAGGTGATGGTATTAGG + Intergenic
947436450 2:230076879-230076901 ACCCCCAAGGTGATGGTATTAGG - Intergenic
947668496 2:231922405-231922427 TCCCTCAAGCTGCTGGGAGAAGG - Intronic
948281562 2:236751206-236751228 ACCCTCAAAGTGATGGTATTAGG - Intergenic
948363490 2:237438814-237438836 GGCCTCAGGATGATGGTAGGAGG - Intergenic
1168834076 20:865384-865406 AACTTCCAGCTGATGGAAGGTGG + Intergenic
1169019622 20:2319767-2319789 TCCCTACAGCTGATGGTTGGGGG + Intronic
1169225257 20:3852498-3852520 GCCCTCAAGCTGATAGCAAGAGG - Intronic
1170751981 20:19157228-19157250 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1172691470 20:36793381-36793403 ACCCTCTGGCTGATGGTAGCTGG + Exonic
1172886889 20:38237385-38237407 ACCCTCAAGCTGAACGAAGCTGG - Intronic
1174514122 20:51078148-51078170 ACCTTTAAGCTGATCGTTGGAGG - Intergenic
1174700648 20:52605141-52605163 ACCCCCAAGGTGATGGTATTAGG + Intergenic
1174741003 20:53014324-53014346 ACCCTCAATGTGATGGTATTAGG - Intronic
1175156904 20:56977327-56977349 ACCCTTGAGCTCTTGGTAGGAGG - Intergenic
1175375743 20:58522764-58522786 ACTTGCAAGCTGATGGTGGGGGG - Intergenic
1176237442 20:64060248-64060270 GCCCTCAAGCTGGGGGTGGGGGG - Intronic
1176246837 20:64101568-64101590 CCCCCCAAGCTGATGGTATCAGG - Intergenic
1176926429 21:14755269-14755291 ACCCCCAAGATAATGGTATGAGG + Intergenic
1177781760 21:25629557-25629579 ACCCCCAAAGTGATGGTAGTAGG - Intergenic
1178041289 21:28643243-28643265 ACCCTTAAGGTGATGGTGGCAGG + Intergenic
1179240711 21:39588677-39588699 ACCCCCAAGGTGATGGTATTAGG - Intronic
1180962768 22:19769723-19769745 ACCCCCAAGGTGATGGTGGCAGG + Intronic
1181347600 22:22231455-22231477 ACCCCCAAGCTGATGGTATTAGG + Intergenic
1182678940 22:32063174-32063196 ACCCCCAAGGTGATGGTATTTGG - Intronic
1182719041 22:32383131-32383153 ACCCTCAATCTCATGGTATCAGG + Intergenic
1182847812 22:33446050-33446072 ACCCTCAACCTGCAGGGAGGCGG + Intronic
1183012404 22:34957691-34957713 ACCCTCAAGGTGATGGTATTAGG - Intergenic
1183039170 22:35163423-35163445 ACCCTCAAGGTGGTGGTATTAGG - Intergenic
1183548619 22:38468508-38468530 CCCCTCGAGATGATGGGAGGCGG + Intronic
1183787788 22:40040956-40040978 ACCCACAAGCTGGGGGAAGGGGG - Exonic
1184509393 22:44924444-44924466 ACCCTCAATGTGATGGTATTTGG + Intronic
1185073299 22:48668980-48669002 ACCCTCGAGGTGATGGTATTTGG + Intronic
949589896 3:5483103-5483125 ACCCCCAAGGTGATGGTATTAGG - Intergenic
949846899 3:8380758-8380780 ACCCTCAATGTGATGGTATTAGG + Intergenic
951271782 3:20634057-20634079 ACCCTCAATGTGATGGTATTAGG + Intergenic
951628234 3:24690099-24690121 ACCCCCAAGGTGATGGTATTAGG - Intergenic
952380231 3:32798711-32798733 ACCCCCAAGGTGATGGTATTAGG - Intergenic
952465256 3:33577720-33577742 ATCCTCAAGGTGATGGTATTAGG + Intronic
953410459 3:42687972-42687994 GCTCTCAGCCTGATGGTAGGAGG + Intronic
955129459 3:56150832-56150854 ACCCTCAATGTGATGGTATTTGG + Intronic
956146060 3:66191937-66191959 ACCCCCAATCTGATGGTATTAGG + Intronic
956271590 3:67453537-67453559 ACCCTCAAGGTGATGATATTAGG - Intronic
957340513 3:78890286-78890308 ATCCTCAATGTGATGGTAGGTGG + Intronic
