ID: 1069764295

View in Genome Browser
Species Human (GRCh38)
Location 10:70841640-70841662
Sequence AAATCTAACCCTCAAGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 804
Summary {0: 1, 1: 0, 2: 14, 3: 163, 4: 626}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069764295_1069764298 -3 Left 1069764295 10:70841640-70841662 CCATCAGCTTGAGGGTTAGATTT 0: 1
1: 0
2: 14
3: 163
4: 626
Right 1069764298 10:70841660-70841682 TTTCAACATATGAATTTTTGGGG 0: 28
1: 444
2: 1606
3: 3278
4: 4796
1069764295_1069764300 23 Left 1069764295 10:70841640-70841662 CCATCAGCTTGAGGGTTAGATTT 0: 1
1: 0
2: 14
3: 163
4: 626
Right 1069764300 10:70841686-70841708 GTAAACATTCAGTCCATTGCAGG No data
1069764295_1069764296 -5 Left 1069764295 10:70841640-70841662 CCATCAGCTTGAGGGTTAGATTT 0: 1
1: 0
2: 14
3: 163
4: 626
Right 1069764296 10:70841658-70841680 GATTTCAACATATGAATTTTTGG 0: 182
1: 925
2: 2225
3: 3438
4: 4626
1069764295_1069764297 -4 Left 1069764295 10:70841640-70841662 CCATCAGCTTGAGGGTTAGATTT 0: 1
1: 0
2: 14
3: 163
4: 626
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764295_1069764299 -2 Left 1069764295 10:70841640-70841662 CCATCAGCTTGAGGGTTAGATTT 0: 1
1: 0
2: 14
3: 163
4: 626
Right 1069764299 10:70841661-70841683 TTCAACATATGAATTTTTGGGGG 0: 28
1: 372
2: 1349
3: 2634
4: 3546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069764295 Original CRISPR AAATCTAACCCTCAAGCTGA TGG (reversed) Intronic
900814549 1:4833385-4833407 AATTCTAACCCTCAAGGTGATGG - Intergenic
900855085 1:5174997-5175019 AATCCTAACCCCCAAGGTGATGG + Intergenic
900866086 1:5269595-5269617 AAACCTAACCCCCAAGGGGATGG - Intergenic
902605202 1:17565261-17565283 AAACCTCACCCCCAAGGTGATGG - Intronic
902734013 1:18388134-18388156 AATTCTAACCCTTGAGGTGATGG + Intergenic
904000031 1:27333673-27333695 AATCTTAACCCTCAAGGTGATGG - Intronic
904449659 1:30602658-30602680 AAATCTAACCTTCAAAGTGTTGG + Intergenic
906096720 1:43229015-43229037 AAACCTAACCCCCAAAGTGATGG - Intronic
906463195 1:46053442-46053464 AAATCTAACACTCAAGGTGACGG + Intronic
906651831 1:47518247-47518269 AAACCTAACCTCCAAGGTGATGG + Intergenic
906716327 1:47972404-47972426 AATTCTAACCCACAATGTGATGG + Intronic
906848982 1:49227071-49227093 AAATCTAATCACCAAGGTGATGG - Intronic
906865353 1:49412444-49412466 AAATCTAACCCTCAATGTGATGG - Intronic
907170726 1:52461360-52461382 AAAACTGACCTTCAATCTGAAGG + Intronic
907309876 1:53533217-53533239 AAACCTACCCCACAAGCTCATGG - Intronic
907709494 1:56865524-56865546 AAACCTAATCCCCAATCTGATGG - Intronic
907964189 1:59313256-59313278 AAACCTAACCCCTAAGGTGATGG - Intronic
907976338 1:59434804-59434826 AAACCTAATCCTCAAGGTGATGG - Intronic
908038419 1:60081347-60081369 AATCCTAACCCCCAAGGTGATGG + Intergenic
908051622 1:60238990-60239012 AATCCTAACCCCCAAGATGATGG - Intergenic
908056977 1:60298350-60298372 AATTCTAACCACCAAGGTGATGG + Intergenic
908283933 1:62572756-62572778 AAGCCTAACCCTCAATGTGATGG - Intronic
908612703 1:65880471-65880493 AATCCTAATCCTCAAGGTGATGG + Intronic
909535744 1:76734124-76734146 AATTCTAACCTCCAAGGTGATGG - Intergenic
909735818 1:78960675-78960697 AATCCTAACCCCCAAGGTGATGG + Intronic
909912452 1:81277735-81277757 AATCCTAACCCCCAAGGTGAGGG - Intergenic
909916891 1:81331115-81331137 AAACCAAAACATCAAGCTGATGG + Intronic
909979398 1:82080732-82080754 AATTCTAACCCTCCATGTGATGG - Intergenic
910056065 1:83034161-83034183 AGTACTAACCCTCAAGGTGATGG - Intergenic
910090841 1:83462003-83462025 AATCCTAACCCTCAAGGGGATGG - Intergenic
910544397 1:88397751-88397773 AATCCTAACCCCCAAGGTGATGG - Intergenic
910551476 1:88480418-88480440 AATCCTAACCCTCAAGGTGATGG - Intergenic
910568108 1:88667927-88667949 AATTCTACCCCTCAAGGTGACGG - Intergenic
910669640 1:89760518-89760540 AGATCTAAACCCCAAGGTGATGG + Intronic
911105159 1:94124059-94124081 AATCCTAACCCCCAAGGTGATGG - Intergenic
911154603 1:94625625-94625647 AATTCTAACCACCAAGGTGATGG - Intergenic
911237724 1:95429584-95429606 AATTCTAACCTCCAAGATGATGG + Intergenic
911584164 1:99671171-99671193 AAATCTTATCCTCTAGCTGAGGG - Intronic
911631233 1:100185719-100185741 AAACCTAATCCCCAAGGTGATGG - Intergenic
911724124 1:101223869-101223891 GAATTTAAACCCCAAGCTGATGG + Intergenic
911834088 1:102593985-102594007 AATCCTAATCCTCAAGATGATGG + Intergenic
911924529 1:103811866-103811888 AATTCTAACCCCCAATGTGATGG - Intergenic
912242234 1:107923354-107923376 AATCCTAACCCTGAAGGTGATGG + Intronic
912893862 1:113563989-113564011 GAATATCACCCTAAAGCTGAGGG - Intronic
913457150 1:119044809-119044831 AAACCTAACTCCCAAGATGATGG - Intronic
914704518 1:150159924-150159946 AAACTTCACCCTCAAACTGAAGG - Exonic
916204380 1:162301206-162301228 AATCCTAACCCCCAAGATGATGG + Intronic
917368712 1:174263358-174263380 GAATTTAACCCTAAAGCTAAGGG - Intronic
917919078 1:179734692-179734714 AATTCTAACCCCCAAGGTGATGG - Intergenic
918708464 1:187697406-187697428 AATCCTAACCCTCAAGGTGATGG + Intergenic
920429536 1:205908235-205908257 AATCCTAACCCCCAAGGTGATGG - Intergenic
920814442 1:209318196-209318218 AAACCTAACCCCCAAAGTGATGG - Intergenic
920830416 1:209459930-209459952 AAATGTAACCTCCAAGGTGATGG + Intergenic
920969739 1:210732870-210732892 AAAACTAACCACCAAGGTGATGG - Intronic
921073458 1:211681646-211681668 AAACCTAACCCCCAAGGTAATGG + Intergenic
922972668 1:229755973-229755995 AAATCTAATCCCCAATGTGATGG - Intergenic
923001350 1:230008738-230008760 AATTCTAACCTCCAAGCGGATGG - Intergenic
923210285 1:231797648-231797670 AAGTCTAACTCCCAAGGTGATGG - Intronic
923333665 1:232948487-232948509 AATCCTAACCCACAAGGTGAAGG - Intergenic
923411416 1:233713673-233713695 AATTATAACCCTCTAGGTGATGG + Intergenic
923476860 1:234342186-234342208 AATCCTAACCCTAAAGGTGATGG + Intergenic
923492037 1:234492609-234492631 AATCTTAACCCTCAAGGTGATGG - Intergenic
924209345 1:241748596-241748618 AAACCTAAACCTCAACGTGATGG - Intronic
924562767 1:245170780-245170802 AAACCTAACCCCCAAAGTGATGG - Intronic
924604796 1:245523735-245523757 AATCCTAACCCACAAGATGATGG - Intronic
924886151 1:248219074-248219096 AATTCTAACCCCCAAGATGACGG - Intergenic
1063089084 10:2845542-2845564 AAACCCAACCCCCAAGGTGATGG - Intergenic
1063168756 10:3487131-3487153 AATTCTCACCCCCAAGGTGATGG + Intergenic
1063991983 10:11576401-11576423 AAACCTAACCCCCAAGGTGATGG + Intronic
1064269994 10:13856431-13856453 AGATCTAGCCCTCAAACTGTTGG + Intronic
1064903667 10:20320766-20320788 AAAACCAACCCTTGAGCTGAAGG - Intergenic
1065209443 10:23388759-23388781 AATCCTAACCCCCAAGGTGATGG - Intergenic
1065710553 10:28513083-28513105 AATCCTAACCCACAAGGTGATGG + Intergenic
1065857625 10:29842994-29843016 AAACCTAATCCTCAAGGTGATGG - Intergenic
1065868945 10:29939796-29939818 AATTCTAAACCTCAAGGTGATGG + Intergenic
1066985699 10:42464793-42464815 ACATCCAACCCTCAAACTCAAGG + Intergenic
1067390617 10:45859793-45859815 AATCCTAACCCTCAAGGTGATGG + Intergenic
1067500854 10:46804041-46804063 AATCCTAACCCTCAAGGTGATGG - Intergenic
1067593726 10:47535878-47535900 AATCCTAACCCTCAAGGTGATGG + Intronic
1067640836 10:48043987-48044009 AATCCTAACCCTCAAGGTGATGG + Intergenic
1067872661 10:49976279-49976301 AATCCTAACCCTCAAGGTGATGG - Intergenic
1068241165 10:54302412-54302434 AATCCTAACCCTCAAGATGGCGG + Intronic
1068286271 10:54939928-54939950 AAACCTAACCCCTAAGGTGATGG - Intronic
