ID: 1069765945

View in Genome Browser
Species Human (GRCh38)
Location 10:70859942-70859964
Sequence AAGTATACACAGATAAATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 380}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069765945_1069765950 16 Left 1069765945 10:70859942-70859964 CCCCTATTTATCTGTGTATACTT 0: 1
1: 0
2: 3
3: 27
4: 380
Right 1069765950 10:70859981-70860003 CAGTGTTTTTAGTGTACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069765945 Original CRISPR AAGTATACACAGATAAATAG GGG (reversed) Intronic
903430511 1:23294593-23294615 AAGTATTCACAGAAATAAAGTGG + Intergenic
903462506 1:23529695-23529717 AAGGACACACAGAGAATTAGTGG + Intronic
905805858 1:40877212-40877234 AAGACTACACAGCTAAAAAGAGG + Intergenic
906161345 1:43651061-43651083 AGGCATACAAAGATGAATAGGGG + Intronic
907282309 1:53359183-53359205 AAGGACACACAGCTAAAAAGTGG - Intergenic
908046015 1:60169613-60169635 AAGGACACACAAATAAATGGAGG - Intergenic
908947248 1:69513600-69513622 AAGTATAAAAATATAACTAGGGG + Intergenic
909210879 1:72821544-72821566 AATTATACACAAGAAAATAGAGG - Intergenic
909266201 1:73560809-73560831 AAGTACACAGAGATAAAATGAGG + Intergenic
909465754 1:75972410-75972432 TAGTATACACAGACAGAAAGAGG + Intergenic
910434277 1:87189574-87189596 GAGTATACAAAGATACATAGAGG - Intergenic
910633459 1:89381379-89381401 TAGTTTACACAGATAAAATGAGG - Intronic
913461490 1:119090720-119090742 AAAAATACACAAATAAATACAGG + Intronic
914261983 1:146006706-146006728 AAGAATACAAAGATAAAAAAGGG - Intergenic
915239332 1:154508704-154508726 AGGTATACAGGGATAAAGAGTGG - Intronic
915818792 1:158999237-158999259 AATTATACAGACATAAATAAAGG + Intergenic
915946679 1:160157711-160157733 GAGTATACACAGAGAGAGAGAGG + Intronic
916400684 1:164445267-164445289 AAGTCTACACAGGTGATTAGAGG + Intergenic
916455946 1:164971142-164971164 AAGGACACATAGCTAAATAGTGG + Intergenic
916831698 1:168498883-168498905 AAATTCACACAGACAAATAGTGG - Intergenic
917545581 1:175963489-175963511 AAGATTACACAGCTAAATAAGGG - Intronic
917911281 1:179649305-179649327 AAGAATACAAATATAAATATGGG - Intronic
918650467 1:186956347-186956369 AAGTGTACAAATATAATTAGTGG + Intronic
919107355 1:193169988-193170010 GATAATACACAGATACATAGAGG - Intronic
919138430 1:193539659-193539681 AAGCATACAAGGAAAAATAGGGG - Intergenic
919311264 1:195912804-195912826 AAATATACACAGTAAAATACTGG + Intergenic
921071762 1:211665383-211665405 TAGGATACACAGATAAGTATGGG - Intronic
922308426 1:224365069-224365091 AAGGTTACACAGCTAAATAATGG - Intronic
922859507 1:228804129-228804151 AAAAACACACAGTTAAATAGAGG - Intergenic
924048550 1:240057478-240057500 AATTGTATACAAATAAATAGAGG - Intronic
924420252 1:243902409-243902431 AAGTGTACACAGAACAGTAGAGG - Intergenic
1063011468 10:2025892-2025914 ACGTACACTCACATAAATAGAGG - Intergenic
1063773173 10:9227680-9227702 AAGAATTGCCAGATAAATAGTGG + Intergenic
1064777336 10:18793291-18793313 ATGTATACACATATATAAAGAGG + Intergenic
1065677415 10:28192910-28192932 AAGTATAAACAAATAGATAATGG + Intronic
1065893325 10:30139307-30139329 TAGAATACACAGAAAAATATAGG - Intergenic
1066995404 10:42558579-42558601 AAATATACACAAATAAAAATAGG + Intergenic
1067244334 10:44524461-44524483 AAGAAGACACAAACAAATAGAGG - Intergenic
1067757809 10:49018403-49018425 AAGTTCACACAGCTATATAGAGG + Exonic
1067822256 10:49540446-49540468 AAGTAAAAGCAGATATATAGTGG + Intergenic
1068057357 10:52027573-52027595 AAGTAGACACACATAAACAATGG + Intronic
1068350516 10:55838766-55838788 ATGTATACACATATACATATGGG - Intergenic
1068634353 10:59331956-59331978 AAGTAGGCAATGATAAATAGAGG + Intronic
1069765945 10:70859942-70859964 AAGTATACACAGATAAATAGGGG - Intronic
1069848108 10:71386706-71386728 CAAAATACACAGATACATAGAGG - Intergenic
