ID: 1069768470

View in Genome Browser
Species Human (GRCh38)
Location 10:70881848-70881870
Sequence CCCTTTCCTGGCCTTTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069768462_1069768470 -9 Left 1069768462 10:70881834-70881856 CCTCCAGCCTCTGCCCCTTTCCT No data
Right 1069768470 10:70881848-70881870 CCCTTTCCTGGCCTTTGCTGGGG No data
1069768461_1069768470 21 Left 1069768461 10:70881804-70881826 CCTCTTGTGAACAATACGCTTAT No data
Right 1069768470 10:70881848-70881870 CCCTTTCCTGGCCTTTGCTGGGG No data
1069768460_1069768470 22 Left 1069768460 10:70881803-70881825 CCCTCTTGTGAACAATACGCTTA No data
Right 1069768470 10:70881848-70881870 CCCTTTCCTGGCCTTTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069768470 Original CRISPR CCCTTTCCTGGCCTTTGCTG GGG Intergenic
No off target data available for this crispr