1068524797 10:58116209-58116231 AATCTTAACCCTCAAGGTGATGG - Intergenic
1068660082 10:59614574-59614596 AATCCTAACCCCCAAGGTGATGG - Intergenic
1069036963 10:63655908-63655930 AAATTTAACCCCCAAGGTGATGG + Intergenic
1069587716 10:69619631-69619653 AAATCTAATCCCCAAGACGATGG - Intergenic
1069764295 10:70841640-70841662 AAATCTAACCCTCAAGCTGATGG - Intronic
1070387259 10:75936827-75936849 AAGCCTAACCCACAAGGTGATGG - Intronic
1070487184 10:76942347-76942369 AATCCTAACCCTCAAGGCGATGG - Intronic
1070653066 10:78252031-78252053 AATCCTAACCCCCAAGGTGATGG - Intergenic
1071200596 10:83217761-83217783 AATCCTAACCTTCAAGGTGATGG - Intergenic
1071237665 10:83667977-83667999 AATTCTAACCCTCTATGTGATGG + Intergenic
1071493195 10:86150679-86150701 AATCCTAACCCTCAAGGTGATGG + Intronic
1072573248 10:96676848-96676870 GAATCTAACCCTTGAGCTGCCGG + Intronic
1072991931 10:100204133-100204155 AATTCTGACCCTGAAGGTGAAGG - Intronic
1073969044 10:109026120-109026142 AAACCTAACCACCAAGATGAAGG + Intergenic
1074610130 10:115013993-115014015 AATCCTAACCCTCAAGGTGATGG - Intergenic
1074672177 10:115804341-115804363 AATCCTAACCCTCAATGTGATGG + Intronic
1074962765 10:118463158-118463180 AATCCTCACCCTCAAGGTGATGG + Intergenic
1074983291 10:118636540-118636562 AAGCCTAACCCCCAAGGTGATGG - Intergenic
1075503944 10:123005614-123005636 AATTCTAACCCCCAATTTGATGG + Intronic
1075517429 10:123119843-123119865 AATCCTAACCCTCAATGTGATGG + Intergenic
1075613596 10:123874416-123874438 AATGCTAACCCACAAGGTGATGG - Intronic
1075657248 10:124170115-124170137 AATCCTAATCCTCAAGGTGATGG + Intergenic
1076111196 10:127861049-127861071 AATCCTGACCCTCAAGGTGATGG + Intergenic
1076440298 10:130476805-130476827 AAACCCAACCCCCAAGGTGATGG - Intergenic
1076445668 10:130512234-130512256 AAACCTAACCCCTAAGGTGATGG - Intergenic
1078992189 11:16660636-16660658 AATACTAACCCACAAGGTGATGG + Intronic
1079381007 11:19937303-19937325 AATTCTCTCCCTCAAGCTTATGG + Intronic
1080025026 11:27604496-27604518 AAACCTAACCCCCAAGGTGATGG + Intergenic
1080161050 11:29176893-29176915 AAATATAATCCTCAAGTTAAAGG - Intergenic
1080583815 11:33664519-33664541 AATCCTAACCCCCAAGGTGATGG + Intronic
1081238259 11:40672356-40672378 AATTCTAACTCCCAAGATGATGG - Intronic
1081506709 11:43724730-43724752 AACCCTAACCCACAAGGTGATGG - Intronic
1081544585 11:44061140-44061162 AATCCTAACCCCCAAGGTGATGG - Intergenic
1081838198 11:46175273-46175295 AATCCTAACCCTCAATATGATGG + Intergenic
1082681918 11:56184258-56184280 AATCCTAACCCCCAAGGTGATGG - Intergenic
1082896875 11:58201144-58201166 AATCCTAACCCTCAAACTGATGG - Intergenic
1083538409 11:63492478-63492500 AATTCTAACCCCCAAAGTGATGG + Intergenic
1084576925 11:69994721-69994743 AAATGTAACATGCAAGCTGATGG - Intergenic
1085235879 11:75015098-75015120 AAACCTAACACCCAAGATGATGG + Intronic
1086111701 11:83206480-83206502 AAATCTTAACCCCAAGGTGATGG + Intronic
1086859722 11:91911071-91911093 AATACTAACCCCCAAGGTGATGG + Intergenic
1087138469 11:94742977-94742999 AAACCTAATCCTCAATGTGATGG - Intronic
1087756924 11:102064034-102064056 AGCTCTAACCCTCAACGTGATGG - Intronic
1087934521 11:104016990-104017012 AATTCTAACCCTCGAGGTGATGG + Intronic
1088183383 11:107137056-107137078 GATTCTAAACCTCAAGGTGATGG + Intergenic
1088713411 11:112528063-112528085 AGATCTAACCCTCAATGTGATGG + Intergenic
1088724884 11:112625404-112625426 AAACCTAATCATCAAGGTGATGG + Intergenic
1088755673 11:112883271-112883293 AATTCCAACCCTGGAGCTGAGGG + Intergenic
1089071966 11:115707494-115707516 AATTCTAACCCCCAATGTGATGG - Intergenic
1089180544 11:116580308-116580330 AAATCAAACCCTCCGTCTGATGG + Intergenic
1089393959 11:118122812-118122834 AATCCTAACCCCCAAGGTGATGG + Intergenic
1090027490 11:123180308-123180330 AATCCTAACCCTCAAGGTGCTGG + Intronic
1090047163 11:123346022-123346044 AATCCTAACCCCCAAGGTGATGG + Intergenic
1090687131 11:129134692-129134714 AAACCTAACGCCCAAGGTGAGGG + Intronic
1090886420 11:130880908-130880930 AATCCTAACCCTCAAGGTGATGG + Intronic
1090980482 11:131716282-131716304 AATTCTAACTCTCAAGGTGATGG - Intronic
1091194222 11:133718058-133718080 AAACCTAACCCTCGAGGTGATGG - Intergenic
1091316022 11:134614678-134614700 AATCCTAACCCCCAAGGTGATGG + Intergenic
1092123383 12:6059698-6059720 AATCCTAACCCCCAAGGTGATGG - Intronic
1093331888 12:17853763-17853785 AATACTAACCCTCAAGGTGATGG + Intergenic
1093451995 12:19326416-19326438 AAATCTAAGCCCCAAGCATAAGG + Intronic
1093555177 12:20464316-20464338 AAATATAACCCTCATTTTGAAGG - Intronic
1093754058 12:22832902-22832924 AAAACTAACCCCCAAGGTGATGG + Intergenic
1094126455 12:27027862-27027884 AAATCTAATCCCCAATGTGATGG - Intronic
1094520794 12:31186525-31186547 AAATCTAGTCCTCAAGATGTGGG + Intergenic
1095127059 12:38492142-38492164 AATCCTAACCCCCAAGGTGATGG - Intergenic
1096911709 12:54990667-54990689 AACTTTAACCCCCAAGGTGATGG - Intergenic
1097816893 12:64084406-64084428 AAATCTAATCCTCAGACTGCTGG + Intronic
1098228800 12:68351978-68352000 AATCCTAACCCCCAAGGTGATGG + Intergenic
1098798090 12:74919278-74919300 AATTCTAAACCTCAAGGTGACGG + Intergenic
1099390357 12:82071661-82071683 AAATCTAACCCACAATGTGATGG + Intergenic
1099648468 12:85392203-85392225 AATTCTAACCCCCAATGTGATGG - Intergenic
1099790923 12:87332528-87332550 AATTCTAACACCCAAGGTGATGG + Intergenic
1099792263 12:87350565-87350587 AATCCTAACCCTCAACATGATGG - Intergenic
1099892104 12:88602693-88602715 AATTCTAACCCCCAATGTGATGG + Intergenic
1100196928 12:92256722-92256744 AAATAGAAACCTCAAGCTGGAGG + Intergenic
1100252382 12:92840857-92840879 AACTCTAACCCTCAAGGAGATGG + Intronic
1100393932 12:94168482-94168504 AAGTCTAACTCCCAACCTGAAGG - Intronic
1100406588 12:94277315-94277337 AATCCTAACCCCCAAGGTGATGG - Intronic
1100468571 12:94871261-94871283 AATCCTAACCCTCAAGGTGATGG - Intergenic
1100567033 12:95806479-95806501 AAACCTAACCCCCAAGGTGATGG + Intronic
1100593668 12:96053312-96053334 AATCCTAACCCCCAAGTTGATGG + Intergenic
1100610067 12:96184585-96184607 AATTCTAACCCCCAAGGTGATGG + Intergenic
1100722979 12:97378329-97378351 AATTCTAACCCCCAAGCTAATGG + Intergenic
1101158923 12:101954044-101954066 AATCCTAACCCCCAAGGTGATGG - Intronic
1101400685 12:104384197-104384219 AAACTTAACCCCCAAGGTGATGG + Intergenic
1101539832 12:105654784-105654806 AATTCTAATCCCCAAGGTGAAGG + Intergenic
1101731959 12:107434055-107434077 AATTCTAACCCACAATGTGATGG - Intronic
1101734539 12:107453329-107453351 AATTCTAACCCCCAAGGTGATGG + Intronic
1101983792 12:109430073-109430095 AAATCTAACTCCCAATGTGATGG - Intronic
1102262449 12:111452361-111452383 AATTCTTACCGTCAAACTGACGG - Exonic
1102414300 12:112747185-112747207 AATTCTAACCTTCAAGGTTATGG + Intronic
1102543825 12:113640695-113640717 AAATCAAACCCTAAATTTGAAGG + Intergenic
1102734858 12:115150363-115150385 AATCCTAACCCTCAAGGTGATGG - Intergenic
1102812929 12:115839916-115839938 AATCCTTACCCTCAAGGTGATGG - Intergenic
1103067932 12:117915394-117915416 AATTCTAACCCTTAATGTGATGG - Intronic
1103195169 12:119037420-119037442 AAATCCAATCCTCATTCTGAAGG - Intronic
1104809772 12:131613092-131613114 AATGCTAACCCCCAAGGTGATGG - Intergenic
1105012282 12:132763729-132763751 AACCCTAACCCCCAAGGTGATGG + Intergenic
1105610176 13:21961930-21961952 AAACCTAACTCCCAAGGTGATGG + Intergenic
1105810309 13:23989741-23989763 AAATCTAACCCCCAATGTGATGG + Intronic
1105929347 13:25037562-25037584 AAATCTAAGCCCCAAGATGATGG - Intergenic