958582756 3:96047365-96047387 ACCCTCAAGATGATGGCATAGGG + Intergenic
958866793 3:99510057-99510079 ACCACCAAGGTGATGGTAGGAGG + Intergenic
960103227 3:113766678-113766700 ACCCTCAATGTGATGGTATTAGG - Intronic
961216634 3:125165123-125165145 ACCCTCATGATGATGGTGGGAGG - Intronic
961251777 3:125513099-125513121 ACACTCAAGGTGATGGTATTAGG + Intronic
961776024 3:129286218-129286240 ACCCCCAAGATGATGGTATTAGG + Intronic
962123444 3:132588959-132588981 ACCCCCAAGCTGATTTTATGTGG + Intronic
963543724 3:146627901-146627923 ACCCCCAAGATGATGGTATTTGG - Intergenic
964203639 3:154146309-154146331 ACCCCCAAGGTGATGGTATTAGG - Intronic
964277291 3:155022023-155022045 GCCCTCAAGATGATGGTATTGGG - Intergenic
964445900 3:156756985-156757007 ACCCTCAAGGTGATGGTATTAGG + Intergenic
964915759 3:161839223-161839245 ACCCTCAATGTGATGGTATGAGG + Intergenic
965957311 3:174386660-174386682 ACCCCCAAGGTGATGGTATTAGG - Intergenic
966001070 3:174949152-174949174 ACCCCCAGGGTGATGGTAGTAGG - Intronic
966875036 3:184316656-184316678 ACCCCCAAGGTGATGGCGGGGGG - Intronic
967183545 3:186927307-186927329 ACCCCCAAGATGATGGTATTTGG - Intergenic
967995769 3:195165245-195165267 ACCCTGTAGAGGATGGTAGGAGG - Intronic
968484219 4:850928-850950 CCACTCAAGCTGAAGGTGGGTGG - Exonic
968510438 4:993184-993206 ACCCTCAGGCTCAAGGCAGGTGG - Intronic
968975318 4:3819233-3819255 ACCCTCCAGGTGATGGTATGTGG - Intergenic
970055853 4:11971288-11971310 ACCCCCAAGCTGATGGTATTAGG - Intergenic
970113020 4:12659889-12659911 ACCCTCAAGGTGATAGTATTAGG - Intergenic
970514819 4:16818052-16818074 ACGCTCAGCCTGATGGGAGGAGG + Intronic
970811779 4:20102732-20102754 ACCCTCAGGGTGATTGGAGGTGG - Intergenic
970940403 4:21626256-21626278 ATCCTCAATGTGATGGTACGTGG + Intronic
971081890 4:23222347-23222369 ACACTGAAGCTCATGGTAAGTGG - Intergenic
972166017 4:36284948-36284970 ACCCCCAAGGTGATGGTATTAGG - Intronic
972268312 4:37484126-37484148 ACCCACAAGATGATGGTATTGGG + Intronic
973755336 4:54068253-54068275 GCCCTCAAGGTGATGGTATTAGG + Intronic
973855035 4:55002803-55002825 ACCCCCAAGCTGATGGTAATAGG + Intergenic
974031743 4:56782513-56782535 ACCCCTAAGGTGATGGTAGTAGG - Intergenic
976329408 4:83812322-83812344 ACCTCCAAGGTGATGGTATGAGG + Intergenic
977187315 4:93955803-93955825 ACCCCCAATGTGATGGTAGTAGG + Intergenic
977465072 4:97373619-97373641 GCCCTCAAGGTGATGGTATTAGG + Intronic
977779303 4:100961771-100961793 ACCCCCAAGGTGATGGTATTAGG + Intergenic
979116969 4:116836974-116836996 ACCCTCAAGGTGATGGTAGTAGG + Intergenic
979366487 4:119830697-119830719 ACCCTCAAGGTGATGGTGTTAGG + Intergenic
980731968 4:136835479-136835501 ACCCACAAAGTGATGGTAGTAGG + Intergenic
982091294 4:151882034-151882056 ACCCCCAAGATGATGGTATTAGG - Intergenic
982142173 4:152335182-152335204 ACCCTCAATGTGATGGTATTAGG + Intronic
983118727 4:163852844-163852866 ACCCCCAAGGTGATGGTATTAGG + Intronic
983488282 4:168357594-168357616 ACCCTCAATGTGATGGTATTAGG - Exonic
983664780 4:170168608-170168630 ACCCTCAATGTGATGGTATTTGG - Intergenic
984600387 4:181719642-181719664 ACCCTCAAGGTGATGGGATTAGG - Intergenic
