ID: 1069764868

View in Genome Browser
Species Human (GRCh38)
Location 10:70847968-70847990
Sequence CAGCGGCATGAACTGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069764864_1069764868 -1 Left 1069764864 10:70847946-70847968 CCTGGGGTAGAGGAGAAGTGGGC 0: 1
1: 0
2: 3
3: 24
4: 302
Right 1069764868 10:70847968-70847990 CAGCGGCATGAACTGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069764868 Original CRISPR CAGCGGCATGAACTGTGCTG GGG Intronic
No off target data available for this crispr