1106409181 13:29499114-29499136 AAACCTAACCCCCAAAGTGATGG - Intronic
1106820403 13:33457832-33457854 AAATCTAACCCCCAATATGATGG - Intergenic
1107174158 13:37380389-37380411 AACTCTAAACCCCAAGATGATGG - Intergenic
1107372671 13:39769698-39769720 AAACCTAACCCCCAAGGTAATGG + Intronic
1108254146 13:48594526-48594548 AATCCTAACCCCCAAGGTGATGG + Intergenic
1108863929 13:54898950-54898972 AATCCTAACCCCCAAGTTGATGG + Intergenic
1109796969 13:67328146-67328168 AATCCTGACCCTCAAGGTGATGG + Intergenic
1110169536 13:72484302-72484324 AAATCTAATCCCCAATGTGACGG - Intergenic
1110379745 13:74836526-74836548 AATGCTAACCCCCAAGGTGATGG - Intergenic
1110417084 13:75264791-75264813 AAACCTAACCCCCATGGTGAAGG - Intergenic
1110496988 13:76179568-76179590 AAATGTAAGGCTTAAGCTGATGG + Intergenic
1110759540 13:79216135-79216157 AATTCTAACTCTCAATCTGATGG - Intergenic
1110792595 13:79601891-79601913 AAACCTAACCATCAAGGTGATGG + Intergenic
1110950630 13:81485698-81485720 AATTCCAACCCCCAAGGTGATGG + Intergenic
1111002450 13:82203957-82203979 AATTCTAACCCCCAAGGTGATGG + Intergenic
1111353316 13:87062641-87062663 AAATCTAACCCTGAGGTGGAAGG - Intergenic
1111809449 13:93080466-93080488 TATTCTAACCCCCAAGGTGATGG - Intergenic
1111986378 13:95070634-95070656 AAATCAGACCCCCAAGCTGGAGG - Intronic
1112034367 13:95483849-95483871 AATGCTAACCCCCAAGGTGATGG + Intronic
1112884050 13:104147135-104147157 AATGCTAACCCACAAGGTGATGG - Intergenic
1113000928 13:105635901-105635923 AATTCTAATCCTCAAGGTGTTGG + Intergenic
1113044620 13:106142124-106142146 AATTCTAACCCTAAAGGTGATGG + Intergenic
1113428462 13:110229572-110229594 AATTCTAACCCCCAAGGTGATGG + Intronic
1113449953 13:110401990-110402012 AAATCTAATCCCCAATCTGCTGG - Intronic
1113565826 13:111319123-111319145 AATCCCAACCCTCAAGATGATGG - Intronic
1113818453 13:113192833-113192855 AATCCTAACCCTCAAAGTGACGG + Intronic
1114962483 14:27911134-27911156 AAATGTAATCCTCAAGCTGGAGG + Intergenic
1115191656 14:30753151-30753173 AAATATAACCCTGACCCTGAAGG - Intergenic
1115197481 14:30817023-30817045 AGCTCTAACCCTCAATGTGATGG + Intergenic
1116071616 14:40053837-40053859 AAATGTGACCCTCAAGCTAATGG - Intergenic
1116111778 14:40594408-40594430 AATGCTAACCCTCAATGTGATGG + Intergenic
1116338909 14:43696911-43696933 AATTCTAACCCGCAAGATGATGG + Intergenic
1116443315 14:44979500-44979522 AAATCTAATCCCCAACGTGATGG - Intronic
1116582237 14:46656870-46656892 AATTCTAACCCCCAAGGTGATGG + Intergenic
1116752103 14:48899431-48899453 AAATCTAACCTCCAATGTGATGG - Intergenic
1117218364 14:53575667-53575689 AATTCTAACTCCCAAGATGACGG - Intergenic
1117678439 14:58178880-58178902 AAATCTCACCCCCAAGGTGATGG - Intronic
1117680832 14:58200826-58200848 AAATCTAACCTTCGAGTTTAGGG - Intronic
1117933402 14:60872328-60872350 AAATGTAATCCTCATGTTGAAGG - Intronic
1118034655 14:61853420-61853442 AATCCTAACCCTCAAGATGATGG + Intergenic
1118437874 14:65787886-65787908 AAACCTCACCCCCAAGGTGATGG - Intergenic
1118450676 14:65898653-65898675 AATCCTAATCCTCAAGGTGATGG + Intergenic
1118597512 14:67447330-67447352 AACTTTAACCTCCAAGCTGATGG - Intronic
1118824397 14:69367286-69367308 AAACCTAACCCCCAAAGTGATGG + Intergenic
1118896772 14:69952002-69952024 AAATAAAACCCTAAAGGTGAAGG - Intronic
1119036372 14:71233012-71233034 AATCCTAACCCCCAAGGTGAGGG + Intergenic
1119150465 14:72354734-72354756 AAATCTAATCCCCAACATGATGG - Intronic
1119876483 14:78064115-78064137 AAATGTAACTTTCAAGGTGATGG + Intergenic
1119915917 14:78401484-78401506 AAATCTAATCCTCATTGTGATGG - Intronic
1120271256 14:82316475-82316497 AAACCTAATCATCAAGATGATGG + Intergenic
1120493718 14:85207662-85207684 AAACCTAATTCTCAAGGTGATGG - Intergenic
1120500366 14:85289495-85289517 AATCCTAACCCGCAAGGTGATGG - Intergenic
1120710803 14:87791093-87791115 AATGCGAACCCTCAAGGTGATGG + Intergenic
1120759981 14:88276157-88276179 AAATCTAACCCTCAATGTGACGG + Intronic
1121145936 14:91582470-91582492 AAACCTGACCTTCAAGCTGAAGG + Intronic
1121382760 14:93488909-93488931 AACCCTAACCCTCAAAGTGATGG - Intronic
1121521485 14:94588950-94588972 AAACCTAACCCCCAAGGTGGTGG - Intronic
1121579576 14:95017622-95017644 AAACCTAACCCCCAATGTGATGG - Intergenic
1121627854 14:95399792-95399814 AATGCTAACCCGCAAGGTGATGG - Intergenic
1122171237 14:99877303-99877325 AACCCTAACCCTCAATGTGATGG - Intronic
1123791686 15:23727508-23727530 AATTCTAATCCCCAAGATGATGG + Intergenic
1124056304 15:26243653-26243675 AAACCTAACCCCCAAGGTAATGG - Intergenic
1124639181 15:31384931-31384953 AACTCTAACCCTCAATAGGATGG + Intronic
1124644830 15:31431014-31431036 AATTCTAACCCCCAAGGTGATGG + Intronic
1124685304 15:31777305-31777327 CAACCTAACCCCCAAGGTGATGG - Intronic
1124722717 15:32124730-32124752 AATCCTAACCCCCAAGGTGATGG + Intronic
1125207967 15:37176570-37176592 AGACCTAACCCTCAATGTGATGG + Intergenic
1126183379 15:45807742-45807764 AATCTTAACCCTCAAGTTGACGG - Intergenic
1126204932 15:46034904-46034926 AAATTTAATCCTCAATGTGATGG + Intergenic
1126573879 15:50179587-50179609 AATCCTAACCCTCAATGTGATGG + Intronic
1126935246 15:53699870-53699892 AACTCTTTCCCTCAAGGTGAAGG + Exonic
1127068619 15:55266086-55266108 AAATCTAATCCCCAATGTGATGG + Intronic
1127321938 15:57855500-57855522 AAACCTAACCCCCAAGATGATGG + Intergenic
1127346242 15:58102615-58102637 AATCCTAACCCCCAAGGTGATGG - Intronic
1127399221 15:58569575-58569597 AAATCTAATCCCCAATGTGATGG + Exonic
1127698693 15:61475990-61476012 AAATCTAACCCTTGAGCTGGGGG + Intergenic
1127972437 15:63971943-63971965 AATTCTAACCCCCAAGGTGATGG + Intronic
1128396018 15:67226600-67226622 AAAGATAACCCTCAAAATGAGGG - Intronic
1128702968 15:69817443-69817465 AATCCTAACCCCCAAGATGATGG - Intergenic
1130429633 15:83833476-83833498 AGACCTAACCCTCAAGTTGATGG - Intronic
1130949451 15:88573892-88573914 AAATCTAATCCCCAATGTGAAGG + Intergenic
1131232866 15:90672142-90672164 AATCCTAACCCCCAAGGTGATGG + Intergenic
1131570256 15:93527769-93527791 AAATCTTAACCTCAATGTGATGG + Intergenic
1131659243 15:94496752-94496774 AATTCTAACACCCAAGGTGATGG + Intergenic
1131683670 15:94749409-94749431 AAAGCTAACCCCCAAGGTGATGG - Intergenic
1131714104 15:95089911-95089933 AAACCTAACCCCCAATGTGATGG + Intergenic
1131894504 15:97011478-97011500 AATCCTAACCCCCAAGGTGATGG - Intergenic
1132011009 15:98276733-98276755 AATCCTAACCCCCAAGGTGATGG + Intergenic
1133912604 16:10079472-10079494 AAACCTAATCCTCAATGTGATGG + Intronic
1134569473 16:15279159-15279181 AAGTCTAACCCCCAATGTGATGG - Intergenic
1134732904 16:16476890-16476912 AAGTCTAACCCCCAATGTGATGG + Intergenic
1134908814 16:18005475-18005497 AATTCTAACCCCCAATATGACGG - Intergenic
1134908898 16:18006222-18006244 AATTCTAACCCCCAATGTGATGG - Intergenic
1135204597 16:20472491-20472513 AGCTCTAACCCTCAACTTGATGG - Intronic
1135214292 16:20551320-20551342 AGCTCTAACCCTCAACTTGATGG + Intronic
1137542297 16:49373055-49373077 AATCCTAACCCCCAAGGTGATGG - Intergenic
1137626117 16:49909855-49909877 AAGACTAACCCTCAATGTGATGG - Intergenic
1138320127 16:56104683-56104705 AAATCTAACCCCCAATGTGATGG + Intergenic
1138589380 16:57991432-57991454 ACATCCAATCCTCAAGCAGATGG - Intergenic
1138699603 16:58848546-58848568 AACTCTAATCCTCAATGTGATGG + Intergenic
1139306942 16:65994778-65994800 AATTCTTACCCTCAAAGTGATGG + Intergenic
1140876192 16:79154637-79154659 AAATACAACCCTTATGCTGATGG + Intronic