986688358 5:10293506-10293528 ACCCTCAAGGTGATGGTATCAGG - Intronic
986727808 5:10612455-10612477 ACCCTCACGGTGATGGTATTAGG - Intronic
987659760 5:20856494-20856516 ACCCCTAAGGTGATGGTAGCTGG - Intergenic
988515372 5:31899685-31899707 ACCCTCAAGGTGGTGGTATTGGG + Intronic
990349318 5:54899873-54899895 ACCCTCAATGTGATGGTATTAGG + Intergenic
991098715 5:62767923-62767945 ACCCTCAAGATAATGGTATTAGG + Intergenic
991191156 5:63875578-63875600 ACCCCCAAGGTGATGGTATTAGG - Intergenic
991953736 5:71971839-71971861 ACCCCCAAGGTGATGGTATTAGG - Intergenic
992157953 5:73973188-73973210 ACCCTCAAGGTGATGGTATTAGG - Intergenic
994397632 5:99238778-99238800 ACCCTCAATGTGATGGTATTAGG - Intergenic
995245246 5:109928001-109928023 ACCCCTAAGGTGATGTTAGGAGG - Intergenic
996240934 5:121200456-121200478 ACCCCCAAGGTGATGGTATGAGG - Intergenic
996338744 5:122412985-122413007 ACTCTCAAGATGATGGTATTTGG + Intronic
996752213 5:126900334-126900356 ACCCTCAAGGTGATGGTATTAGG + Intronic
997076354 5:130683205-130683227 ACCCCCAAGGTGATGGTATTAGG + Intergenic
997385776 5:133471400-133471422 ACCCCCAAGGTGATGGTATTAGG + Intronic
997411559 5:133694934-133694956 ACCCCCAAGCTGATGGTATTAGG - Intergenic
998948060 5:147362506-147362528 ACCCTCAATTTGATGGTATTTGG - Intronic
1001291601 5:170466821-170466843 ACCCTCAAGGTGATGGTACTAGG - Intronic
1001439566 5:171731114-171731136 ACCCTCAAGGTGATGCTATTAGG - Intergenic
1002168261 5:177361305-177361327 ATCCTCAAGAGGATGGTAGAGGG + Intronic
1003186285 6:3833561-3833583 ACCCTAAAGCTGGGGGTAGAGGG - Intergenic
1003306307 6:4932447-4932469 ACCCACAAGGTGATGGTCTGAGG - Intronic
1003317987 6:5028741-5028763 ACCCCCAAGGTGATGGTATTTGG + Intergenic
1003389897 6:5704375-5704397 ACCCCCAAGATGATGGTCTGAGG - Intronic
1003402280 6:5800333-5800355 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1003486724 6:6586614-6586636 AGCCTCAAGGTGATGGTATTAGG + Intergenic
1003636024 6:7832286-7832308 ACCCCCAAGGTGATGGTATTAGG + Intronic
1004086532 6:12454878-12454900 GCCTTCAAGCTGATGGTATTAGG + Intergenic
1004352107 6:14898937-14898959 ACCCCCAAGGTGATGGTACTGGG + Intergenic
1005027080 6:21473585-21473607 ACCCTCAATGTGATGGTATTTGG + Intergenic
1005510529 6:26508315-26508337 ACCCTCTGGCTGCTGGTAAGGGG + Intronic
1007364345 6:41380582-41380604 ACCCTCAAGGTGATGGCATTAGG - Intergenic
1008164145 6:48115075-48115097 ACCCTCAAGGTGATGGTCCTAGG + Intergenic
1008652236 6:53575311-53575333 ACCCTTAAACTGATGGTATTAGG + Intronic
1009845153 6:69125393-69125415 CCCCTCAAGCTGAGAGTATGAGG + Intronic
1009902292 6:69822218-69822240 AACCCCAAGCTGATGGTATCAGG + Intergenic
1009905080 6:69860125-69860147 ACCCTCAAGGTGATAGTATTAGG - Intergenic
1011156873 6:84342967-84342989 ACCCTCAAGGTGGTGGTATTAGG - Intergenic
1011568930 6:88713109-88713131 ACCCTCAAAGAGATGGTATGAGG + Intronic
1011645905 6:89457883-89457905 ACCCTCAATGTGATGGTACTAGG + Intronic
1013948651 6:115752946-115752968 ACCCTCAATATGATGGTATTAGG + Intergenic
1015560195 6:134506155-134506177 ACCCTCAAGGTGATAGTATTAGG - Intergenic
1016019411 6:139220038-139220060 ACTCTCAAACTGATGGTATTAGG + Intergenic