1071993550 10:91124881-91124903 AAGTATAAATTGATCAATAGAGG + Intergenic
1073383199 10:103097595-103097617 AATTATACACATATTTATAGGGG + Intronic
1073384539 10:103113745-103113767 AAGTATAGAGAGACAAAAAGAGG + Intronic
1073785519 10:106885149-106885171 CAATTTAGACAGATAAATAGAGG + Intronic
1073811942 10:107161818-107161840 AAGTATATACATACAGATAGTGG - Intronic
1073827740 10:107344851-107344873 AAGTCAACACAAATAAATACTGG - Intergenic
1074988268 10:118677308-118677330 AAGTATAAACAGATGAAAATAGG - Exonic
1076919378 10:133443505-133443527 AGGTATACACAGACACACAGAGG + Intergenic
1078478353 11:11654066-11654088 GAGCATAGACAAATAAATAGTGG + Intergenic
1079173422 11:18117437-18117459 ATATATATACAGATATATAGTGG - Intronic
1079280088 11:19079494-19079516 AATTACACAGAGATAAATGGAGG + Intergenic
1079479858 11:20867958-20867980 AGGTAAACACAGAGAAATAGAGG + Intronic
1079523125 11:21352607-21352629 AAATACACACAAATAAATTGGGG + Intronic
1079593078 11:22205147-22205169 CAGAACACACAGATACATAGAGG + Intronic
1079799131 11:24846820-24846842 ATGTATACACACACACATAGAGG - Intronic
1079906587 11:26255725-26255747 ATGTATAAACAAATAAATAATGG - Intergenic
1079953387 11:26832554-26832576 GAGAAAACACACATAAATAGAGG + Intergenic
1080327640 11:31095872-31095894 AAGCATACACAAATAAATATTGG - Intronic
1081035621 11:38141527-38141549 GATTATACACACATATATAGTGG + Intergenic
1081229523 11:40567851-40567873 AAGTATACATACATGAATAAAGG - Intronic
1081310686 11:41567935-41567957 AAGCATATTCAGAGAAATAGTGG - Intergenic
1083017709 11:59473264-59473286 ATGTATACACAGACACATATGGG - Intergenic
1086960647 11:92977155-92977177 TAGTGTACACAGATATATATGGG - Intronic
1087536044 11:99446920-99446942 AAGTAAGCCCAGAAAAATAGGGG - Intronic
1087599577 11:100296009-100296031 AAGCATAGTCAAATAAATAGTGG - Intronic
1087605196 11:100368810-100368832 AAGGACACACAGATATAAAGTGG + Intergenic
1088161994 11:106883311-106883333 AGGTATACACACATAGATAAAGG - Intronic
1090307113 11:125701004-125701026 AAGTAGACCCAGATAAATTGAGG - Intergenic
1091942902 12:4505644-4505666 AAGCATGCACAGATAAGTAGTGG + Intronic
1092570093 12:9711736-9711758 AAGTAAGCACAGATAAGAAGAGG - Intergenic
1093133805 12:15424605-15424627 ATGTATACACAAACAAATAATGG + Intronic
1093825191 12:23676330-23676352 AAATATACACAAATAAAAACAGG + Intronic
1094035986 12:26072514-26072536 AAGTATATACATATATATGGGGG + Exonic
1095079934 12:37987533-37987555 AAATATCCCCAGATAAAAAGTGG + Intergenic
1095847809 12:46765030-46765052 AAGTATACAAAAATAAAAAGTGG - Exonic
1096322243 12:50625320-50625342 AAGGATAAACTGATAAATACAGG - Intronic
1097610288 12:61811589-61811611 TACTATATACAGATATATAGTGG - Intronic
1097633026 12:62087331-62087353 AAGTATACAAAGATAATTTCAGG + Intronic
1099321621 12:81157822-81157844 AAATATAAACAGAAATATAGAGG + Intronic
1099323005 12:81175397-81175419 AGGTAAACACAGAATAATAGTGG + Intronic
1100740690 12:97588339-97588361 AAATATATAAAGATAAATAGAGG - Intergenic
1100978421 12:100145336-100145358 AAGTTTACACAGTTATAAAGTGG - Intergenic
1101823066 12:108198900-108198922 TAGTTTACACAGGTCAATAGTGG + Intronic
1102941716 12:116948242-116948264 AAGTATTGAAAGAAAAATAGAGG - Intronic
1102946779 12:116996693-116996715 AAGTGTAGACAGATAACTCGTGG + Intronic
1103167296 12:118781116-118781138 GAGTAAACACAGAGAAATATAGG + Intergenic
1103636116 12:122306965-122306987 AAGGATACACAGATAGGCAGTGG - Intronic
1104090915 12:125517051-125517073 AAAGATACCCAGGTAAATAGGGG + Intronic
1105633175 13:22192179-22192201 CCATATACACATATAAATAGAGG + Intergenic
1105866566 13:24466110-24466132 AAATATACACATGTAATTAGTGG + Intronic
1105969782 13:25417856-25417878 AAGCATAAACAGATATACAGTGG + Intronic
1106726645 13:32493311-32493333 AATGATACACAAATAGATAGAGG - Intronic