1140988722 16:80186883-80186905 AAATATAACCCTCAAACTTTAGG - Intergenic
1141417076 16:83884008-83884030 AATCCTAACCCCCAAGGTGATGG + Intergenic
1141782390 16:86172110-86172132 AATCCTAACCCTCAATGTGATGG + Intergenic
1143213143 17:5204247-5204269 AAATCTAACCCCCAAGATGATGG + Intergenic
1143250892 17:5522267-5522289 AATTCTAACCCCCAAGGTGATGG + Intronic
1143743566 17:8972990-8973012 AAGCCTAACCCCCAAGGTGATGG + Intergenic
1143908137 17:10226184-10226206 AAACCTAACCCTCAATGTGTTGG - Intergenic
1144044754 17:11445290-11445312 CATTCTAAACCTCAAGGTGATGG - Intronic
1144125903 17:12202710-12202732 AAACCTAACCCCCAATGTGATGG + Intergenic
1144585508 17:16485283-16485305 AATCCTAACCCCCAAGGTGATGG + Intronic
1144671584 17:17135731-17135753 AATCCTAACCCCCAAGGTGATGG - Intronic
1145944557 17:28763427-28763449 ACATTTAACTCTCAGGCTGAAGG - Intronic
1146592295 17:34137914-34137936 AAATCTTAACCCCAAGCTGATGG - Intronic
1146684093 17:34828764-34828786 AATTCTAACCCCCAAGGTGATGG + Intergenic
1146892451 17:36514801-36514823 AAGTCTCAGCCTCAAGCTCAGGG + Intronic
1147117332 17:38311290-38311312 AATCCTAACCCCCAAGGTGATGG + Intronic
1148412350 17:47478296-47478318 AATCCTAACCCCCAAGGTGATGG - Intergenic
1149373607 17:56021550-56021572 AATTCTAACCCCCAAGGTGTAGG + Intergenic
1149381714 17:56100954-56100976 AATTCTAACCTTCAATGTGATGG + Intergenic
1149879704 17:60276522-60276544 AAATCTAACCCTGAAACAAAAGG + Intronic
1150189431 17:63222247-63222269 AATTCTAACCCCCAAGGTGATGG - Intronic
1150950228 17:69795339-69795361 AATCCTAACCCCCAAGGTGATGG + Intergenic
1151009690 17:70480358-70480380 AATTCTAATCCTCAAGGTGATGG + Intergenic
1151880413 17:76891352-76891374 AATCCTAACCCTCAATGTGATGG - Intronic
1152984460 18:309048-309070 AAATCTAAACCTCAGGCTTGGGG + Intergenic
1153273047 18:3342057-3342079 AAATCTAACCCCCATGGTGATGG - Intergenic
1153470301 18:5437160-5437182 GAATCCTACCCTCAAGGTGATGG + Intronic
1153646393 18:7199696-7199718 AATCCTAACCCCCAAGATGATGG - Intergenic
1154088778 18:11336649-11336671 AAATAAAACCCTGCAGCTGAAGG + Intergenic
1154957566 18:21274300-21274322 AATCCTAACCCCCAAGGTGATGG - Intronic
1155013049 18:21801877-21801899 GAAGGGAACCCTCAAGCTGATGG - Intronic
1155352122 18:24917331-24917353 TAATCTAAACCTCATGCTGGTGG - Intergenic
1155845786 18:30704468-30704490 AAATATAACCCTGATCCTGAAGG + Intergenic
1156048106 18:32900003-32900025 ACTTCTAACCCTCCAGCAGATGG + Intergenic
1156149888 18:34228477-34228499 AATCCTAACCCCCAAGGTGATGG + Intergenic
1156455618 18:37291936-37291958 AATTCTAAACCCCAAGGTGATGG + Intronic
1156857784 18:41802562-41802584 AAATCTAACCCCCAAAGTGAGGG + Intergenic
1156867439 18:41904582-41904604 AAATCTAATCCCCAATATGAGGG + Intergenic
1157137909 18:45075281-45075303 AATCCTAACCCCCAAGATGATGG - Intergenic
1157144235 18:45144987-45145009 AAATCTAACCCTTAAAGTTATGG + Intergenic
1157423299 18:47563874-47563896 AAATCTAAGCCCCAAGGTGATGG + Intergenic
1157818850 18:50750822-50750844 AATTCTAACCCCCAAGGTGATGG + Intergenic
1158088652 18:53683891-53683913 AAATAGAACCCTCAAGCTCTTGG + Intergenic
1158379049 18:56907860-56907882 AAATGTAACCCCCAAGGTGATGG - Intronic
1160670399 19:359861-359883 AATTCCCACCCTCAAGGTGATGG - Intergenic
1161750080 19:6089479-6089501 AAACCTAACCCCCAATATGACGG + Intronic
1161996621 19:7716884-7716906 AAACCTAACCTCCAAGATGACGG + Intergenic
1162888736 19:13716465-13716487 AAACCTAATCCTCAATGTGATGG - Intergenic
1163295135 19:16406847-16406869 AATTCTCACCCCCAAGATGATGG + Intronic
1164603301 19:29578048-29578070 AATCCTAACCCTCAAAATGATGG + Intergenic
1164963587 19:32459223-32459245 ATATCTACCCATCAAGCTGCTGG + Intronic
1165135808 19:33667857-33667879 AAATCTATAAATCAAGCTGAGGG + Intronic
1165253999 19:34562069-34562091 AAATCTAATCATCAATATGATGG - Intergenic
1167735256 19:51290666-51290688 AATCCTAACCCCCAAGATGATGG + Intergenic
1167815360 19:51876066-51876088 GTTTCTAACCCTGAAGCTGAGGG + Intronic
925214110 2:2078896-2078918 AATTCTAACCCCCAAGGTAATGG + Intronic
928136909 2:28694663-28694685 AATCCTAACTCTCAAGGTGATGG - Intergenic
929448169 2:42016425-42016447 AATCCTAACCCCCAAGGTGATGG - Intergenic
930194862 2:48499089-48499111 AACTCTAACCCCCAAGGTGATGG - Intronic
930207447 2:48602191-48602213 AAACCTAACCCCCAAGATGATGG - Intronic
930485193 2:52002484-52002506 AATCCTAACCCTCAAGGTGATGG - Intergenic
930542306 2:52721994-52722016 AAATCTCACCCTCAGGCTGGTGG + Intergenic
930547336 2:52785415-52785437 AATTCTAATCCCCAAGATGATGG + Intergenic
930602541 2:53458644-53458666 AATCCTAACCCTCAAGGTGATGG + Intergenic
930620626 2:53639718-53639740 AATTCTAACCCCCAAACTGAGGG + Intronic
930886490 2:56332525-56332547 AAACCTAACCTCCAAGGTGAGGG - Intronic
931972806 2:67608327-67608349 AATCCTAACCCTCAAGGTGATGG - Intergenic
932941303 2:76170029-76170051 AAATCTAATCACCAAGCTGATGG + Intergenic
932982698 2:76689042-76689064 AATTCTGACCCCCAAGCTGATGG - Intergenic
933089478 2:78103501-78103523 AAACCCAACCTTCAAGTTGAAGG + Intergenic
933850506 2:86362814-86362836 AATCCTAACCCCCAAGGTGATGG + Intergenic
934521258 2:95021511-95021533 AATCCTAACCCCCAAGATGATGG + Intergenic
934987148 2:98895794-98895816 AAATCTTAACCCCAAGCTGATGG + Intronic
935607065 2:104981880-104981902 AAACCTAACTCCCAAGGTGATGG - Intergenic
935645792 2:105333203-105333225 AAACCTAACCCTCAAGGTGATGG + Intergenic
936458287 2:112692390-112692412 AAATCAAATCCTCAAGTTTAGGG + Intergenic
936599840 2:113884931-113884953 AAATTTAACCCCCAGGGTGATGG - Intergenic
936650708 2:114422898-114422920 ATATCTTACCCTCTGGCTGAAGG + Intergenic
936707144 2:115088210-115088232 AATTCTAACACCCAAGGTGATGG - Intronic
936708346 2:115102315-115102337 AACTCTAACCCTAAAAATGATGG - Intronic
937134331 2:119539968-119539990 AAACCTAACCCACAAGGTGATGG + Intergenic
937238056 2:120442434-120442456 AAATCAAGCCCCGAAGCTGAAGG + Intergenic
937460792 2:122084007-122084029 AAACCTAATCCCCAAGGTGATGG + Intergenic
937514963 2:122642699-122642721 AAACCTAACCCCCAAGGTCACGG + Intergenic
937714541 2:125016446-125016468 AAATCTAACACTCTAGCAGGAGG + Intergenic
938241341 2:129744560-129744582 AAATCTAACCCCCAGGGTGAAGG - Intergenic
938803630 2:134786347-134786369 AATCCTAACCCTCAAGATGCTGG + Intergenic
938933818 2:136111372-136111394 AATCCTAACCCTCAAGGTGATGG - Intergenic
938971626 2:136438300-136438322 AAACCTAATCCTCAAGGGGAAGG + Intergenic
939077196 2:137617947-137617969 AATCCTAACCCTCTAGGTGATGG - Intronic
939173033 2:138717604-138717626 AATTCTAACTCCCAAGGTGATGG - Intronic
939236838 2:139504901-139504923 AAATCTAATCATCAATGTGATGG + Intergenic
939773788 2:146358919-146358941 AATTCTAACCCCCAAGGTGATGG + Intergenic
939878292 2:147602220-147602242 AAATCTAACCCCCAAGGTGATGG - Intergenic
939949821 2:148456404-148456426 AATCCTAACCCCCAAGGTGATGG - Intronic
940848955 2:158670454-158670476 AATTCCAACCCCCAAGGTGATGG - Intronic
940877295 2:158910864-158910886 AAACCTAACCCTCAATGTGATGG + Intergenic
941449739 2:165645438-165645460 AATTCTAACCCCCAAGGTGATGG - Intronic
941913573 2:170791333-170791355 AAATTTTACCCTCATGATGATGG + Intronic
941913696 2:170793165-170793187 AAATTTTACCCTCATGATGATGG + Intronic
942294237 2:174502098-174502120 AAATGGAACCATCAAACTGATGG + Intergenic
942709139 2:178812950-178812972 AAATCTAACCCCAAAGGTGATGG + Intronic
943122044 2:183748778-183748800 AATCCTAACCCCCAAGGTGATGG + Intergenic
