ID: 1069764396

View in Genome Browser
Species Human (GRCh38)
Location 10:70842875-70842897
Sequence CTGAATACAAACATGGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 273}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069764396_1069764404 14 Left 1069764396 10:70842875-70842897 CCCCTGTCCATGTTTGTATTCAG 0: 1
1: 0
2: 1
3: 42
4: 273
Right 1069764404 10:70842912-70842934 CGGGCACTCTGCCACATGTTGGG No data
1069764396_1069764400 -6 Left 1069764396 10:70842875-70842897 CCCCTGTCCATGTTTGTATTCAG 0: 1
1: 0
2: 1
3: 42
4: 273
Right 1069764400 10:70842892-70842914 ATTCAGTATAAATTGTGTGCCGG No data
1069764396_1069764407 27 Left 1069764396 10:70842875-70842897 CCCCTGTCCATGTTTGTATTCAG 0: 1
1: 0
2: 1
3: 42
4: 273
Right 1069764407 10:70842925-70842947 ACATGTTGGGGATTTAGTACTGG No data
1069764396_1069764403 13 Left 1069764396 10:70842875-70842897 CCCCTGTCCATGTTTGTATTCAG 0: 1
1: 0
2: 1
3: 42
4: 273
Right 1069764403 10:70842911-70842933 CCGGGCACTCTGCCACATGTTGG No data
1069764396_1069764401 -5 Left 1069764396 10:70842875-70842897 CCCCTGTCCATGTTTGTATTCAG 0: 1
1: 0
2: 1
3: 42
4: 273
Right 1069764401 10:70842893-70842915 TTCAGTATAAATTGTGTGCCGGG No data
1069764396_1069764405 15 Left 1069764396 10:70842875-70842897 CCCCTGTCCATGTTTGTATTCAG 0: 1
1: 0
2: 1
3: 42
4: 273
Right 1069764405 10:70842913-70842935 GGGCACTCTGCCACATGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069764396 Original CRISPR CTGAATACAAACATGGACAG GGG (reversed) Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900523487 1:3117244-3117266 TTAAATACAAACATGGCAAGTGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
902945104 1:19830164-19830186 GAGAAGACAAACATGGACTGGGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905268061 1:36768683-36768705 CTGGACACATACATGCACAGTGG + Intergenic
907023475 1:51092002-51092024 CTGAATACAAACATATAAAAAGG + Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909404969 1:75278064-75278086 CTGAATAGACACATGGGTAGTGG - Intronic
911724651 1:101230293-101230315 GTGAATAAAAAAATGGAAAGTGG + Intergenic
913090680 1:115474734-115474756 CAGAAAAGAAACAAGGACAGTGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918520191 1:185406762-185406784 CTAAATGCATAAATGGACAGGGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919101641 1:193104253-193104275 ATGAATAGAAACATGCACGGAGG + Intronic
919520938 1:198585606-198585628 CCCAATTCAAACATGGGCAGAGG - Intergenic
920793697 1:209117659-209117681 ATGAAAACAAACAGGGAAAGAGG - Intergenic
921759750 1:218899460-218899482 CTGAATACATCCATGTACATAGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923552721 1:234977036-234977058 CTAAAAACAAACTTGGAGAGTGG + Intergenic
923732209 1:236563109-236563131 CTGAATAGAAACAATGACAGAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1064875990 10:19995085-19995107 ATCAATACAAGCATGGACATTGG - Intronic
1066277834 10:33886486-33886508 CTAAATACAAACAGGGCCATGGG + Intergenic
1066498754 10:35970038-35970060 ATGAACATAAACATGGACACTGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1068210601 10:53914947-53914969 CAGAATACAAACTGGAACAGGGG - Intronic
1068466454 10:57399277-57399299 CTAAACAGAAACAGGGACAGAGG + Intergenic
1068956193 10:62819969-62819991 TTGAATACAAACATGTACCATGG + Intronic
1069469090 10:68670244-68670266 ATGCATTCAATCATGGACAGGGG - Intronic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1070796138 10:79217697-79217719 CTGGAAACATACATGGAAAGAGG - Intronic
1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG + Intergenic