1106958396 13:34969589-34969611 AAGAATACACTGACACATAGAGG - Intronic
1107614758 13:42154392-42154414 TTGTATTCACAAATAAATAGGGG + Intronic
1108894618 13:55309633-55309655 AATTCTACACAACTAAATAGAGG - Intergenic
1109662019 13:65472863-65472885 AAGGATTCACAGCTAAAAAGTGG + Intergenic
1109730914 13:66412537-66412559 ATGTATACATAAATAAAAAGTGG - Intronic
1109973033 13:69795253-69795275 AAATATACACAGATTGATGGGGG - Intronic
1110026622 13:70548350-70548372 AATAAAACAAAGATAAATAGCGG + Intergenic
1110438476 13:75501616-75501638 AAATAGCCACAGATAACTAGTGG + Intergenic
1110649937 13:77932443-77932465 AAGTAGACATAAATAAATAAAGG - Intergenic
1111093452 13:83477600-83477622 AAATATACACAGCTTAATATTGG + Intergenic
1111373475 13:87348445-87348467 AAAGATACACAGATAGGTAGAGG + Intergenic
1111535214 13:89595132-89595154 ACATATACACACATATATAGTGG - Intergenic
1112748195 13:102551795-102551817 AAGTCTACACAGATAGTGAGTGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112982383 13:105401105-105401127 AAATACACACATATCAATAGTGG + Intergenic
1112990002 13:105501626-105501648 AAGTATACACAAAAGAATTGCGG - Intergenic
1113060570 13:106317783-106317805 AATTATACAGAAATACATAGAGG - Intergenic
1116187829 14:41621071-41621093 AAGTATATACACAAATATAGAGG - Intronic
1116210978 14:41943409-41943431 AAATATAAACAGATAAACAGTGG + Intergenic
1116361837 14:44008494-44008516 AAGTCTACACAGAAAAATTTTGG - Intergenic
1116620457 14:47196529-47196551 TAATATAAACAGATGAATAGTGG + Intronic
1117582188 14:57162673-57162695 AAGTAGACACCGATTAATAATGG + Intergenic
1118161744 14:63297650-63297672 TTGTATACACAGTGAAATAGGGG + Intergenic
1118291246 14:64526475-64526497 GAATCTACACAGATATATAGTGG + Intronic
1118815443 14:69310114-69310136 TACTATAAACAGATCAATAGAGG - Intronic
1119464462 14:74844272-74844294 GTGTATATACAGTTAAATAGTGG + Intronic
1120728346 14:87972146-87972168 AATAATACACAGATAAGTTGTGG + Intronic
1120862282 14:89265701-89265723 AAGTATACACAGCTAGTAAGTGG + Intronic
1124247366 15:28082308-28082330 AAGTATCCACAGATTAGTAGGGG - Intronic
1124863828 15:33469906-33469928 AAGAATACAGAGATGAATACGGG + Intronic
1125068626 15:35524592-35524614 AAGGTTACACAGCTAAAAAGTGG - Intronic
1125480837 15:40078872-40078894 CACTATACACAGAGAAAGAGAGG - Intergenic
1125490678 15:40146482-40146504 ATGTATACACATATAGAGAGAGG + Intergenic
1126247104 15:46520016-46520038 CAATATAAAAAGATAAATAGGGG + Intergenic
1126560144 15:50034562-50034584 AAGTATAAACAGACAGATATGGG + Intronic
1127607312 15:60599650-60599672 AAATACACACAGATAAGAAGGGG + Intronic
1130602000 15:85282101-85282123 ATGTATACACACATATATATAGG - Intergenic
1133652402 16:7825051-7825073 CAGAACACACAGATACATAGAGG + Intergenic
1134592773 16:15469335-15469357 AAGAATACACATATAGATTGAGG - Intronic
1135150954 16:20005191-20005213 CAGTATACAAAGCCAAATAGTGG - Intergenic
1139140193 16:64252955-64252977 ACCAATACACAGATAGATAGAGG + Intergenic
1139622160 16:68154289-68154311 AACTATACACAGAATGATAGAGG - Intronic
1140079725 16:71734240-71734262 AAGTATGAATAGAAAAATAGAGG - Intronic
1140736109 16:77899203-77899225 AAGGTTACACAGACAAAAAGTGG + Intronic
1141013778 16:80428250-80428272 AATTTTATGCAGATAAATAGAGG - Intergenic
1142844052 17:2658325-2658347 AGGGAAACACAGATAAATAAGGG + Intronic
1143148847 17:4794627-4794649 CAGTATAAAAAGACAAATAGAGG + Intergenic
1144297511 17:13890291-13890313 ATGTATACACAGATAAAAAGGGG - Intergenic
1147765795 17:42834885-42834907 AAGAACACAAAGATAAATATAGG - Intronic
1147941971 17:44055286-44055308 AAGTATACATAGCTAAACATAGG + Intronic
1148532220 17:48405132-48405154 AAGTAGACAAAAATAAATAATGG + Intronic
1149098008 17:52868540-52868562 AAGTATGTAAAGATTAATAGTGG - Intronic