944150752 2:196555441-196555463 AAATCTAACCTGCAATGTGATGG - Intronic
945063991 2:205932896-205932918 AATCCTAACCCCCAAGGTGAAGG + Intergenic
945241303 2:207679363-207679385 AAACCTAATCCTCAAGGCGATGG - Intergenic
945282277 2:208047236-208047258 AATCCTAACCCTCAAGGTGAAGG + Intergenic
945370393 2:209009215-209009237 AAATCCTATCCTCAAGGTGATGG - Intergenic
945566277 2:211404141-211404163 AAAAATAACGCTGAAGCTGAAGG - Intronic
946038519 2:216764174-216764196 AAACCTAACCATGAAGCTGGTGG + Intergenic
946079285 2:217103262-217103284 AATCCTAACCCCCAAGGTGACGG - Intergenic
946796777 2:223362760-223362782 AATTCTAACCCTCAAGGTGATGG + Intergenic
946890985 2:224276269-224276291 GAAGCTAACCCTCAAGGTGATGG + Intergenic
947436452 2:230076886-230076908 AAACCTAACCCCCAAGGTGATGG - Intergenic
948097341 2:235346938-235346960 AATTCTAGCCCCCAAGGTGATGG - Intergenic
948228849 2:236334959-236334981 AAATCCACCCCCCAGGCTGATGG - Intronic
948281564 2:236751213-236751235 AAACCTAACCCTCAAAGTGATGG - Intergenic
948360627 2:237417624-237417646 AATTCTAACCCCCAAAGTGATGG + Intergenic
948784497 2:240345245-240345267 AAAACTACCCCTGAAGGTGATGG + Intergenic
1168884060 20:1232766-1232788 AAACCTAACCTTCAAGGTGATGG + Intronic
1168906013 20:1404434-1404456 ATTTCTAACCCACAAGGTGATGG - Intergenic
1170975558 20:21160708-21160730 AATTCTAATCCCCAAGGTGATGG + Intronic
1173291528 20:41719145-41719167 AATCCTAACCCCCAAGGTGATGG - Intergenic
1173321688 20:41993001-41993023 ACATCTAGACCTTAAGCTGAGGG - Intergenic
1174700646 20:52605134-52605156 AATCCTAACCCCCAAGGTGATGG + Intergenic
1174822584 20:53739958-53739980 ATCTCTTACTCTCAAGCTGAAGG - Intergenic
1177111386 21:17033370-17033392 AATTCTAACACCCAAGGTGATGG - Intergenic
1177217808 21:18151907-18151929 AATCCTAACCCTCAATGTGATGG - Intronic
1177394867 21:20520572-20520594 AAACCTAACCACCAAGATGATGG - Intergenic
1177550630 21:22616817-22616839 AAATCTGACCATCTAGCTAAAGG - Intergenic
1177762285 21:25415241-25415263 AAATCTAACCCACAATGTGATGG - Intergenic
1177959558 21:27645803-27645825 AATTCTCACCTTCAAGGTGATGG + Intergenic
1178047525 21:28712032-28712054 AAATGTAATCCCCAAGGTGATGG - Intergenic
1178136863 21:29637495-29637517 AATTCTAACCCTCAAGACAATGG + Intronic
1178173792 21:30073808-30073830 AATTCTAACCCTCATGGTGATGG - Intergenic
1178733649 21:35129483-35129505 AATTCTAACCCCCAAGATGATGG - Intronic
1178745962 21:35250630-35250652 AATTCTAACCTTCAATGTGATGG + Intronic
1179131465 21:38641160-38641182 AATCCTAACCCTCAAGGTAATGG + Intronic
1179149797 21:38800093-38800115 AAACCTAACCCCCGAGGTGATGG + Intergenic
1179240713 21:39588684-39588706 AATCCTAACCCCCAAGGTGATGG - Intronic
1181347597 22:22231448-22231470 AATCCCAACCCCCAAGCTGATGG + Intergenic
1181486676 22:23235937-23235959 AAATCTAACCCCCAATGTGATGG - Intronic
1182483559 22:30625847-30625869 AAACCTAACCCCAAAGGTGATGG - Intronic
1182719040 22:32383124-32383146 AATTCTAACCCTCAATCTCATGG + Intergenic
1182892527 22:33830965-33830987 AAACCTAACTTTCAAGGTGATGG - Intronic
1183012405 22:34957698-34957720 AATTCTAACCCTCAAGGTGATGG - Intergenic
1183210255 22:36446909-36446931 AATCCTAACCCCCAAGGTGATGG - Intergenic
1183261064 22:36796288-36796310 AAACCCAACTCTCAAGGTGATGG - Intergenic
1183388740 22:37530853-37530875 AATCCTAACCTTCAAGGTGATGG - Intergenic
1183729942 22:39612678-39612700 AATTCTATCCCCCAAGGTGATGG - Intronic
1184509391 22:44924437-44924459 AATCCTAACCCTCAATGTGATGG + Intronic
949371221 3:3336656-3336678 AAATCTAACCCACACTGTGATGG + Intergenic
949657198 3:6234303-6234325 AATTCTAATCCCCAAGGTGATGG + Intergenic
949792032 3:7803047-7803069 ACATCTACCCATCAAGCTGGAGG - Intergenic
949846896 3:8380751-8380773 AACCCTAACCCTCAATGTGATGG + Intergenic
951108233 3:18770410-18770432 AAACCTAACCACCAAGGTGATGG - Intergenic
951271780 3:20634050-20634072 AATCCTAACCCTCAATGTGATGG + Intergenic
951527464 3:23667770-23667792 AAACCTAACCCCCAAGGTGATGG + Intergenic
951628236 3:24690106-24690128 AATCCTAACCCCCAAGGTGATGG - Intergenic
951890490 3:27563674-27563696 AAATCCAACCCCCAAGGTGATGG - Intergenic
952380233 3:32798718-32798740 AATCCTAACCCCCAAGGTGATGG - Intergenic
952686813 3:36159514-36159536 AATTCTAATCCTCAAGGTGATGG - Intergenic
953548043 3:43878726-43878748 AACTCTAACCCCTAAGGTGATGG + Intergenic
955129458 3:56150825-56150847 AGCTCTAACCCTCAATGTGATGG + Intronic
955797513 3:62653197-62653219 AAATCTAACCCTCAATGTTATGG + Intronic
956146059 3:66191930-66191952 AATTCTAACCCCCAATCTGATGG + Intronic
956459672 3:69458820-69458842 CAGTCTAACCTTGAAGCTGATGG + Intronic
957318049 3:78593288-78593310 AATTCTAACCCCCAATGTGATGG - Intergenic
957937552 3:86964533-86964555 AATCCTAACCCCCAAGGTGATGG + Intronic
958582753 3:96047358-96047380 AATCCTGACCCTCAAGATGATGG + Intergenic
959677286 3:109050536-109050558 AAATCTGACCCCCAGGATGATGG - Intronic
959714464 3:109417331-109417353 AATTCTAACCCCCAATGTGATGG - Intergenic
959811686 3:110627282-110627304 AAATCTAACTCCCAAGGTGATGG + Intergenic
960103229 3:113766685-113766707 AATTCCAACCCTCAATGTGATGG - Intronic
960635115 3:119777214-119777236 AATCCTAACCCCCAAGGTGATGG - Intergenic
960776479 3:121262147-121262169 CCATCTAATCCTCAAGGTGATGG - Intronic
961251775 3:125513092-125513114 AATCCTAACACTCAAGGTGATGG + Intronic
961360293 3:126363059-126363081 AATCCTAACCCCCAAGGTGATGG + Intergenic
961776022 3:129286211-129286233 AATCCTAACCCCCAAGATGATGG + Intronic
961927148 3:130493152-130493174 AACTGTAACCCGCAAGGTGATGG + Intergenic
962455436 3:135561245-135561267 AATCCTAACCCCCAAGGTGATGG + Intergenic
963019496 3:140859196-140859218 AAACCTAAACCCCAAGGTGATGG + Intergenic
964011211 3:151894247-151894269 AAATCTAATCTCCAAGGTGATGG + Intergenic
964015839 3:151945465-151945487 AATCCTAACCCCCAAGGTGATGG + Intergenic
964024944 3:152061374-152061396 AAATCTAGCCCCCAAGTTAATGG + Intergenic
964203641 3:154146316-154146338 AATCCTAACCCCCAAGGTGATGG - Intronic
964222509 3:154363613-154363635 AAATCCAACCTTCAAGCCAAGGG + Intronic
964445898 3:156756978-156757000 AATCCTAACCCTCAAGGTGATGG + Intergenic
964838491 3:160967599-160967621 AAAACTAATCCTCATGGTGATGG - Intronic
964915757 3:161839216-161839238 AATCCTAACCCTCAATGTGATGG + Intergenic
965759823 3:172063883-172063905 AAATCTAACCCCCAAGTTGATGG + Intronic
965767175 3:172143057-172143079 AATTCTAACCCCAAAGGTGATGG - Intronic
965957312 3:174386667-174386689 AATTTTAACCCCCAAGGTGATGG - Intergenic
966059838 3:175741404-175741426 AAATCTAACCCCTAAAGTGATGG - Intronic
966263062 3:178003080-178003102 AATCCTAACCCTCAACATGATGG + Intergenic
966758908 3:183397505-183397527 AAACCTAACCCCCGAGGTGATGG - Intronic
966765626 3:183459388-183459410 AATTCTAACCCTCAGTGTGAGGG - Intergenic
967259179 3:187625301-187625323 AAACCCAACCCCCAAGGTGATGG + Intergenic
967911459 3:194545773-194545795 AATTCTAACACCCAAGATGATGG - Intergenic
969385070 4:6839234-6839256 AAATCTAAACCTGACGGTGATGG - Intronic
969547088 4:7837280-7837302 AATCCTAACCCTCAAGAGGATGG + Intronic
969965214 4:10987060-10987082 AAATCTAATCACCAATCTGATGG + Intergenic
970012873 4:11479900-11479922 AAATCTAATCCCCAAGGTGATGG - Intergenic
970055854 4:11971295-11971317 AATTCTAACCCCCAAGCTGATGG - Intergenic
970284349 4:14493439-14493461 AAACCTAACCCCAAAGGTGATGG + Intergenic
970340054 4:15096847-15096869 AAACCTAAACCCCAAGCTGATGG + Intergenic