1016641683 6:146356513-146356535 ACCCCCAAGGTGATGGTATTAGG - Intronic
1017198628 6:151729090-151729112 ACTCTCAAGATGATGGTATTAGG + Intronic
1018225888 6:161628497-161628519 ACCCTCAAGGTGATGGTATTAGG - Intronic
1018753274 6:166825802-166825824 ACCCTCAAGGTGATGGTATTGGG - Intronic
1018913558 6:168118650-168118672 ACCCTCAAGGGGATGGTATTAGG + Intergenic
1020676060 7:11186333-11186355 ACCCCCAAGGTGATGGTAGGTGG + Intergenic
1021345440 7:19521592-19521614 ACTCTCAAGGTGATGGTATTAGG + Intergenic
1024250734 7:47503986-47504008 ACCCCCAAGGTGATGGTAGCTGG - Intronic
1024259022 7:47560149-47560171 AACCCCAAGGTGATGGTATGAGG + Intronic
1024391916 7:48823630-48823652 ACCCTTAAGGTGATGGTATTAGG - Intergenic
1028414509 7:90565907-90565929 ACCTCCAAGGTGATGGTAGTAGG + Intronic
1028597102 7:92557363-92557385 ACCCCCAAGCTAATGGTATTAGG + Intergenic
1030438804 7:109559333-109559355 ACACTCGAGGTGATGGTATGAGG - Intergenic
1031374808 7:121010731-121010753 AATCTCAAGCTGATGATGGGAGG - Intronic
1031516994 7:122712932-122712954 ACCCCCAAGGTGATGGTATTAGG - Intronic
1031914476 7:127549963-127549985 ACACTCAATATGATGGTATGAGG - Intergenic
1033018688 7:137699263-137699285 ACCCCCAAGGTGATGGTATCAGG - Intronic
1033639267 7:143245635-143245657 ACCCCCAAGGTGATGGTATTAGG + Intronic
1034071661 7:148191758-148191780 ACCCCTAACTTGATGGTAGGAGG - Intronic
1034882018 7:154770035-154770057 ACCCCCAAGGTGATGGTATTAGG + Intronic
1034916943 7:155047961-155047983 ACCCCCAAGGTGATGGTACTGGG + Intergenic
1035283540 7:157792478-157792500 ACCCTCGAGCTGAAGGCAGCTGG - Intronic
1036178316 8:6561026-6561048 ACCGTCAAGCTGATGGTTAATGG - Intronic
1037287833 8:17319851-17319873 ACCTTTAAGCTGATGGTATTTGG - Intronic
1038154287 8:24973112-24973134 AACCTCAAGGTGATGGTATTAGG - Intergenic
1039093991 8:33863778-33863800 ACCCTTAAGATGATGGTATTAGG + Intergenic
1042027930 8:64443672-64443694 ACCCCCAAGATGATATTAGGAGG + Intergenic
1042114328 8:65414638-65414660 ACCTCCAAGGTGATGGTATGTGG - Intergenic
1042117344 8:65446831-65446853 ACCCTCAAGATGATGGCATTAGG + Intergenic
1042166886 8:65954469-65954491 ACCCTCAAGATGATGATACTAGG + Intergenic
1042329419 8:67562575-67562597 ACCCCCAAGGTGATGGTATTAGG + Intronic
1043257406 8:78153564-78153586 ACCCTCAAGATGATCGCTGGAGG - Intergenic
1044065024 8:87688415-87688437 ACCCCCAAGGTGATGGTATTTGG + Intergenic
1044774611 8:95675367-95675389 ACCCCCAAGTTGATGGTATTAGG + Intergenic
1044785456 8:95788173-95788195 ACCCTCAAGCTGAGGTTTGGCGG + Intergenic
1044915796 8:97111573-97111595 TGCTTCAAGATGATGGTAGGAGG - Intronic
1046238849 8:111464058-111464080 ACCCTCAATGTGATGGTATTAGG - Intergenic
1046321500 8:112582735-112582757 ACCCTCAAGGTGATGGTATTAGG + Intronic
1046724779 8:117662588-117662610 ACCCCCAAAGTGATGGTATGAGG - Intergenic
1046831631 8:118752580-118752602 ACTCCCAAGATGATGGTAGTAGG + Intergenic
1046849511 8:118956226-118956248 ACCCTCAAGGTGATGCTATTAGG - Intergenic
1047323921 8:123818290-123818312 ACCCTCAACTTGATGGTATTAGG - Intergenic
1047415343 8:124660472-124660494 ACCCTCAAGCTGAAGGGTGGAGG + Intronic