1149406601 17:56358181-56358203 GAGAATACACAGAGAAAGAGAGG - Intronic
1149449021 17:56735060-56735082 AAGGATAAACAGATGAACAGAGG - Intergenic
1149508738 17:57218933-57218955 AGGTTTACACAAATATATAGTGG + Intergenic
1150305812 17:64084400-64084422 AAGTCCACACAGATTAAGAGAGG - Intronic
1152480834 17:80551294-80551316 AAGTATAGAGAGAGAAATAAGGG + Intronic
1152481869 17:80559628-80559650 CAGCATACACAGAGAAACAGAGG - Intronic
1153107742 18:1547420-1547442 AAGTATACATGCATAATTAGAGG - Intergenic
1153948996 18:10041780-10041802 AATTATACACAAAGAAATAAAGG + Intergenic
1155288304 18:24314465-24314487 AAGTATTGACAGATAAAAATTGG + Intronic
1156075352 18:33270316-33270338 AAGTATATTCAAATAAATAATGG + Intronic
1156582734 18:38395998-38396020 AAATAGACACATATATATAGAGG - Intergenic
1156645567 18:39157835-39157857 AAGGAGGCAGAGATAAATAGAGG + Intergenic
1157634243 18:49134070-49134092 AAGAACAGAGAGATAAATAGAGG + Intronic
1157902106 18:51528361-51528383 AAGAATACAGATAGAAATAGGGG - Intergenic
1158035837 18:53029238-53029260 AAGGAAACACAGATATATGGGGG + Intronic
1158794919 18:60833582-60833604 AAATACATACAGATATATAGGGG - Intergenic
1158947049 18:62456266-62456288 CAATCTACACAGATATATAGAGG + Intergenic
1159136161 18:64339056-64339078 AACTATACACAGATAATTTGAGG + Intergenic
1159540500 18:69768332-69768354 ATATATACACAGAGAAAGAGAGG + Intronic
1159550257 18:69887435-69887457 AAGTTTATACAGAAAAATACAGG - Intronic
1159754889 18:72351904-72351926 AAGTATAGACTGAAAAGTAGGGG + Intergenic
1161674049 19:5633216-5633238 AAGTTCACACAGATAAATGAGGG - Intronic
1164096438 19:22013905-22013927 AAGTAAACAAAGATATAAAGTGG - Intergenic
1164199628 19:23005935-23005957 AAGTAAACAAAGATACAAAGTGG - Intergenic
1164880638 19:31729959-31729981 ATGGATAGATAGATAAATAGAGG - Intergenic
1164964455 19:32469895-32469917 AATTATTCACATGTAAATAGAGG + Intronic
1166651272 19:44576991-44577013 ACGGATACACAGATACACAGAGG + Intergenic
1168554926 19:57329969-57329991 ATGCATACACAGAAAAATAAAGG - Exonic
927130564 2:20055126-20055148 AAGTACACAGAAAAAAATAGTGG - Intergenic
927455488 2:23245527-23245549 AAGTATAAACACATAAAAAGTGG - Intergenic
927610821 2:24538617-24538639 AAGTATATACAGACATTTAGAGG - Intronic
928848731 2:35715184-35715206 AACTGTCCACAGATAGATAGAGG + Intergenic
929019454 2:37537174-37537196 AATTATAAACAAATAAATGGAGG - Intergenic
929244995 2:39691879-39691901 AAGCATACACACATATATAATGG + Intronic
929611327 2:43272942-43272964 AAGTAGACACATATAAATGATGG + Intronic
929836653 2:45407540-45407562 AAGTATATAAAAATGAATAGAGG - Intronic
930613083 2:53564587-53564609 AAGTTTACACAGTTAAGTACTGG - Intronic
932306966 2:70710700-70710722 AAGATTACACAGATAATAAGTGG - Intronic
932506439 2:72236746-72236768 TAGTATAAATAGATTAATAGTGG + Intronic
933345658 2:81082312-81082334 AAAGTAACACAGATAAATAGAGG - Intergenic
933451722 2:82461640-82461662 ACATATACAGACATAAATAGGGG + Intergenic
933486521 2:82931644-82931666 ATGCATACACAGATGAAAAGAGG - Intergenic
933838124 2:86262159-86262181 AAGTATAGAGAAAAAAATAGGGG - Intronic
933947533 2:87299598-87299620 AAGTTTACACAGCTAATAAGTGG - Intergenic
936332663 2:111561973-111561995 AAGTTTACACAGCTAATAAGTGG + Intergenic
937503987 2:122515640-122515662 AACAATAGACAGATTAATAGGGG + Intergenic
939842938 2:147210692-147210714 AATTATAGACAGAGAAAGAGAGG - Intergenic
941244508 2:163079868-163079890 CAGTTTACACAGATAATGAGAGG - Intergenic
941719494 2:168798407-168798429 AAGTATTCACAAACAAATATTGG - Intronic
942938908 2:181593262-181593284 AAGTAAAAAGAGATAAATAGAGG + Intronic
943046952 2:182871064-182871086 AAGTTCTCACAGATAAATAAGGG + Intergenic
943432488 2:187822079-187822101 ATGTATACAAATATAAATAGTGG - Intergenic
943861292 2:192866532-192866554 AAAAATACAAAGATAAATTGTGG - Intergenic