1071128259 10:82360815-82360837 CTGAACACAAACACCTACAGAGG - Intronic
1071206921 10:83290572-83290594 CTGAATACATGCAAGCACAGGGG - Intergenic
1072910778 10:99498945-99498967 CTAAATAAAAACATTGACAAAGG - Intergenic
1074473211 10:113745862-113745884 CTAAATACAAAAATAGACACTGG + Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1080293832 11:30702253-30702275 CTGTATAAAAACATGGAAATTGG - Intergenic
1080337827 11:31219423-31219445 CTGAATATAAACATGAGCAGAGG + Intronic
1080552534 11:33386116-33386138 CTGAATAGAAATAGGGAGAGTGG + Intergenic
1083577729 11:63804444-63804466 TTGAACACACACGTGGACAGAGG + Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087386998 11:97483759-97483781 CAGAAAACAAAAAAGGACAGGGG + Intergenic
1087913463 11:103780275-103780297 CTGAATTGAAACATGGAAAGAGG + Intergenic
1089744052 11:120604571-120604593 CTGAAGACAAATACAGACAGGGG + Intronic
1089826796 11:121284943-121284965 CTGAATGCAAAGATGGAACGAGG + Intergenic
1092048928 12:5454296-5454318 CTGAACACAGACATGCACAGAGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094126927 12:27033137-27033159 GTGAATACAAACAGGGAGAGAGG - Intronic
1095090240 12:38097810-38097832 CTTAATACAGCCAGGGACAGTGG - Intergenic
1095604950 12:44055510-44055532 GTGAATAAAAGCATGGACTGTGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097258966 12:57702909-57702931 CTCAATTCAAAAATGGGCAGAGG - Intronic
1098400286 12:70067518-70067540 CTGAATGCAAACATAAACAATGG - Intergenic
1098631978 12:72734556-72734578 CTGAATGAAAATATGGACTGTGG - Intergenic
1098870551 12:75812659-75812681 CTGAAAACAAACGTGCACATAGG + Intergenic
1099603330 12:84769439-84769461 CTGAATACAATCATAGTCTGAGG + Intergenic
1100713817 12:97284915-97284937 CTGAATTCAAAAATAGACACAGG + Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1102968116 12:117144379-117144401 CTGATGAGGAACATGGACAGTGG + Intronic
1103186922 12:118966226-118966248 CTGAGAACACACATGGACACAGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105657263 13:22454954-22454976 CAGAGGACAAACTTGGACAGGGG - Intergenic
1106633491 13:31502631-31502653 CTCCATACAAAAATGGACTGAGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107984986 13:45767781-45767803 CTGAATACAACCATGGCAAGTGG - Intergenic
1108051413 13:46444428-46444450 GTGTATACACACATGCACAGGGG + Intergenic
1109048853 13:57451114-57451136 CTGAACACAAACATGCACAATGG - Intergenic
1109306447 13:60646972-60646994 TTTAATACAAACATGGAGATTGG - Intergenic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109543969 13:63818051-63818073 GTGTATACACACATGCACAGGGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110709023 13:78629500-78629522 CTGAACAGAGACATGGAGAGAGG + Intronic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112617563 13:101020825-101020847 CTGAACACACCCATGGCCAGTGG - Intergenic
1113629872 13:111874910-111874932 TTGAATCCAAACAGGGAGAGCGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115417226 14:33149978-33150000 ATGAAAACACACATGGACACAGG - Intronic
1117539780 14:56735543-56735565 CTCAATATAAACATGTACTGTGG - Intergenic
1118491411 14:66264323-66264345 ATGAATAGAAACTTGGAGAGAGG - Intergenic
1118579962 14:67285878-67285900 ATGAATACAAACATACACATGGG - Intronic
1120037070 14:79709800-79709822 CTGAAGACAGACAAGGAGAGAGG + Intronic
1202851592 14_GL000225v1_random:23545-23567 CTGAAAACAAATCTGGACCGTGG - Intergenic
1123645825 15:22437080-22437102 CTTAACATAAACATTGACAGCGG - Intergenic
1123732482 15:23158264-23158286 CTTAACACAAACATTGACAGCGG + Intergenic
1123750617 15:23355646-23355668 CTTAACACAAACATTGACAGCGG + Intronic