970550697 4:17178088-17178110 AATCCTAACCCCCAAGGTGATGG - Intergenic
970931980 4:21522936-21522958 AATACTAACATTCAAGCTGATGG + Intronic
971246662 4:24935462-24935484 AAACCTAACCCCCAATATGAAGG + Intronic
971326147 4:25645470-25645492 AAACCTAATCATCAAGGTGATGG - Intergenic
971424730 4:26504585-26504607 AATCCTAACCCCCAAGGTGATGG + Intergenic
971459621 4:26881065-26881087 AAACCTAAACCTCAAGGTGATGG + Intronic
971749925 4:30633666-30633688 AATCCTAACCCCCAAGGTGATGG - Intergenic
972268309 4:37484119-37484141 AATCCTAACCCACAAGATGATGG + Intronic
972342850 4:38167546-38167568 AATCCTAACCCCCAAGGTGATGG - Intergenic
972383028 4:38536630-38536652 AAATCTAACCCCCAATGTGATGG + Intergenic
972411622 4:38801155-38801177 AATCCTAACCCCCAAGGTGATGG + Intronic
972914042 4:43853736-43853758 AATCCTAACCCTCAATGTGAAGG - Intergenic
973163937 4:47053531-47053553 AATCCTAACCCTCAATGTGATGG - Intronic
973855033 4:55002796-55002818 AATCCTAACCCCCAAGCTGATGG + Intergenic
973986324 4:56357430-56357452 AAATCTAATCCCCAATCTGTTGG - Intronic
974031982 4:56784449-56784471 AATCCTAACCCTCAATGTGATGG + Intergenic
974300815 4:60065005-60065027 AATTCTAATCCCCAATCTGATGG - Intergenic
974331265 4:60482094-60482116 AAACCTAATCCTCAATGTGATGG + Intergenic
974511520 4:62848240-62848262 AATTGTAACCCCCAAGGTGATGG - Intergenic
974821761 4:67075678-67075700 AAATTTAACCTCCAAGGTGATGG + Intergenic
976776407 4:88711142-88711164 AAACCTAGCCCCCAAGATGATGG + Intergenic
976952095 4:90846244-90846266 TAATTTAACTCTCACGCTGAAGG - Intronic
977075825 4:92447866-92447888 AATTCTAACCCATAAGGTGATGG - Intronic
977465070 4:97373612-97373634 AATCCTAGCCCTCAAGGTGATGG + Intronic
978374422 4:108060089-108060111 AAATCAAACCCTCAAACTAGAGG + Intronic
978375308 4:108068998-108069020 AATTCTAACCCCCAATGTGATGG + Intronic
978768941 4:112433439-112433461 AGTTCTAACCCACAAGGTGATGG - Intronic
979116968 4:116836967-116836989 AATCTTAACCCTCAAGGTGATGG + Intergenic
979646051 4:123070664-123070686 AAATCTAACCCCCAAAGTGATGG - Intronic
979749956 4:124266806-124266828 AAATATATCCCACATGCTGAGGG - Intergenic
980179350 4:129385248-129385270 AAATCTAACCATCAATGTGATGG + Intergenic
981009562 4:139911606-139911628 AATCCTAACCCCCAAGGTGAGGG + Intronic
981330444 4:143502320-143502342 AATTCTAACTCTCAAGTTAATGG - Intergenic
981676812 4:147351956-147351978 AATTCTCACCCCCAAGGTGATGG - Intergenic
981916701 4:150041592-150041614 AAATCTAACCCACAAGGTGATGG - Intergenic
982079793 4:151778223-151778245 AAACCTAACCCCCAAGGTAATGG - Intergenic
982091295 4:151882041-151882063 AAATCTAACCCCCAAGATGATGG - Intergenic
982126013 4:152184583-152184605 AATCCTAACCCCCAAGGTGACGG + Intergenic
982142171 4:152335175-152335197 AATCCTAACCCTCAATGTGATGG + Intronic
982165185 4:152607787-152607809 AAATCTAATCACCAAGATGATGG + Intergenic
982219340 4:153111563-153111585 AAACCTAACCCCCAAGGTGGTGG + Intergenic
983118725 4:163852837-163852859 AATCCTAACCCCCAAGGTGATGG + Intronic
983488283 4:168357601-168357623 AATTCTAACCCTCAATGTGATGG - Exonic
983795333 4:171854844-171854866 AAACCTAATCCTCAATGTGATGG - Intronic
984136574 4:175948222-175948244 AATCCTAACCCTCAAAGTGATGG + Intronic
984598029 4:181693741-181693763 AAATCCTACCCTCAGGCAGAAGG + Intergenic
984600390 4:181719649-181719671 AACCTTAACCCTCAAGGTGATGG - Intergenic
985198868 4:187463119-187463141 AAACCTAACCCCCAAGGTGATGG + Intergenic
985342167 4:188966415-188966437 AAATCTAAACCACTAGTTGATGG + Intergenic
985850674 5:2386675-2386697 AAATATAACCCTTTATCTGAAGG - Intergenic
986135989 5:4978450-4978472 AACTGTAATCCTCAAGCTGGAGG + Intergenic
986284777 5:6351132-6351154 AAATATTGCCCTCAAGATGAAGG - Intergenic
986293776 5:6420946-6420968 AAAAATAACCATAAAGCTGAAGG - Intergenic
986673933 5:10167509-10167531 AATTCTAACCCCCAAAGTGATGG - Intergenic
986688360 5:10293513-10293535 AATCCTAACCCTCAAGGTGATGG - Intronic
986727810 5:10612462-10612484 AATCCTAACCCTCACGGTGATGG - Intronic
986734985 5:10661927-10661949 AAATCTCTCCCTCACGCAGATGG - Intergenic
986788301 5:11135982-11136004 AAACCTAACCCCCAAGGTGATGG + Intronic
986830308 5:11569801-11569823 AATGCTATCCCTCAAGATGAGGG + Intronic
987081027 5:14425642-14425664 AAATCTAACCGCCAATGTGATGG + Intronic
987097378 5:14561803-14561825 AAACCTAACCCTCAAAGCGATGG - Intergenic
987437923 5:17920361-17920383 TAATCTATCATTCAAGCTGATGG + Intergenic
987448389 5:18050959-18050981 ACATTTAAACCTCAAGATGATGG + Intergenic
987766430 5:22237395-22237417 AATCCTAATCCTCAAGGTGATGG + Intronic
987795024 5:22616767-22616789 AAACCTAACCCCCAATGTGATGG + Intronic
988515369 5:31899678-31899700 AATCCTAACCCTCAAGGTGGTGG + Intronic
989428626 5:41326055-41326077 AATCCTAACCTTCAAGATGATGG - Intronic
989642117 5:43593083-43593105 AATCCTAACCCCCAAGGTGATGG + Intergenic
990176736 5:53116217-53116239 AATCCTAACCCCCAAGCTGATGG + Intergenic
990349316 5:54899866-54899888 AATCCTAACCCTCAATGTGATGG + Intergenic
990509699 5:56479455-56479477 AAATCTAACCTTCAATGTGATGG - Intronic
991098713 5:62767916-62767938 AATCCTAACCCTCAAGATAATGG + Intergenic
991487381 5:67151464-67151486 AAAACTAACCCCCAAGGTAATGG - Intronic
992157955 5:73973195-73973217 AATCCTAACCCTCAAGGTGATGG - Intergenic
992214904 5:74516388-74516410 AAATCCAGCCATCCAGCTGAGGG + Intergenic
993172344 5:84435144-84435166 AAATCTAATCATCAATGTGATGG + Intergenic
993552309 5:89288752-89288774 AAATCTAACCCTGAATGTGTTGG + Intergenic
993664126 5:90673750-90673772 AAATCTAATCCCCAAAGTGATGG - Intronic
994035649 5:95196988-95197010 AAACCTTACCATCAACCTGAGGG - Intronic
994114247 5:96044235-96044257 AAACCTAACCCCCAAGGTGATGG + Intergenic
994440399 5:99795986-99796008 AAATCTAACCCACAATGTGATGG - Intergenic
994558514 5:101335339-101335361 AAACTTAACCCACAAGGTGATGG - Intergenic
994663179 5:102677263-102677285 AATTCTAACCCCCAATGTGATGG + Intergenic
995336233 5:111002745-111002767 AATCCTAACCCTCAAGGTGATGG + Intergenic
995437395 5:112152410-112152432 AAATCTAACCTCCAAGGTGATGG + Intronic
996178539 5:120390065-120390087 AATCCTAACCCCCAAGGTGATGG - Intergenic
996240935 5:121200463-121200485 AATTCTAACCCCCAAGGTGATGG - Intergenic
996338742 5:122412978-122413000 AGACCTAACTCTCAAGATGATGG + Intronic
996701277 5:126452363-126452385 AATTCTAACCCCCGAGGTGAAGG - Intronic
996752211 5:126900327-126900349 AATCCTAACCCTCAAGGTGATGG + Intronic
996761404 5:126989616-126989638 AAATCTCACTCCCCAGCTGAGGG - Intronic
997076353 5:130683198-130683220 AATTCTAACCCCCAAGGTGATGG + Intergenic
997132695 5:131293120-131293142 AATTCTAACCCGCAACGTGATGG + Intronic
997411562 5:133694941-133694963 AGCCCTAACCCCCAAGCTGATGG - Intergenic
997529051 5:134570971-134570993 AAATCTCACCATCCAGCTGGTGG - Intronic
999122234 5:149218385-149218407 AATTCGAACCCCCAAGGTGATGG - Intronic
999698875 5:154209733-154209755 AATCCTAACCCCCAAGGTGACGG - Intronic
1001285670 5:170421690-170421712 AAATCTAATCATGAAGATGATGG - Intronic
1001291602 5:170466828-170466850 AATCTTAACCCTCAAGGTGATGG - Intronic
1001688089 5:173610774-173610796 AAATCTAATCCTTAATGTGATGG + Intronic
1001836995 5:174841122-174841144 AAACCTAACCCCCAATGTGATGG + Intergenic
1003389899 6:5704382-5704404 AATCCTAACCCCCAAGATGATGG - Intronic
1003402282 6:5800340-5800362 AATCCTAACCCCCAAGGTGATGG - Intergenic
1003486722 6:6586607-6586629 AATCCTAAGCCTCAAGGTGATGG + Intergenic
1003636022 6:7832279-7832301 AAACCTAACCCCCAAGGTGATGG + Intronic