945780743 2:214168556-214168578 AAGTATACACAGTGAAAGAGTGG + Intronic
947108556 2:226694095-226694117 AACTTTACAGAGATAAACAGTGG - Intergenic
1169006400 20:2210747-2210769 AAATATACATAAATAAATATGGG + Intergenic
1169530227 20:6477103-6477125 AAGTATCCACAGACAAAGAGGGG + Intergenic
1169549994 20:6692640-6692662 AAGTTCACACAGTTAATTAGTGG + Intergenic
1169656166 20:7925941-7925963 AAGTATTTTCATATAAATAGTGG - Intronic
1169821727 20:9718781-9718803 AAGTATACACAAAGAAAAATTGG - Intronic
1170479733 20:16754042-16754064 AAGTATACACAGCTAGAAAACGG - Intronic
1171083452 20:22212601-22212623 AAGCATAAAAAGACAAATAGTGG - Intergenic
1171157161 20:22886222-22886244 AAATAAACACAGATACATGGGGG - Intergenic
1172742166 20:37177731-37177753 CAGTAGCCACAGATAACTAGTGG - Intronic
1173082653 20:39884065-39884087 AAAAAAACACAGAAAAATAGAGG + Intergenic
1174281038 20:49439508-49439530 AAGGGTACACAGTTAAAAAGGGG + Intronic
1175196612 20:57248164-57248186 CTGTATGCACATATAAATAGAGG - Intronic
1177286609 21:19059658-19059680 TATTATACACAGAAAAAAAGTGG - Intergenic
1177668888 21:24199358-24199380 AAGTATATTCACATAAAAAGTGG - Intergenic
1178032988 21:28549269-28549291 AAGTTTACACAGTTTGATAGAGG - Intergenic
1181232658 22:21430926-21430948 AAGAATAGAGAGATAAGTAGTGG + Intronic
1181245993 22:21503930-21503952 AAGAATAGAGAGATAAGTAGTGG - Intergenic
1183285675 22:36961357-36961379 AAGTTTACACAGCTACACAGAGG - Intergenic
1185293841 22:50043103-50043125 ATGGATAGACAGATAAACAGTGG + Intronic
1185389427 22:50550692-50550714 AAGTCTACACAGCTAAAAAGGGG - Exonic
949554189 3:5138432-5138454 ACATACACACAGCTAAATAGTGG - Intronic
951405168 3:22288312-22288334 AAATATACTCAAATAAATAATGG - Intronic
951601936 3:24386361-24386383 AAGGGTAGACAGGTAAATAGAGG - Intronic
953079646 3:39603790-39603812 AAGAAAACATAGATACATAGAGG - Intergenic
955985188 3:64566397-64566419 AAGTAAACACAGTTATATAATGG - Intronic
956146975 3:66200109-66200131 AAATATAAACAAATATATAGTGG + Intronic
958975703 3:100666227-100666249 AAGTATAGAGAAAGAAATAGGGG + Intronic
959255343 3:104004165-104004187 GACTATACACAGATAAAATGAGG - Intergenic
959919300 3:111853260-111853282 AAGGATACAAAGAGAAACAGTGG + Intronic
960644537 3:119864581-119864603 AAGTAGACACTTATAAATGGAGG + Intronic
961581574 3:127887669-127887691 ATTTATAGACAGATAAAGAGAGG + Intergenic
962231278 3:133667676-133667698 AAGCTTACACATATCAATAGAGG + Intergenic
962543552 3:136408804-136408826 AAGTCTAGACAGATAAAAAATGG + Intronic
964652918 3:159031914-159031936 AAGTATAAACTGATAACTTGTGG + Intronic
964814441 3:160701653-160701675 CAGTATACACAGCTCATTAGAGG + Intergenic
964929942 3:162005945-162005967 AAATATATACAGTTAAATTGTGG + Intergenic
965348473 3:167582564-167582586 AAGAATAAACAGACACATAGTGG - Intronic
966181347 3:177191684-177191706 AAGAATACACAGATAAAAAGTGG + Intronic
970425441 4:15941332-15941354 ACGCATACACTGATAAATTGTGG + Intergenic
971436387 4:26629174-26629196 AAGTATACCCAGAAACATATGGG - Intronic
971937776 4:33175138-33175160 ATGTTTACACAGATATATACAGG + Intergenic
972968781 4:44546627-44546649 AAGTATATACACATATATATGGG - Intergenic
973096451 4:46207253-46207275 AAGCATACACAAAAAAATAGTGG + Intergenic
973221942 4:47736674-47736696 AAGAATACATAGACACATAGAGG - Intronic
974206551 4:58710148-58710170 AATTATACACAAATAAAGACAGG - Intergenic
974431771 4:61807501-61807523 AAGTACTCACAGATACACAGGGG - Intronic
975242932 4:72083022-72083044 ATGTATACACATACAAACAGTGG - Intronic
976214335 4:82701620-82701642 AAGTTCACACAGCTAATTAGTGG - Intronic
976312750 4:83628601-83628623 AAGTATACACATCTACCTAGAGG - Intergenic
976670552 4:87647982-87648004 GAGAAGACACAGATAAATATGGG - Intergenic
