ID: 1069764294

View in Genome Browser
Species Human (GRCh38)
Location 10:70841636-70841658
Sequence CTAACCCTCAAGCTGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069764294_1069764297 0 Left 1069764294 10:70841636-70841658 CCTACCATCAGCTTGAGGGTTAG 0: 1
1: 0
2: 3
3: 13
4: 72
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764294_1069764296 -1 Left 1069764294 10:70841636-70841658 CCTACCATCAGCTTGAGGGTTAG 0: 1
1: 0
2: 3
3: 13
4: 72
Right 1069764296 10:70841658-70841680 GATTTCAACATATGAATTTTTGG 0: 182
1: 925
2: 2225
3: 3438
4: 4626
1069764294_1069764298 1 Left 1069764294 10:70841636-70841658 CCTACCATCAGCTTGAGGGTTAG 0: 1
1: 0
2: 3
3: 13
4: 72
Right 1069764298 10:70841660-70841682 TTTCAACATATGAATTTTTGGGG 0: 28
1: 444
2: 1606
3: 3278
4: 4796
1069764294_1069764299 2 Left 1069764294 10:70841636-70841658 CCTACCATCAGCTTGAGGGTTAG 0: 1
1: 0
2: 3
3: 13
4: 72
Right 1069764299 10:70841661-70841683 TTCAACATATGAATTTTTGGGGG 0: 28
1: 372
2: 1349
3: 2634
4: 3546
1069764294_1069764300 27 Left 1069764294 10:70841636-70841658 CCTACCATCAGCTTGAGGGTTAG 0: 1
1: 0
2: 3
3: 13
4: 72
Right 1069764300 10:70841686-70841708 GTAAACATTCAGTCCATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069764294 Original CRISPR CTAACCCTCAAGCTGATGGT AGG (reversed) Intronic
902637523 1:17744289-17744311 CTAAACCTCAGGCTGATAGGAGG + Intergenic
905011770 1:34751952-34751974 CTCAGCCCCAAGCTGGTGGTAGG + Intronic
907875015 1:58477497-58477519 CCAACATTCAAGCTGATGATGGG - Intronic
910641329 1:89465905-89465927 CTAACCCTCAGGATGATGCCAGG - Intergenic
914785104 1:150822382-150822404 CTAACCCTCAACCTCATGGAGGG + Intronic
921325556 1:213983853-213983875 CTAACCCTCAAAACGATGGGTGG + Intronic
1063062964 10:2577391-2577413 CTAAGCCTCAATCTGAGGGCTGG + Intergenic
1065725827 10:28667266-28667288 CTAAGCCCCAAGCTAATGCTGGG + Intergenic
1066387976 10:34956861-34956883 CTCCTCCTCAAGCTGATGATGGG - Intergenic
1068286269 10:54939924-54939946 CTAACCCCTAAGGTGATGGTAGG - Intronic
1068524796 10:58116205-58116227 TTAACCCTCAAGGTGATGGTAGG - Intergenic
1069135104 10:64754180-64754202 CTAACCCTCAATGTGATTGATGG + Intergenic
1069764294 10:70841636-70841658 CTAACCCTCAAGCTGATGGTAGG - Intronic
1077280317 11:1741805-1741827 CTAACCCCTAAAGTGATGGTAGG + Intronic
1087933100 11:104001067-104001089 CTAACCCTTAATCACATGGTTGG - Intronic
1092892946 12:12986297-12986319 GCAACCCTGAACCTGATGGTGGG - Intronic
1093640584 12:21523136-21523158 CTAAACCTCAATATGATGGTAGG + Intergenic
1098206296 12:68113863-68113885 CTGCCACACAAGCTGATGGTAGG + Intergenic
1098511982 12:71326621-71326643 CTAACCATAAATCTTATGGTTGG - Intronic
1103139939 12:118539828-118539850 CCATCCCTCAAGCTGAAGGATGG + Intergenic
1106034701 13:26033235-26033257 CTAACCCTCAAGATGATATTAGG + Intergenic
1120278320 14:82407181-82407203 CTAACCCACAATGTAATGGTAGG + Intergenic
1124367250 15:29080925-29080947 ATAAGCCTCAAGCTGCTGGTGGG - Intronic
1126530582 15:49706255-49706277 CTAAGCATAAAGCTTATGGTGGG - Intergenic
1126747896 15:51845408-51845430 CTCACCCTCAGTCTGATGCTGGG + Intronic
1132364557 15:101247761-101247783 CCATCCCTCAAGCAGATGGCAGG + Intronic
1133112177 16:3554647-3554669 GCAACCCTCACGCTGCTGGTGGG + Intronic
1137285866 16:47015206-47015228 CTAACCCCCAAGATGATGTTGGG + Intergenic
1141186327 16:81790095-81790117 CTACCCCACAGGCTCATGGTTGG + Intronic
1141665218 16:85462360-85462382 CCAACCAACAAGCTGAGGGTAGG - Intergenic
1151469502 17:74309371-74309393 GTGACCTTCAAGCTGAGGGTGGG - Exonic
1153834375 18:8950915-8950937 CTAATCCTCAACGTGGTGGTAGG + Intergenic
1156900361 18:42293882-42293904 CTGACCCTCACGCTGCTGGCAGG - Intergenic
1157395264 18:47335938-47335960 CTAGCCCTCAAGGACATGGTTGG - Intergenic
1157801870 18:50627426-50627448 CCACCCCTGAAGCTGGTGGTTGG - Intronic
1164963591 19:32459227-32459249 CTACCCATCAAGCTGCTGGGGGG + Intronic
1165819459 19:38665344-38665366 CTAATCCTCAAACTGAGGATAGG - Intronic
927576794 2:24207513-24207535 CTGACCCTGAAGCTGGGGGTCGG + Intronic
930602543 2:53458648-53458670 CTAACCCTCAAGGTGATGGATGG + Intergenic
934674695 2:96241282-96241304 CTCACCCCCAAGGTGATGGAGGG - Intergenic
937035703 2:118779922-118779944 CTACCCCTCAATGTGATGGTAGG + Intergenic
945241301 2:207679359-207679381 CTAATCCTCAAGGCGATGGATGG - Intergenic
947153677 2:227138997-227139019 CTAACCCCCAAGGTGATAGTAGG + Intronic
947583303 2:231335347-231335369 CTTACTCCCAAGCTGCTGGTTGG - Intronic
947926827 2:233928760-233928782 CTATTTCTCAAGCTGGTGGTGGG - Intronic
1168893960 20:1311142-1311164 CTGGCCTTCAAGCTGAGGGTGGG - Intronic
1169642646 20:7771932-7771954 CTAACCAACAAACTGAAGGTAGG - Intergenic
1170394146 20:15907913-15907935 CTCACCCTCAAGCTTTGGGTTGG + Intronic
1176237445 20:64060251-64060273 CCAGCCCTCAAGCTGGGGGTGGG - Intronic
1183388738 22:37530849-37530871 CTAACCTTCAAGGTGATGGATGG - Intergenic
951127523 3:19001353-19001375 CTTGACCTCAAGCTGAAGGTTGG + Intergenic
957340512 3:78890283-78890305 CTAATCCTCAATGTGATGGTAGG + Intronic
958866792 3:99510054-99510076 CTAACCACCAAGGTGATGGTAGG + Intergenic
959162085 3:102736029-102736051 CTAACCCTGAACCTGACAGTTGG + Intergenic
959443401 3:106407165-106407187 GTTACCATCATGCTGATGGTGGG - Intergenic
961216635 3:125165126-125165148 GTGACCCTCATGATGATGGTGGG - Intronic
962790615 3:138808060-138808082 CTAGCCCTCAATCTGATTGAGGG - Intronic
965810148 3:172583278-172583300 CTATCCCCCATGATGATGGTAGG - Intergenic
967684055 3:192399192-192399214 CTAACCTCCAAGATGATGTTAGG + Intronic
968453925 4:687804-687826 CTGGCCCTCATGCTGCTGGTTGG + Intronic
968732536 4:2276355-2276377 CACACCCCCAAGCTGAAGGTAGG - Intronic
973063201 4:45755792-45755814 CCAACCCTCAAGGTGATATTAGG - Intergenic
977551762 4:98450224-98450246 AGAACCCTCATGCTGATGGCAGG + Intergenic
986135991 5:4978454-4978476 GTAATCCTCAAGCTGGAGGTGGG + Intergenic
987437924 5:17920365-17920387 CTATCATTCAAGCTGATGGCTGG + Intergenic
987448390 5:18050963-18050985 TTAAACCTCAAGATGATGGAAGG + Intergenic
995245247 5:109928004-109928026 CTAACCCCTAAGGTGATGTTAGG - Intergenic
998312031 5:141142863-141142885 CTAACCCCCAACGTGATGGTAGG - Intronic
1002882408 6:1264601-1264623 CTCACCATCATCCTGATGGTTGG - Intergenic
1004254528 6:14050747-14050769 CCACCCCACAAGCTGCTGGTTGG - Intergenic
1009985613 6:70778615-70778637 TTAACCCTCAAGCCCCTGGTTGG + Intronic
1015292136 6:131549306-131549328 CTAACAGTCAAGCTGAATGTGGG - Intergenic
1019390059 7:781622-781644 GGAACCCTCACGCTGCTGGTGGG - Intronic
1020676059 7:11186330-11186352 CTAACCCCCAAGGTGATGGTAGG + Intergenic
1023094016 7:36641715-36641737 CTAAACCTCAAGCTCTAGGTAGG + Intronic
1031374809 7:121010734-121010756 CTGAATCTCAAGCTGATGATGGG - Intronic
1034071662 7:148191761-148191783 CTAACCCCTAACTTGATGGTAGG - Intronic
1037738194 8:21583374-21583396 CTAACCCTCAAGGTGACATTAGG + Intergenic
1042027929 8:64443669-64443691 CTAACCCCCAAGATGATATTAGG + Intergenic
1044076926 8:87833308-87833330 CTAATCCTCAAGATGATATTAGG + Intergenic
1044785454 8:95788170-95788192 CCCACCCTCAAGCTGAGGTTTGG + Intergenic
1047415342 8:124660469-124660491 CACACCCTCAAGCTGAAGGGTGG + Intronic
1047930299 8:129721907-129721929 CTAACCCCCACTCTGAGGGTGGG - Intergenic
1050485985 9:6135140-6135162 TTAACCCTCAAGGTGATGGGAGG + Intergenic
1052344098 9:27390770-27390792 CTAACCCCCAAGGTGATATTAGG + Intronic
1056858993 9:90162252-90162274 ATAATCCTCTAGCTCATGGTTGG - Intergenic
1189405227 X:40716223-40716245 GGAACCCTCACGCTGTTGGTGGG + Intronic
1192158939 X:68768649-68768671 CTAGCCTTCAAGTTGATGCTTGG + Intergenic
1198702628 X:139414182-139414204 CTTACCTTCAAGCGGATGGAAGG + Intergenic