1125673941 15:41492844-41492866 CTGACTACCAACATGGGAAGTGG + Intergenic
1126491583 15:49242967-49242989 CAAAATACAAAGATGGAAAGTGG + Intronic
1127898900 15:63326715-63326737 CACAATAAAAACATGGACAAAGG + Intronic
1129119057 15:73384106-73384128 CTGAATGAAAACAGGGAAAGGGG - Intergenic
1129181895 15:73882926-73882948 TTGAATGCAAACAAGGGCAGAGG + Intronic
1129380175 15:75160002-75160024 TTAAATAAAAACATGGCCAGGGG - Intergenic
1129964624 15:79723177-79723199 ATGAATAGAAACATGGACACAGG + Intergenic
1130186974 15:81692468-81692490 CTGAAGAGAAACATGGGAAGTGG - Intergenic
1130425672 15:83796153-83796175 ATGAATACAAGCAATGACAGTGG - Intronic
1131105566 15:89731759-89731781 CTCAATAAACACATGGGCAGTGG - Intronic
1131248076 15:90813346-90813368 CTGAAAACAAGCATGGAAATGGG - Intronic
1132518321 16:376170-376192 CTGAACACCGGCATGGACAGCGG - Exonic
1132553399 16:562483-562505 ATGAACACAAGCATGCACAGAGG + Intronic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1133882865 16:9799290-9799312 CTGAACACAGACATGCACACAGG + Intronic
1134894541 16:17872797-17872819 TTGAATACAAAAGTGGAAAGGGG + Intergenic
1137943000 16:52707328-52707350 CTCAATCCAAACCTGGGCAGAGG - Intergenic
1140470833 16:75213457-75213479 CTGAATACACACGCGAACAGGGG - Intergenic
1143089890 17:4443797-4443819 CCCAATAGAAAAATGGACAGTGG + Intronic
1143816597 17:9521078-9521100 GTGAATATAAAGATGCACAGAGG + Intronic
1143916056 17:10293898-10293920 CTGAATGCAGAGATGGAAAGAGG + Intergenic
1145102843 17:20091001-20091023 CTGAAAACAAACTTTGATAGTGG - Intronic
1146679843 17:34799143-34799165 CTGATCACAAGCATGGACATTGG + Intergenic
1146861722 17:36307515-36307537 GTGAATACAATCATGGCCAAGGG - Intronic
1147092050 17:38111619-38111641 GTGAATACAATCATGGCCAAGGG - Intergenic
1147105159 17:38208876-38208898 GTGAATACAATCATGGCCAAGGG + Intergenic
1147441973 17:40452975-40452997 CTGAATACAGACAAGGACGAGGG + Exonic
1148424340 17:47579609-47579631 GTGAATACAATCATGGCCAAGGG - Intronic
1149276596 17:55046417-55046439 TTAAATACAAACCTGAACAGAGG - Intronic
1149389538 17:56175056-56175078 CTTAATACAAACGTGGATATAGG - Intronic
1150603675 17:66673427-66673449 CTGTACACAAACCTGGACTGAGG - Intronic
1152991242 18:365802-365824 CTGAGTGCCAACATGGTCAGAGG - Intronic
1153259693 18:3211480-3211502 CTGAAACCATTCATGGACAGAGG + Intronic
1154459949 18:14572914-14572936 CTGTAGACAAACATGGACCCTGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1157350397 18:46879224-46879246 CTCAATTCAAAAATGGACAAAGG + Intronic
1158406662 18:57165858-57165880 CTGGACACAAACATGAATAGGGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159438335 18:68446434-68446456 CTGGACACAGACATGCACAGAGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159653289 18:71002925-71002947 CTGAAAGAAAACATGGAGAGTGG + Intergenic
1160070387 18:75623047-75623069 TTGAACACAAACATGCACAGAGG + Intergenic
1160077099 18:75688280-75688302 CTTAATACAAAAATTGACAGTGG + Intergenic
1160892447 19:1386398-1386420 CAGGACACAAACATGTACAGAGG - Intronic
1161130894 19:2587979-2588001 CTGAATAGAAACAGTGAGAGTGG - Intronic
1161896024 19:7081081-7081103 CTGTATTTAAACCTGGACAGGGG + Intronic
1163054601 19:14708881-14708903 TTGGACACAGACATGGACAGAGG - Intronic
1165173663 19:33911305-33911327 ATGCATCAAAACATGGACAGTGG - Intergenic
1166579090 19:43877013-43877035 CGGAATAGAAAAAAGGACAGTGG + Intronic
926956045 2:18301499-18301521 GTGAAGTCAAACATGGACACCGG - Intronic
927140664 2:20128830-20128852 TTGAATATAAAATTGGACAGGGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
930460373 2:51666090-51666112 CTCAATACAAAAATATACAGAGG + Intergenic