976955871 4:90898713-90898735 AAGTATACAAAAATAAACAATGG - Intronic
977111222 4:92958136-92958158 AATTATACAAAGAGAAATAAAGG - Intronic
978538834 4:109793878-109793900 AGAAATTCACAGATAAATAGAGG - Intronic
980273966 4:130623756-130623778 AAGAACACACAGACACATAGAGG + Intergenic
980509404 4:133764903-133764925 AAATATATATAGATAGATAGTGG - Intergenic
980534215 4:134093872-134093894 AAATATACAAATATAAATATAGG - Intergenic
981743809 4:148032168-148032190 AAGTATAAAAAGATACAAAGTGG + Intronic
981985063 4:150844329-150844351 AAGCATACACACAAAAAAAGTGG - Intronic
982334845 4:154223128-154223150 GATTAGACACAGATAAAGAGAGG - Intergenic
982526113 4:156481478-156481500 AAATATGTAAAGATAAATAGTGG - Intergenic
982867692 4:160538075-160538097 GAGTATACATTGATAAACAGAGG - Intergenic
983214566 4:164991242-164991264 AAGTATAGAGAGAGAAATAAGGG - Intergenic
983818373 4:172161282-172161304 AAATATACACATATACATAAAGG - Intronic
984324327 4:178232143-178232165 AAATAGAAACAGATAAATAATGG + Intergenic
984461788 4:180046344-180046366 AAGAATACAGAGACAAAAAGAGG - Intergenic
985281417 4:188289839-188289861 GAGTATACAAAGAGAAACAGTGG + Intergenic
986111178 5:4719757-4719779 AAATATACACACAATAATAGTGG - Intergenic
987043399 5:14084525-14084547 AAGTAAACACACATAAAAATGGG + Intergenic
987513717 5:18877605-18877627 AATAATACTGAGATAAATAGTGG - Intergenic
987591600 5:19934894-19934916 AAATAAACCCAGATAAAAAGAGG + Intronic
988056925 5:26109193-26109215 AAGAATACACATACAAATAATGG + Intergenic
988792936 5:34625248-34625270 AAGTCTACACAGAAAAGTATAGG + Intergenic
988802784 5:34712097-34712119 AAGTCTACACAAATAAAGAGAGG - Intronic
989512597 5:42305560-42305582 AAGAATAGTCAGATAAACAGTGG + Intergenic
989834904 5:45975573-45975595 AAATATCCACAGATAAATACTGG + Intergenic
989840146 5:46054900-46054922 AAGTATCTTCAGATAAAAAGTGG + Intergenic
990396162 5:55381223-55381245 AAATAGAGACAGAAAAATAGAGG - Intronic
992376410 5:76192188-76192210 AGGTATACACAGATTACTTGGGG + Intronic
993100207 5:83529030-83529052 ATGTATACACACATATATACAGG + Intronic
993549518 5:89256524-89256546 AAGTATACATAGTTAATAAGTGG + Intergenic
994079390 5:95689986-95690008 AAGAATACATAGACACATAGAGG + Intronic
994227825 5:97274636-97274658 AGGTATACACAAACACATAGAGG + Intergenic
995508692 5:112886219-112886241 ACGTTTAAACAGGTAAATAGGGG - Intronic
996493586 5:124128007-124128029 ACGGACACACAGCTAAATAGAGG - Intergenic
996775057 5:127123745-127123767 CAGTATCGACACATAAATAGTGG + Intergenic
996831547 5:127745967-127745989 AAGTAAACACATAAAGATAGAGG - Intergenic
998468614 5:142365533-142365555 AAGTATACAAACATAAATGAGGG - Intergenic
998663922 5:144274207-144274229 AAGGATACAGAGAAAAAGAGGGG - Intronic
998985129 5:147748546-147748568 AAGTTTGCACAGATGAATACTGG + Intronic
999991175 5:157051510-157051532 AAATTTACACAGATAGAAAGTGG - Intronic
1000396301 5:160778031-160778053 AAGGATACACACATACAAAGTGG + Intronic
1000989743 5:167899570-167899592 AAGGTTACACAGATAAAACGTGG + Intronic
1002717669 5:181238377-181238399 AGGTATACAGAGATAAATATTGG - Intronic
1003358846 6:5404049-5404071 AAGTTTACACAGATAGTAAGCGG + Intronic
1003392582 6:5726500-5726522 AAAGAAACACAGATAAACAGTGG + Intronic
1005032995 6:21528871-21528893 AAGGTCACACAGATAATTAGTGG - Intergenic
1005216823 6:23538640-23538662 AAGAATACACAAATAAATTAAGG - Intergenic
1005703063 6:28423191-28423213 AGGGATACACAGACAAAGAGGGG + Intergenic
1006669896 6:35723555-35723577 AAGTAAACACCGATAGATGGAGG + Intronic
1007648967 6:43405255-43405277 GAGTATAAACAGAAAAAAAGTGG + Intergenic
1007973004 6:46072035-46072057 GAGAACACACAGACAAATAGAGG + Intronic
1008733866 6:54517981-54518003 AAATATAAACAGATTAAAAGTGG - Intergenic
1008842366 6:55919394-55919416 AAGCAAACACATGTAAATAGAGG - Intergenic