1004241971 6:13931825-13931847 AATTCTAACTCCCAAGGTGATGG + Intronic
1004389949 6:15201733-15201755 AAAGCATAACCTCAAGCTGAGGG + Intergenic
1005523454 6:26621973-26621995 AAATCTAACCAAGAAGCTGAAGG - Intergenic
1005815501 6:29548781-29548803 AAATCTAATCCTCAATGTGATGG - Intergenic
1006082792 6:31577112-31577134 CCAGCAAACCCTCAAGCTGAGGG + Exonic
1007364347 6:41380589-41380611 AATCCTAACCCTCAAGGTGATGG - Intergenic
1007799227 6:44377883-44377905 AAACCTAATCCCCAAGGTGATGG - Exonic
1008164143 6:48115068-48115090 AATCCTAACCCTCAAGGTGATGG + Intergenic
1008200838 6:48587878-48587900 AAATTTAACCCCCAAGGTGATGG + Intergenic
1008397169 6:51022390-51022412 AATGCTAACCCCCAAGGTGATGG - Intergenic
1008430982 6:51416451-51416473 AGATTTAGCTCTCAAGCTGATGG + Intergenic
1008614794 6:53216348-53216370 AATTCTAATCCTCAATGTGATGG + Intergenic
1008652234 6:53575304-53575326 AATCCTAACCCTTAAACTGATGG + Intronic
1008654534 6:53598104-53598126 AAATCTAATCCTCAATGTGCTGG - Intronic
1009304782 6:62075160-62075182 AAACCTAACCTCCAAGGTGATGG + Intronic
1009338691 6:62526794-62526816 AATTCTCATCCCCAAGCTGACGG + Intergenic
1009397597 6:63217908-63217930 AATTCTAACCCTAAATATGACGG - Intergenic
1009556066 6:65168622-65168644 AATCCTAACCCCCAAGATGATGG - Intronic
1009744405 6:67795357-67795379 AAAGCTAACCCACAAGTTTATGG + Intergenic
1009902290 6:69822211-69822233 AATCCTAAACCCCAAGCTGATGG + Intergenic
1011441395 6:87391043-87391065 AAACCTAATCCCCAAGGTGATGG - Intronic
1011645902 6:89457876-89457898 AACCCTAACCCTCAATGTGATGG + Intronic
1012360346 6:98369772-98369794 AATTCTAACCCCCAAGGTGATGG + Intergenic
1012381440 6:98624273-98624295 AAATTCCACCCCCAAGCTGAAGG - Intergenic
1012414586 6:98999436-98999458 AAATCTAATCTCCAAGGTGATGG + Intergenic
1013340114 6:109205680-109205702 AAACCTAACCCCCAAGGTGATGG - Intergenic
1013478159 6:110529001-110529023 AATCCTAACCCTCAAAATGACGG + Intergenic
1014028750 6:116678076-116678098 AAACCTAACCCTCAAAGTGATGG - Intergenic
1014187753 6:118454979-118455001 AAATGCAACCATGAAGCTGAAGG - Intergenic
1015236203 6:130974101-130974123 AAATCTAACCCACAATGTGATGG + Intronic
1015615734 6:135072759-135072781 AGACCTAACCCTCATCCTGAAGG - Intronic
1016016398 6:139190827-139190849 AACTCTAAGCCCCAAGGTGATGG - Intergenic
1016029270 6:139321213-139321235 AATTCTAACCCCCAAGATGATGG + Intergenic
1016165380 6:140935622-140935644 AATTCTAATCCCCAAGGTGATGG - Intergenic
1016301063 6:142632476-142632498 AATTCTAACCCCCAATGTGATGG + Intergenic
1016641685 6:146356520-146356542 AATCCTAACCCCCAAGGTGATGG - Intronic
1016683806 6:146859399-146859421 AAATCTAATCTTCAATGTGATGG + Intergenic
1017054249 6:150423768-150423790 AAACCTAATCCCCAAGGTGATGG - Intergenic
1017198627 6:151729083-151729105 AATGCTAACTCTCAAGATGATGG + Intronic
1018206578 6:161442359-161442381 AAATCTAGCCTTCAAGATTAAGG - Intronic
1018225890 6:161628504-161628526 ACTCCTAACCCTCAAGGTGATGG - Intronic
1018431684 6:163727584-163727606 AACACTACCCCTCAAGCTGGTGG - Intergenic
1018753277 6:166825809-166825831 AATCCTAACCCTCAAGGTGATGG - Intronic
1018775568 6:167011895-167011917 AATCCTAACCCTCAATGTGATGG - Intronic
1019595388 7:1856092-1856114 AATTCTAACGCCCAAGATGAGGG - Intronic
1020333733 7:7045109-7045131 AACCCTAACCCCCAAGGTGATGG - Intergenic
1020441680 7:8223517-8223539 AAATCTAACCTTGACCCTGATGG - Intronic
1020676057 7:11186326-11186348 AATCCTAACCCCCAAGGTGATGG + Intergenic
1021022625 7:15622787-15622809 AATCCTAACCCTCAAGGTGACGG + Intronic
1021405013 7:20255439-20255461 GAAACTAAGCCTCAAGCTGCTGG - Intergenic
1022198100 7:28089154-28089176 AAATCTAATCCCCAATGTGATGG + Intronic
1023062421 7:36341505-36341527 AATCCTAACCCCCAAGGTGAGGG + Intronic
1023305594 7:38823094-38823116 AAACCTAACCTCCAAGGTGATGG + Intronic
1023340135 7:39211162-39211184 AATCCTAACCCCCAAGGTGATGG - Intronic
1023767049 7:43521552-43521574 AAACTTAACCCCCAAGGTGATGG + Intronic
1024250736 7:47503993-47504015 AAACCTGACCCCCAAGGTGATGG - Intronic
1024391917 7:48823637-48823659 AATTCTAACCCTTAAGGTGATGG - Intergenic
1026307982 7:69159203-69159225 AACTCTAACCCTCAGCCTTAGGG - Intergenic
1027307687 7:76918470-76918492 AATCCTAACCCTCAAGGGGATGG - Intergenic
1027569673 7:79848121-79848143 AATTCTAACACCCAAGGTGATGG - Intergenic
1027724651 7:81788977-81788999 AATCCTAACCCCCAAGGTGATGG + Intergenic
1027761478 7:82284748-82284770 GAACTTAACCCTCAAGGTGATGG - Intronic
1028597101 7:92557356-92557378 AATTTTAACCCCCAAGCTAATGG + Intergenic
1029970899 7:104787919-104787941 AAACCTAACCCCCAACATGACGG - Intronic
1030276787 7:107729840-107729862 AAATCTCACCCCCAATGTGATGG + Intergenic
1031244707 7:119295824-119295846 AAATCTTCCTCTCAAGCAGATGG - Intergenic
1031283360 7:119833774-119833796 AAACCTAACCCTAAAGATGGTGG + Intergenic
1031308160 7:120160284-120160306 AATACTAACCCCCAAGTTGATGG + Intergenic
1031631015 7:124042754-124042776 AATCCTAACCCCCAAGGTGATGG - Intergenic
1031681038 7:124675081-124675103 AATCTTAACACTCAAGCTGATGG + Intergenic
1031906611 7:127466854-127466876 AATTCTCACCCCCAAGGTGATGG + Intergenic
1031909075 7:127494723-127494745 AATCCTAACCCCCAAGGTGATGG - Intergenic
1032132803 7:129244698-129244720 AAATCTAACCCCCAGTGTGATGG - Intronic
1032357657 7:131225391-131225413 AAATCTAACCCCCAAAGTCATGG - Intronic
1032696210 7:134338664-134338686 AAATCTAACTCCCAAGGTGATGG - Intergenic
1032742025 7:134748820-134748842 AATCCTAGCCCTCAAGGTGACGG + Intronic
1033018690 7:137699270-137699292 AATCCTAACCCCCAAGGTGATGG - Intronic
1033079782 7:138284626-138284648 AATCCTAACCCCCAAGGTGAAGG + Intergenic
1033486910 7:141799655-141799677 AAACCTAATCCTCAATGTGATGG + Intergenic
1033639265 7:143245628-143245650 AATCCTAACCCCCAAGGTGATGG + Intronic
1033995792 7:147345881-147345903 GAATCTAACCCTCAAAGAGATGG + Intronic
1034840910 7:154395273-154395295 AAACCTAACCTCCAACCTGATGG - Intronic
1034882016 7:154770028-154770050 AATCCTAACCCCCAAGGTGATGG + Intronic
1035283541 7:157792485-157792507 AAAACACACCCTCGAGCTGAAGG - Intronic
1036161475 8:6392926-6392948 AATCCTAACTCTCAAACTGATGG + Intergenic
1037223205 8:16551540-16551562 AATCCTAACGCTCAAGGTGATGG - Intronic
1037537105 8:19835016-19835038 AAACCTAACCCCCAATGTGAGGG - Intronic
1038154289 8:24973119-24973141 AAATCCTAACCTCAAGGTGATGG - Intergenic
1039035847 8:33358609-33358631 AATTCTAACCTGCAAGATGATGG + Intergenic
1039093989 8:33863771-33863793 AATCCTAACCCTTAAGATGATGG + Intergenic
1039282428 8:36000313-36000335 AACTCTAACCCTGAATGTGATGG - Intergenic
1039877880 8:41603009-41603031 AAACCTAAGCCCCAAGGTGATGG - Intronic
1040509372 8:48080726-48080748 AAACCCCACCCCCAAGCTGAAGG + Intergenic
1040889750 8:52304899-52304921 AATCCTAACCCCCAAGGTGATGG - Intronic
1041451100 8:58007528-58007550 AGATCTAATCCTCAAGGGGATGG + Intronic
1041735620 8:61107581-61107603 AAACCTAACACCCAAGGTGATGG - Intronic
1041748071 8:61231018-61231040 AAACCTAATCCCCAAGGTGATGG - Intronic
1041756628 8:61320795-61320817 AATTCTAACCCCCAAGGTGATGG - Intronic
1041872627 8:62652160-62652182 AAACCTAATCCCCAAGATGATGG - Intronic
1042117342 8:65446824-65446846 AATCCTCACCCTCAAGATGATGG + Intergenic
1042329417 8:67562568-67562590 AATCCTAACCCCCAAGGTGATGG + Intronic
1042472899 8:69211437-69211459 AATTCTAATCCCCAAGGTGATGG - Intergenic
1043591434 8:81837694-81837716 AAACCTAACCTTCAAGGTGATGG - Intronic
