ID: 1069764297

View in Genome Browser
Species Human (GRCh38)
Location 10:70841659-70841681
Sequence ATTTCAACATATGAATTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9356
Summary {0: 17, 1: 389, 2: 1334, 3: 2920, 4: 4696}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069764284_1069764297 23 Left 1069764284 10:70841613-70841635 CCCCCCAAAGGCTCCCTCTTCCT 0: 1
1: 0
2: 9
3: 74
4: 602
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764287_1069764297 20 Left 1069764287 10:70841616-70841638 CCCAAAGGCTCCCTCTTCCTCCT 0: 1
1: 1
2: 5
3: 59
4: 539
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764290_1069764297 9 Left 1069764290 10:70841627-70841649 CCTCTTCCTCCTACCATCAGCTT 0: 1
1: 0
2: 6
3: 100
4: 851
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764286_1069764297 21 Left 1069764286 10:70841615-70841637 CCCCAAAGGCTCCCTCTTCCTCC 0: 2
1: 0
2: 5
3: 75
4: 621
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764295_1069764297 -4 Left 1069764295 10:70841640-70841662 CCATCAGCTTGAGGGTTAGATTT 0: 1
1: 0
2: 14
3: 163
4: 626
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764289_1069764297 10 Left 1069764289 10:70841626-70841648 CCCTCTTCCTCCTACCATCAGCT No data
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764294_1069764297 0 Left 1069764294 10:70841636-70841658 CCTACCATCAGCTTGAGGGTTAG 0: 1
1: 0
2: 3
3: 13
4: 72
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764288_1069764297 19 Left 1069764288 10:70841617-70841639 CCAAAGGCTCCCTCTTCCTCCTA 0: 1
1: 1
2: 2
3: 51
4: 440
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764293_1069764297 3 Left 1069764293 10:70841633-70841655 CCTCCTACCATCAGCTTGAGGGT 0: 1
1: 1
2: 8
3: 56
4: 402
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696
1069764285_1069764297 22 Left 1069764285 10:70841614-70841636 CCCCCAAAGGCTCCCTCTTCCTC 0: 1
1: 0
2: 6
3: 66
4: 631
Right 1069764297 10:70841659-70841681 ATTTCAACATATGAATTTTTGGG 0: 17
1: 389
2: 1334
3: 2920
4: 4696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069764297 Original CRISPR ATTTCAACATATGAATTTTT GGG Intronic
Too many off-targets to display for this crispr