1010338758 6:74722830-74722852 AAGCATACACAGAAAAAGAAAGG - Intergenic
1011105088 6:83770302-83770324 AATTATGCACAAATAAACAGAGG + Intergenic
1011909077 6:92411912-92411934 AAGGAAAAACAGATAAATAAAGG - Intergenic
1012136161 6:95559840-95559862 AAAAATACACAGATAAATGAAGG - Intergenic
1012324107 6:97893000-97893022 AAGGTTAGACAGCTAAATAGTGG + Intergenic
1012715465 6:102662634-102662656 AAGAAGAGACAGATAGATAGAGG + Intergenic
1012857886 6:104524903-104524925 AAGTATAGACAGATCAACAATGG + Intergenic
1012911470 6:105122631-105122653 TACTATACACAGAGAAATACAGG + Intronic
1013299817 6:108794514-108794536 ATATAAACATAGATAAATAGAGG - Intergenic
1013629934 6:111976556-111976578 AAATATACACAGTTAGAGAGAGG - Intergenic
1013939375 6:115643785-115643807 AAATATACACACATACATACAGG + Intergenic
1014303159 6:119708943-119708965 AAGTATACATGGATAAATCTGGG - Intergenic
1014463360 6:121726330-121726352 AAATATAGACATATAATTAGAGG + Intergenic
1014488806 6:122036358-122036380 AAGCATACACATATCTATAGAGG + Intergenic
1015413768 6:132924885-132924907 AAAGATACAAAGATAAATAGTGG + Intergenic
1016165733 6:140939839-140939861 AAGTATACACACATAATTCTAGG - Intergenic
1016689498 6:146920204-146920226 AAATATACAGAGATGCATAGGGG - Intergenic
1016812242 6:148272719-148272741 AAGTTTTCATAGATAAGTAGAGG - Intronic
1017506184 6:155070811-155070833 ATGTAGACACACATAAATAAAGG - Intronic
1017663277 6:156694626-156694648 ATGAATAAACAGATAAATGGTGG + Intergenic
1017750203 6:157484476-157484498 ATATATACACACACAAATAGAGG + Intronic
1017965866 6:159265521-159265543 AAGTATACACATTTCAATAAGGG - Intronic
1018130334 6:160724596-160724618 ATGTTTACACAGAAGAATAGTGG + Intronic
1020561417 7:9732394-9732416 AAATATATATATATAAATAGAGG - Intergenic
1021167486 7:17359308-17359330 AAGCATAAACAGATAAAGAAGGG + Intergenic
1022297514 7:29069694-29069716 AAGGATACACAAATAGATTGTGG - Intronic
1022900911 7:34809823-34809845 GAGAACACACAGATACATAGAGG - Intronic
1023489027 7:40717585-40717607 ATGCCTACACAGATAAAAAGGGG - Intronic
1024819622 7:53312160-53312182 ATGTATACATAGAGAAAGAGTGG - Intergenic
1027862058 7:83596793-83596815 AGATTTACACAGATAAATATAGG - Intronic
1027919311 7:84372155-84372177 AAATTTACACACACAAATAGTGG - Intronic
1030863471 7:114668036-114668058 AAGTCTGCAAAGAGAAATAGAGG + Intronic
1031662887 7:124448589-124448611 AAGTAAACACAAATAATAAGAGG + Intergenic
1032797563 7:135289906-135289928 ATTTATACACATATACATAGTGG - Intergenic
1033682938 7:143613974-143613996 GAGTAAATAAAGATAAATAGAGG + Intergenic
1035915875 8:3621501-3621523 AAATTTACAGAGATGAATAGTGG + Intronic
1037209869 8:16374087-16374109 AACTCAACACAGATAAATAAAGG - Intronic
1038555640 8:28511764-28511786 TAATATACACACAAAAATAGAGG - Intronic
1038770648 8:30476230-30476252 AAGTTTACACACATAAAAATTGG + Intronic
1039354214 8:36797416-36797438 AAAGATACACAGAGAAATATAGG - Intronic
1040126091 8:43739625-43739647 AAGTATACAGAAAGAAATAAGGG + Intergenic
1040137415 8:43870886-43870908 AAATATCCACAGATAAAAACAGG + Intergenic
1040889526 8:52302411-52302433 AAACATACACACATAAATACAGG - Intronic
1041567580 8:59297468-59297490 ATGGATACATAGATACATAGAGG - Intergenic
1043202573 8:77388795-77388817 AAGTTTACACAGTTAATAAGTGG + Intergenic
1044146953 8:88728750-88728772 AAGTTTACATAGATAACAAGTGG - Intergenic
1044968502 8:97596755-97596777 AAGCATAAAAAGATAAATAAAGG - Intergenic
1046192372 8:110813382-110813404 AAGTATACAGAAACAATTAGAGG - Intergenic
1046679672 8:117154709-117154731 AACTTTACACAGACAAATAATGG - Intronic
1047033017 8:120904117-120904139 GAGTATACACAGATGAATAAGGG + Intergenic
1047572936 8:126120868-126120890 AAAAACACACAGATAAGTAGGGG + Intergenic
1047668942 8:127123821-127123843 AAAAGTACACAGAAAAATAGAGG + Intergenic