930930437 2:56875336-56875358 CTAAATAAACACATGTACAGAGG + Intergenic
932002467 2:67897228-67897250 CTGAACACAGGCAGGGACAGTGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933214222 2:79608860-79608882 CTGAATAAAATCAAGGAGAGTGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938074596 2:128325021-128325043 CTGAATACAATCATGCACAGAGG - Intergenic
938553238 2:132399931-132399953 TTAAAGACAAACATGAACAGAGG - Intergenic
938652411 2:133397289-133397311 ATGAATTCAAACATGAAAAGAGG - Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939088083 2:137745595-137745617 CAGAACACAGAAATGGACAGAGG + Intergenic
940707830 2:157126419-157126441 CTGAACACACACATGGGTAGTGG + Intergenic
942305903 2:174607434-174607456 CTGAATGCAACCATGTTCAGAGG - Intronic
946437618 2:219668355-219668377 CTGAATATAAAAATGCCCAGAGG - Intergenic
947772241 2:232679765-232679787 CTGAATAGAAACGTGGGCAAAGG + Intronic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1170008588 20:11695662-11695684 CTGAATAGCAACCTGGGCAGTGG - Intergenic
1170546522 20:17439490-17439512 AGGAATACAAACACGGACACAGG - Intronic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172611187 20:36253650-36253672 TTTAATACAAACATGGGCAGGGG - Intronic
1172866028 20:38098129-38098151 CTCAATTCAAAAATGGGCAGAGG - Intronic
1173295455 20:41751533-41751555 ATGAGAACTAACATGGACAGTGG - Intergenic
1175214593 20:57385116-57385138 CTGGACACAGACAAGGACAGAGG + Intergenic
1176295245 21:5068694-5068716 CTGAATGTGCACATGGACAGCGG + Intergenic
1176814166 21:13579914-13579936 CTGTAGACAAACATGGACCCTGG - Intergenic
1176901531 21:14448116-14448138 TAGGATACAAACATGTACAGAGG - Intergenic
1176912304 21:14580879-14580901 CTGAAAACACACATGACCAGAGG + Intronic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179861804 21:44193434-44193456 CTGAATGTGCACATGGACAGCGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1183057141 22:35313971-35313993 GGGAATAAAAACACGGACAGTGG - Intronic
1183402505 22:37612942-37612964 CTGAATCCAGAAATGGATAGTGG - Intronic
1184699786 22:46162908-46162930 CTGAATAAATACATGAACTGAGG - Intronic
1185306078 22:50117483-50117505 CCAAATACAATCATGGAAAGAGG - Intronic
949939181 3:9141261-9141283 GTGAATGCACACATGGCCAGAGG - Intronic
951649594 3:24936153-24936175 CTCTATACAAACATGGACCATGG - Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951946297 3:28140586-28140608 CTGAATACTTACATGAACACAGG + Intergenic
953469515 3:43155070-43155092 CTGAACACAGACTTGGGCAGGGG + Intergenic
956010349 3:64824213-64824235 CGGAATATAAAGATGAACAGGGG + Intergenic
957944619 3:87047543-87047565 CTGACCAAAAACATGGAGAGTGG - Intergenic
959740619 3:109714964-109714986 CTCAACACAAACATGTTCAGGGG + Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960778077 3:121284415-121284437 CTGTGTACAAACCTGGACACTGG - Intronic
962135471 3:132727232-132727254 CTTAATACAAACATTTACAGAGG - Intergenic
964717548 3:159738461-159738483 GTGAATATTAACATGGAGAGAGG - Intronic
964975036 3:162607612-162607634 TTGAATACACAGATGCACAGAGG - Intergenic
965911373 3:173781609-173781631 TTGAATAGAGACATGGACACTGG + Intronic
965916205 3:173849472-173849494 CTGAATATAAACATTAGCAGAGG + Intronic
970010899 4:11457970-11457992 CTGAACACAGACATGTACAGAGG - Intergenic
970303288 4:14703757-14703779 CTAAATAGAACCATGGACATGGG - Intergenic
971680653 4:29695393-29695415 GTAAATAAAAACATGGACATTGG + Intergenic
973017162 4:45154791-45154813 ATGAATGGAAATATGGACAGAGG - Intergenic
974866164 4:67583565-67583587 CTGTATAAAAACATCTACAGAGG - Exonic
975397863 4:73898473-73898495 CTCCATGCACACATGGACAGAGG - Intergenic