1043672422 8:82904189-82904211 AATTCTAACCCACAATGTGATGG + Intergenic
1044011270 8:86997038-86997060 AAACCTAATCTTCAAGATGATGG - Intronic
1044124711 8:88444081-88444103 AATCCTAACCCCCAAGCTGATGG + Intergenic
1044415579 8:91935466-91935488 AATGCTAACCCACAAGGTGATGG - Intergenic
1044542740 8:93425966-93425988 AAACTTGACCCTCAAGGTGATGG - Intergenic
1044548124 8:93482215-93482237 AATCCTAACCCCCAAGATGATGG + Intergenic
1044774610 8:95675360-95675382 AATTCTAACCCCCAAGTTGATGG + Intergenic
1045692941 8:104778190-104778212 AATCCTAACCCCCAAGGTGATGG - Intronic
1046223646 8:111248164-111248186 AATTCTAACCCTAAAGATAATGG - Intergenic
1046287583 8:112115011-112115033 GAAACTAACCCCCAAGCTCAAGG + Intergenic
1046321498 8:112582728-112582750 AATCCTAACCCTCAAGGTGATGG + Intronic
1046796265 8:118376307-118376329 AATCCTAACCCCCAAGGTGATGG + Intronic
1047323922 8:123818297-123818319 AACTGTAACCCTCAACTTGATGG - Intergenic
1047470680 8:125168708-125168730 AATCCTAACCCTTAAGGTGATGG - Intronic
1047767572 8:128001943-128001965 AATCCTAACCCTCAAGGTGATGG - Intergenic
1047820661 8:128516662-128516684 AAATCTAATCCCCAATGTGACGG + Intergenic
1047884526 8:129234370-129234392 AAATCCAATCCTCAACATGAAGG + Intergenic
1047930301 8:129721911-129721933 TAATCTAACCCCCACTCTGAGGG - Intergenic
1048308963 8:133303585-133303607 AAAGCCAACCCTCAATGTGATGG + Intergenic
1048367458 8:133750786-133750808 AACTCTAACCCCCAAGATGACGG + Intergenic
1048399104 8:134047068-134047090 AATCCTAATCCTCAAGGTGAAGG + Intergenic
1048446228 8:134495416-134495438 AAATCTAATCCCCAAAATGATGG - Intronic
1048593955 8:135846798-135846820 AAATCTAACCATCAATGTGATGG - Intergenic
1048870115 8:138790361-138790383 AATCCTAACCCCCAAGGTGATGG - Intronic
1048900811 8:139036158-139036180 AAATCTATCCCGGAAGCAGAGGG - Intergenic
1049390852 8:142369952-142369974 GAATCTAACCCCCAACATGATGG + Intronic
1050121085 9:2307879-2307901 AACTCCAACACTTAAGCTGATGG - Intergenic
1050205201 9:3189035-3189057 AATCCTAACCCCCAAGGTGATGG + Intergenic
1050365943 9:4873847-4873869 AATCCTAACCCCCAAGGTGATGG + Intronic
1050485983 9:6135136-6135158 AAAATTAACCCTCAAGGTGATGG + Intergenic
1050498569 9:6269806-6269828 AATTCTAACCCCCAAGGTGATGG - Intergenic
1051130657 9:13856438-13856460 AATCCTAACCCTGAAGGTGATGG - Intergenic
1051168781 9:14296480-14296502 AATCCTAACCCCCAATCTGATGG + Intronic
1051260143 9:15256052-15256074 AAACCTAACCCCCAAAGTGATGG + Intronic
1051359681 9:16270888-16270910 AATTCTAACCCCCAACATGATGG + Intronic
1051722111 9:20047790-20047812 AATCCTAACCCCCAAGGTGATGG - Intergenic
1052399104 9:27978385-27978407 AATCCTAACCCCCAAGGTGATGG + Intronic
1052467528 9:28848897-28848919 AATTCTAACCCCTAAGGTGATGG + Intergenic
1052587963 9:30453205-30453227 AAAGCTAATCCTCAATGTGATGG - Intergenic
1052738321 9:32368271-32368293 AAGTCTAACCCCCAATGTGATGG - Intergenic
1053002419 9:34584624-34584646 ATCTCTGACCCTCTAGCTGAAGG - Intronic
1053048865 9:34941850-34941872 AATCCTAACCCCCAAGGTGATGG - Intergenic
1053301541 9:36955482-36955504 AAGTTTTACCCACAAGCTGAAGG - Intronic
1054862779 9:69970367-69970389 AAATCTAATCCTCAGTGTGATGG - Intergenic
1055275412 9:74610568-74610590 AATTCTTACCCTCAAGATGATGG - Intronic
1055923349 9:81485256-81485278 AAATCTAAACCTCAATGTGATGG + Intergenic
1056269817 9:84936306-84936328 AAATATAACACATAAGCTGAGGG - Intronic
1056418856 9:86404142-86404164 AATCCTAACCCCCAAGGTGATGG + Intergenic
1056526957 9:87452371-87452393 AATCCTAACCCTCACGGTGATGG + Intergenic
1056579193 9:87878040-87878062 AATCCTAACCCCCAAGGTGATGG + Intergenic
1056789952 9:89618822-89618844 AATCCTAACCCCCAAGGTGATGG + Intergenic
1058095826 9:100859232-100859254 AAATCTAACCCCCAATATGATGG - Intergenic
1058583941 9:106486724-106486746 AAATCTAACCCTCAATGTAACGG - Intergenic
1058794818 9:108487955-108487977 AAATTTAATCCTCAATGTGATGG - Intergenic
1059822480 9:117989269-117989291 AATCCTAACCCGCAAGATGATGG - Intergenic
1059829062 9:118072053-118072075 AGTTCTACCCCTCAAGGTGATGG + Intergenic
1060341970 9:122785578-122785600 AATTCTAACCCCCAATATGATGG + Intergenic
1060516019 9:124266248-124266270 TAATCTAACCCTTAACCTGAGGG + Intronic
1060649501 9:125313211-125313233 AATTCTAACCCCCAAGGTGATGG - Intronic
1186146241 X:6627058-6627080 AAACCTAACCCCCAAAATGATGG - Intergenic
1186151220 X:6676692-6676714 AACTCTAACCCACAGGGTGATGG + Intergenic
1186208394 X:7224436-7224458 AATTCTAACCCCCAAGATGATGG + Intronic
1186395605 X:9205804-9205826 AAATCTAACCCCCAAGGTGATGG - Intergenic
1186450943 X:9673121-9673143 AAATCTAACCCCCAAGGGGATGG - Intronic
1186462217 X:9757353-9757375 AATTCTAACCCCTAAGGTGATGG - Intronic
1186468823 X:9805420-9805442 AATCCTAACCCACAAGGTGATGG + Intronic
1187030731 X:15485443-15485465 AAACCTAACACTCAATATGATGG - Intronic
1187178153 X:16915659-16915681 AATCCTAACTCTCAAGGTGATGG + Intergenic
1187446149 X:19363160-19363182 AATCCTAACCCACAAGGTGATGG + Intronic
1187780655 X:22818883-22818905 AATCTTAACCCTCAAGGTGATGG - Intergenic
1188235801 X:27729773-27729795 AATTCTAACCTCCAAGGTGATGG - Intronic
1188396000 X:29684433-29684455 AAACCTAATCACCAAGCTGATGG - Intronic
1188431964 X:30113667-30113689 CAACCTAACTCTCAAGGTGATGG - Intergenic
1188584586 X:31757728-31757750 AAACCTAACACTCAAGGTGATGG - Intronic
1188706145 X:33333666-33333688 AATTCTAAGCATAAAGCTGAGGG - Intronic
1188746463 X:33850763-33850785 AATCCTAACCTTCAAGGTGATGG - Intergenic
1189633789 X:42983182-42983204 AATCCTAACCCTCAAGGTGATGG - Intergenic
1190434467 X:50409764-50409786 AATCCTAACCCTCTAGGTGATGG + Intronic
1190895889 X:54617612-54617634 AAACCTAACCTCCAAGGTGATGG + Intergenic
1191972003 X:66827140-66827162 AATTCTAACCCCCAAGGTGATGG - Intergenic
1192102916 X:68284229-68284251 CAATTAAACCCTCAAGCAGAAGG - Intronic
1192119156 X:68438685-68438707 AATCCTAACCCTCAAGGTAATGG + Intergenic
1192231247 X:69266584-69266606 CAATCTAATCCCCAAGGTGATGG + Intergenic
1192286950 X:69748239-69748261 AATTTTAATCCTCAGGCTGATGG + Intronic
1192840309 X:74848739-74848761 AAATCTAATCCCCAATGTGATGG + Intronic
1193455289 X:81724469-81724491 ATATCCTTCCCTCAAGCTGAAGG - Intergenic
1193997362 X:88383158-88383180 AAACCTAACCCTCAATGTGGTGG - Intergenic
1194353612 X:92854227-92854249 AATCCTCACCCTCAAGGTGATGG - Intergenic
1194579640 X:95656093-95656115 AATTCTAACCCTCAAGGTAATGG + Intergenic
1194621769 X:96181790-96181812 AAACCTAACCCCCAAAGTGATGG + Intergenic
1194642011 X:96413545-96413567 AAACCTAATCATCAAGGTGATGG - Intergenic
1196407573 X:115380793-115380815 AATCCTAACCCACAAGGTGATGG + Intergenic
1197168704 X:123407649-123407671 AATCCTAACCCCCAAGGTGATGG - Intronic
1197784855 X:130189215-130189237 TATTCTATCCCTCAATCTGAGGG - Intergenic
1197828098 X:130612383-130612405 AACTCTAACCCCCAAGGTGATGG - Intergenic
1198098504 X:133403487-133403509 AATCCTAACCCTCAAGGTGATGG - Intronic
1198541377 X:137643726-137643748 AATTCTAACACTGAAGGTGATGG - Intergenic
1199235002 X:145481344-145481366 AAACCTAATCCTCAAAGTGATGG - Intergenic
1199353311 X:146831287-146831309 AAACCTGACCTTCAAGCTGAAGG + Intergenic
1200661974 Y:5971300-5971322 AATCCTCACCCTCAAGGTGATGG - Intergenic
1201251537 Y:12063351-12063373 AATTCTAACACTCAAGATCATGG - Intergenic
1201906394 Y:19090137-19090159 AAATCAAATCCCCAAGGTGATGG + Intergenic
1202047442 Y:20749159-20749181 AATCCTAACCCTCAAGGGGATGG + Intergenic