1047441063 8:124879157-124879179 ACCCCCAATGTGATGGTATGAGG - Intergenic
1047470678 8:125168701-125168723 ACCCTTAAGGTGATGGTATTAGG - Intronic
1047767569 8:128001936-128001958 ACCCTCAAGGTGATGGGATTTGG - Intergenic
1048870112 8:138790354-138790376 ACCCCCAAGGTGATGGTATTGGG - Intronic
1049625925 8:143620786-143620808 ACCCCGAAGGTGATGGTATGAGG - Intergenic
1050498568 9:6269799-6269821 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1051168783 9:14296487-14296509 ACCCCCAATCTGATGGTATTAGG + Intronic
1051722109 9:20047783-20047805 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1052344099 9:27390773-27390795 ACCCCCAAGGTGATATTAGGAGG + Intronic
1054865428 9:69995721-69995743 ACCCCCAAGGTGATGGTATGAGG + Intergenic
1055275411 9:74610561-74610583 ACCCTCAAGATGATGGTATTAGG - Intronic
1056309111 9:85321594-85321616 ACCCTCAAGCAGAGGGTTTGGGG - Intergenic
1056418858 9:86404149-86404171 ACCCCCAAGGTGATGGTATCAGG + Intergenic
1056526959 9:87452378-87452400 ACCCTCACGGTGATGGTATTAGG + Intergenic
1057035131 9:91806439-91806461 ACCCCCAAGGTGATGGTATTAGG - Intronic
1058724804 9:107792294-107792316 ACCCTCAATGTGATGGTATTTGG + Intergenic
1059119705 9:111631169-111631191 ATCCTCCAGCTGCTGGTACGGGG + Intergenic
1059465174 9:114464570-114464592 ACCCACAAGCTGATAGTATTAGG - Intronic
1060649500 9:125313204-125313226 ACCCCCAAGGTGATGGTATTTGG - Intronic
1061362574 9:130153038-130153060 ACTCCCAAGATGATGGTATGAGG - Intergenic
1186103126 X:6177825-6177847 ACCCCCAAGATGATGGTATCAGG + Intronic
1186208395 X:7224443-7224465 ACCCCCAAGATGATGGTATTTGG + Intronic
1186468825 X:9805427-9805449 ACCCACAAGGTGATGGTATTAGG + Intronic
1187178155 X:16915666-16915688 ACTCTCAAGGTGATGGTATTAGG + Intergenic
1190434469 X:50409771-50409793 ACCCTCTAGGTGATGGTATTAGG + Intronic
1191885613 X:65884910-65884932 ACCCTCAAAGTGATGGTATTAGG + Intergenic
1192119158 X:68438692-68438714 ACCCTCAAGGTAATGGTATTAGG + Intergenic
1194205735 X:91009060-91009082 ACCCTCAAGTTTATAGTAGTAGG - Intergenic
1196407575 X:115380800-115380822 ACCCACAAGGTGATGGTATTAGG + Intergenic
1197168702 X:123407642-123407664 ACCCCCAAGGTGATGGTATTAGG - Intronic
1198034391 X:132786455-132786477 AAGCTCAAGGTGGTGGTAGGAGG - Intronic
1198069479 X:133133930-133133952 AGCCTCAGGTTGATGGTATGTGG + Intergenic
1198098502 X:133403480-133403502 ACCCTCAAGGTGATGGTATTAGG - Intronic
1198174594 X:134142907-134142929 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1198793435 X:140370695-140370717 ACCCCCAATGTGATGGTATGAGG + Intergenic
1198802464 X:140461588-140461610 ACCCCCAAGATGATGGTATTAGG + Intergenic
1200180888 X:154150092-154150114 ACCCCCAAGGTGATGGTATTAGG - Intronic
1200186531 X:154187206-154187228 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1200192183 X:154224344-154224366 ACCCCCAAGGTGATGGTATTAGG - Intronic
1200197938 X:154262148-154262170 ACCCCCAAGGTGATGGTATTAGG - Intronic
1200326026 X:155240134-155240156 ACCCCCAAGGTGATGGTATTAGG - Intergenic
1200551494 Y:4583871-4583893 ACCCTCAAGTTTATAGTAGTAGG - Intergenic
1201675484 Y:16578742-16578764 AACCTCAAGTTGATGGTATTGGG + Intergenic