977162462 4:93652201-93652223 TAGAATACAGACATGCACAGAGG + Intronic
978663285 4:111153716-111153738 CTGAGTAAAAACTCGGACAGAGG - Intergenic
979494785 4:121371072-121371094 GTGAAAACAAACATGGATTGTGG - Intronic
981770814 4:148305439-148305461 CTGTATACAGACCTGGAAAGTGG - Intronic
983176215 4:164590835-164590857 TTGGACACAGACATGGACAGAGG + Intergenic
983231297 4:165131389-165131411 CTGAATGCAAACATGGTTTGGGG - Intronic
983357951 4:166688546-166688568 CTGAACACCAGCATTGACAGAGG + Intergenic
984599138 4:181706184-181706206 TTGGACACAGACATGGACAGAGG - Intergenic
985193327 4:187401427-187401449 GTGAATAAAAGCATGGACACCGG - Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
987692268 5:21282605-21282627 CTGAATGCAAAGATGGAATGAGG - Intergenic
987869561 5:23597638-23597660 AAGAATACAAACATGCCCAGAGG + Intergenic
988343015 5:29999715-29999737 CTTAATACAAAAAAAGACAGAGG + Intergenic
990079597 5:51897119-51897141 TTGGACACAAACATGAACAGAGG - Intergenic
990492292 5:56314409-56314431 CTGAATCCATATATGGAAAGAGG + Intergenic
991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG + Intergenic
991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG + Intergenic
991828925 5:70662745-70662767 CTGAATGCAAAGATGGAATGAGG - Intergenic
991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG + Intergenic
992159154 5:73983800-73983822 CTGAATCCAGCCATGGAAAGAGG + Intergenic
992693992 5:79266127-79266149 AAGACTACACACATGGACAGAGG - Intronic
993004612 5:82416955-82416977 CTGGAAACAAACAGGTACAGAGG - Intergenic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
993366806 5:87043592-87043614 CTGAAAAGAAAAATGAACAGAGG - Intergenic
993514364 5:88812296-88812318 ATGAATAGATATATGGACAGAGG + Intronic
995282238 5:110349464-110349486 CTGCATACTAACAAGGACACGGG + Intronic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
998618386 5:143767223-143767245 CTTAACACAGACATGGAAAGGGG - Intergenic
999077328 5:148808759-148808781 CTTAATACAAACAGGGAAACAGG - Intergenic
1002513394 5:179738514-179738536 CTGAAGACAAAAAAGGAAAGAGG - Intronic
1002830115 6:812767-812789 CTAAATAAAAAGATAGACAGGGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005647748 6:27857304-27857326 TTGAACACAGACATGCACAGAGG + Intronic
1007127658 6:39440947-39440969 CTGAATACATGCATGGAATGGGG + Intronic
1008188874 6:48429436-48429458 ATGAATACAACCATGGAGATGGG - Intergenic
1009990893 6:70841732-70841754 CTGAACACAAACATGAATGGGGG - Intronic
1010380709 6:75221263-75221285 CTGAATAAAAAAATAGTCAGCGG - Intergenic
1011119976 6:83942090-83942112 CAGAAAACAAACATGTACATAGG - Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012289344 6:97433592-97433614 TAGAATACAAACATAAACAGAGG - Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1013133621 6:107258825-107258847 TTCAATACAAACATTGATAGGGG - Intronic
1013428570 6:110036142-110036164 CTGAATAGAAACTTGGGGAGTGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015469809 6:133591216-133591238 TGGAATACAATCATGAACAGAGG - Intergenic
1015846655 6:137527093-137527115 CTCAATTCAAAAATGGACAAAGG - Intergenic
1016554473 6:145320295-145320317 TTCAATAGAAAAATGGACAGTGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017550096 6:155496491-155496513 TTGGACACAAACATGTACAGAGG + Intergenic
1017554893 6:155552739-155552761 CTGAATAGTACCATTGACAGTGG + Intergenic
1017797530 6:157859755-157859777 CCTAATACAAAAATGGGCAGAGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018345794 6:162898003-162898025 GTGAATGTAGACATGGACAGGGG - Intronic