1050179713 9:2907856-2907878 AAGTATACAGAGAGAAAAATAGG - Intergenic
1050598945 9:7231431-7231453 AAGAATGCCCAGATAAATAAGGG + Intergenic
1050866731 9:10509867-10509889 ACTTATATACAGATAAATAGAGG - Intronic
1051043730 9:12848272-12848294 GAGTATACAAAGAAAAATAAAGG + Intergenic
1051115479 9:13688971-13688993 AAGTACACACAGAGACACAGAGG - Intergenic
1051668334 9:19486063-19486085 AAGTATACAGAGAACATTAGAGG - Intergenic
1052011059 9:23409772-23409794 AAATATAAACAGATACATATTGG + Intergenic
1052631711 9:31049727-31049749 AAATGTAAACAGGTAAATAGTGG - Intergenic
1056466884 9:86865775-86865797 TAGAAGACTCAGATAAATAGGGG - Intergenic
1056770917 9:89477628-89477650 AAGTACACACACATCCATAGAGG - Intronic
1057532354 9:95861844-95861866 AAGAAGACACAAATAAATGGGGG - Intergenic
1057889879 9:98861840-98861862 AAGTTTGCACAGATAATAAGCGG + Intergenic
1058897249 9:109411024-109411046 AAGTAGCCACATATAACTAGTGG - Intronic
1059593002 9:115683783-115683805 AAATAAAGACAGAAAAATAGGGG - Intergenic
1059613201 9:115921507-115921529 AAGAATTCACCGAGAAATAGAGG + Intergenic
1059646572 9:116274004-116274026 AAGGATACACAGTTAAATGGTGG + Intronic
1060469723 9:123938399-123938421 TGGTACACACAGCTAAATAGGGG - Intergenic
1062304502 9:135896393-135896415 AAGTTGACACAGCTAAAAAGAGG + Intronic
1185752168 X:2621373-2621395 TAGTATAAACAGAAAAATAGTGG - Intergenic
1186085541 X:5986234-5986256 AAGTATAAAAATATAAATTGCGG + Intronic
1187406058 X:19005066-19005088 AAGGACACACAGATAGAAAGTGG + Intronic
1188205110 X:27346331-27346353 CCGTATACACATATATATAGGGG - Intergenic
1188659341 X:32739183-32739205 AAGTTTACACAGCTAAAAAGTGG + Intronic
1189172324 X:38921408-38921430 AAGTATGCACAACTAATTAGTGG - Intergenic
1189900327 X:45699862-45699884 AAGTATAGAGAGAGAAAGAGGGG + Intergenic
1190256419 X:48766078-48766100 AAATATAAAGAGATCAATAGAGG + Intronic
1190339840 X:49287331-49287353 AATTATACAAAAATAAATACAGG - Exonic
1190471132 X:50780835-50780857 AAGGATATAAAGATAAATATAGG + Intronic
1191581091 X:62761755-62761777 AAATATCCCCAGATAAATACTGG - Intergenic
1191581792 X:62770713-62770735 TAATATACTCAGATAAAAAGTGG - Intergenic
1191582027 X:62773760-62773782 AAATATTCACAGATAAAAACTGG - Intergenic
1193246970 X:79240270-79240292 ATGTATAGATGGATAAATAGTGG + Intergenic
1193439650 X:81523949-81523971 AAGTATACACATAAACATGGTGG - Intergenic
1194460479 X:94161146-94161168 GAGTATACACAGACACAAAGAGG - Intergenic
1194784506 X:98065287-98065309 AAGTAGACACATTTAAGTAGAGG - Intergenic
1194873192 X:99158639-99158661 AAGTATACATGGATATAAAGAGG + Intergenic
1195173867 X:102296170-102296192 AAGGAGACACAGACACATAGGGG + Intergenic
1195184998 X:102390923-102390945 AAGGAGACACAGACACATAGGGG - Intronic
1196185255 X:112738625-112738647 AAGTGTACACAGATGAATAGTGG - Intergenic
1196198658 X:112861232-112861254 AAGGTTACACAGATAATTGGTGG + Intergenic
1196295388 X:113990985-113991007 AAGTATAGAGAGAGAAAAAGGGG - Intergenic
1196469299 X:116007780-116007802 AAGTAAGCACAGAAAAATATTGG + Intergenic
1197073630 X:122329790-122329812 AAGTCTACAAAAATAAATAATGG + Intergenic
1197341567 X:125281718-125281740 AAGTTTTCAGGGATAAATAGGGG - Intergenic
1198143454 X:133830217-133830239 AAATATACCCACACAAATAGGGG + Intronic
1198169128 X:134088334-134088356 AAGTTTACAAAAATAAATAATGG + Intergenic
1198326184 X:135575975-135575997 AAGCATAGAAAGATAAATTGAGG - Intronic
1199013706 X:142787199-142787221 AACTATATACATATAAATATGGG - Intergenic
1201295894 Y:12462962-12462984 AAGTATAGAGAAAGAAATAGGGG + Intergenic
1201855859 Y:18540800-18540822 AAGAAGACACAGATGAATACTGG + Intergenic
1201877462 Y:18779585-18779607 AAGAAGACACAGATGAATACTGG - Intronic
1202112084 Y:21432126-21432148 AAGTATACTCAAACAAATATTGG + Intergenic