1018606374 6:165602075-165602097 GTGAAAACAGAAATGGACAGTGG - Intronic
1020145459 7:5638969-5638991 CTCAACTCAAAAATGGACAGAGG - Intronic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1022378505 7:29837765-29837787 ATGAATACAAAGATGGGCACAGG + Intronic
1022872705 7:34495999-34496021 CTGATTAGAAAAGTGGACAGGGG - Intergenic
1023603096 7:41899891-41899913 CTGAATACAAAAATCCATAGAGG + Intergenic
1023736729 7:43242098-43242120 CTTTATACAAACATGCAAAGTGG - Intronic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1027843120 7:83339388-83339410 CTGAATAAATAAATGGCCAGAGG - Intergenic
1028379400 7:90182051-90182073 CTGAATATATACAGTGACAGAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1030980415 7:116179539-116179561 TTGGACACAGACATGGACAGAGG - Intergenic
1031814510 7:126416641-126416663 GAGAAAATAAACATGGACAGGGG + Intergenic
1032648611 7:133853734-133853756 ATGAATACAAACATGAGCATGGG - Intronic
1032896887 7:136261354-136261376 CTGAATGCAAAGATGGAACGAGG - Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035555969 8:567483-567505 CTGAGCACAAACATGAACAAGGG - Intergenic
1037484669 8:19336048-19336070 CTGATAACTAACATGGTCAGGGG + Intronic
1038525952 8:28273533-28273555 TAGAAAACAACCATGGACAGAGG + Intergenic
1042029378 8:64459022-64459044 CTGAATGCAAACATGAAAAGAGG + Intergenic
1043392189 8:79802524-79802546 ATGAATCCAGACATGGCCAGTGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043607497 8:82020065-82020087 ATGAAAAGAAATATGGACAGTGG - Intergenic
1043609104 8:82039915-82039937 TTCACTACAAACATTGACAGAGG + Intergenic
1044560409 8:93606662-93606684 CTGAACACAGAGATGGGCAGTGG + Intergenic
1044920282 8:97162881-97162903 CTGATTACAAACTGGGGCAGGGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045959762 8:107953395-107953417 CTGAATCAAAACAAGGCCAGTGG + Intronic
1047237578 8:123055682-123055704 CTGAATGCAGAGTTGGACAGAGG - Intronic
1047909388 8:129510743-129510765 CTGGAGACAGACATGCACAGAGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1049297546 8:141850834-141850856 TTGAACACAGACATGCACAGGGG + Intergenic
1049803368 8:144528308-144528330 CTGATTACAAACTTGAAAAGAGG - Intronic
1050139216 9:2500061-2500083 TTGAATACAAACATGCAAAGAGG + Intergenic
1051506371 9:17831636-17831658 CTGAATGAAAACAGGGACAATGG - Intergenic
1051756103 9:20402573-20402595 CATAATAAAAACATGGAAAGAGG - Intronic
1052592981 9:30522482-30522504 ATGAATACAAGCATGTACATAGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1056388811 9:86121498-86121520 CTGGACACAGACATGCACAGAGG - Intergenic
1058811583 9:108644679-108644701 ATGAATCCGAACGTGGACAGTGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059767740 9:117399920-117399942 ATGAATACAGAAGTGGACAGTGG + Intronic
1186456715 X:9715451-9715473 CAGGCTACAAACCTGGACAGCGG + Intronic
1189545848 X:42042052-42042074 CTCTATACACACATGGAGAGAGG + Intergenic
1190722287 X:53159678-53159700 CTGAGTGCAAAGATGGAGAGAGG - Intergenic
1190908207 X:54748994-54749016 CACAAAACAAACATGGACATAGG - Exonic
1192124327 X:68487788-68487810 GAGAATCCACACATGGACAGAGG + Intergenic
1193556839 X:82964221-82964243 CTGAATCAAAAAATGGGCAGAGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194806359 X:98333235-98333257 CTGAATGCAAACCAAGACAGAGG - Intergenic
1195027227 X:100889554-100889576 TTGAATGCAAACATGCACATGGG + Intergenic
1195868016 X:109454312-109454334 CAGGATACAGACATGGACTGTGG - Intronic
1197889330 X:131251680-131251702 CTGAATAAAAACAAAGATAGTGG + Intergenic
1199907496 X:152248412-152248434 CTTAATACAAATAAGCACAGTGG + Intronic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic