ID: 1069769376

View in Genome Browser
Species Human (GRCh38)
Location 10:70887978-70888000
Sequence CCAGCGCCACCAAGCCCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 188}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069769369_1069769376 17 Left 1069769369 10:70887938-70887960 CCGGGGGTGGGTGGGGGAAGCTC 0: 1
1: 2
2: 6
3: 54
4: 438
Right 1069769376 10:70887978-70888000 CCAGCGCCACCAAGCCCCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1069769368_1069769376 18 Left 1069769368 10:70887937-70887959 CCCGGGGGTGGGTGGGGGAAGCT 0: 1
1: 0
2: 5
3: 72
4: 588
Right 1069769376 10:70887978-70888000 CCAGCGCCACCAAGCCCCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1069769356_1069769376 29 Left 1069769356 10:70887926-70887948 CCCGCCCCCGCCCCGGGGGTGGG 0: 1
1: 1
2: 7
3: 70
4: 643
Right 1069769376 10:70887978-70888000 CCAGCGCCACCAAGCCCCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1069769364_1069769376 23 Left 1069769364 10:70887932-70887954 CCCGCCCCGGGGGTGGGTGGGGG 0: 1
1: 0
2: 12
3: 89
4: 823
Right 1069769376 10:70887978-70888000 CCAGCGCCACCAAGCCCCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1069769360_1069769376 25 Left 1069769360 10:70887930-70887952 CCCCCGCCCCGGGGGTGGGTGGG 0: 1
1: 0
2: 1
3: 35
4: 383
Right 1069769376 10:70887978-70888000 CCAGCGCCACCAAGCCCCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1069769366_1069769376 22 Left 1069769366 10:70887933-70887955 CCGCCCCGGGGGTGGGTGGGGGA 0: 1
1: 1
2: 4
3: 46
4: 399
Right 1069769376 10:70887978-70888000 CCAGCGCCACCAAGCCCCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1069769358_1069769376 28 Left 1069769358 10:70887927-70887949 CCGCCCCCGCCCCGGGGGTGGGT 0: 1
1: 0
2: 1
3: 26
4: 326
Right 1069769376 10:70887978-70888000 CCAGCGCCACCAAGCCCCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1069769354_1069769376 30 Left 1069769354 10:70887925-70887947 CCCCGCCCCCGCCCCGGGGGTGG 0: 1
1: 0
2: 7
3: 75
4: 549
Right 1069769376 10:70887978-70888000 CCAGCGCCACCAAGCCCCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1069769367_1069769376 19 Left 1069769367 10:70887936-70887958 CCCCGGGGGTGGGTGGGGGAAGC 0: 1
1: 1
2: 1
3: 29
4: 415
Right 1069769376 10:70887978-70888000 CCAGCGCCACCAAGCCCCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1069769362_1069769376 24 Left 1069769362 10:70887931-70887953 CCCCGCCCCGGGGGTGGGTGGGG 0: 1
1: 0
2: 7
3: 50
4: 575
Right 1069769376 10:70887978-70888000 CCAGCGCCACCAAGCCCCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069769376 Original CRISPR CCAGCGCCACCAAGCCCCCG TGG Intronic
900346018 1:2210562-2210584 CCACCCCCACCCAGCCCCCAAGG - Intronic
900427450 1:2587030-2587052 CCAGCCCCGCCCAGGCCCCGCGG - Intronic
900472911 1:2863407-2863429 CCATAGCCACCACCCCCCCGTGG - Intergenic
900518665 1:3095344-3095366 CCAGCGGCACCCAGCACCCCTGG - Intronic
900526689 1:3132795-3132817 CCTGCCCCACCCAGTCCCCGGGG - Intronic
900575856 1:3382160-3382182 CCAGGGCCACCAGCCCCACGTGG - Intronic
900704531 1:4071992-4072014 CAAGGGCCACCCAGCCCCCAGGG - Intergenic
900732836 1:4273956-4273978 CCAGCGGCACCAAGCCCTGCTGG + Intergenic
900947741 1:5840903-5840925 CCAGCCGCACCCAGCCCCCTTGG + Intergenic
901464705 1:9413674-9413696 CCGGCCCCACCAAACCTCCGGGG + Intergenic
901866981 1:12112786-12112808 CCAGCGCCAGCAGCACCCCGAGG + Intronic
903192754 1:21666097-21666119 CCAGCTCCACCATGCTCCCTCGG - Intronic
905036034 1:34918845-34918867 CCAGCCCCACCCTGCCCCAGGGG + Intronic
905205895 1:36342721-36342743 CCAGAGCCTCCTGGCCCCCGAGG - Intronic
905210903 1:36373524-36373546 TCATAGCCACCAAGCTCCCGGGG - Intronic
905460366 1:38118833-38118855 CCAGAGCCACCCAGTCTCCGGGG + Intergenic
906693920 1:47811340-47811362 GCAGCACCACCAAGTCCACGGGG - Intronic
907671274 1:56476987-56477009 CCAGGCCCACCAGGCCCTCGAGG - Intergenic
912484330 1:110012919-110012941 CCAGCGGCACTGAGCCCCCAGGG - Exonic
912951092 1:114121056-114121078 CCATAGCCACCAAGGCCCCCAGG + Intronic
918133400 1:181648005-181648027 CCAGCACCAGCAAGGCCCTGGGG - Intronic
922236674 1:223727433-223727455 CCAACTCCGCCAAGCCCCCAGGG - Intronic
922305836 1:224343744-224343766 CCAGTGCCACCTAGCCTCCATGG + Intergenic
923631078 1:235649864-235649886 CCTGCGCCCCCAGGCCCGCGTGG - Exonic
923721692 1:236472454-236472476 CCAACCCCACCAAACCCCCAGGG - Intronic
1067166311 10:43868928-43868950 CCAGCAACACCAAGCCACCAAGG - Intergenic
1069631997 10:69902781-69902803 CCAGGGCCCCCAGGCCCCCCTGG + Exonic
1069698437 10:70404640-70404662 CCAGCTCCACCGAAGCCCCGGGG + Intronic
1069769376 10:70887978-70888000 CCAGCGCCACCAAGCCCCCGTGG + Intronic
1073510825 10:104041311-104041333 CCAGGCCCACCAGGACCCCGAGG - Exonic
1075418838 10:122285919-122285941 TCAAAGCCACTAAGCCCCCGAGG + Intronic
1075875578 10:125803348-125803370 CCAGAGCCTCCAGGACCCCGTGG + Intronic
1077160676 11:1111122-1111144 CCAGGGCCACCCGACCCCCGGGG - Intergenic
1077246603 11:1542298-1542320 CCAGGGGCACCAGGCCCCCACGG - Intergenic
1077494603 11:2880795-2880817 CCAGGCCCACCAAGGCCCCCTGG + Intergenic
1077970344 11:7182285-7182307 CAAGCTCCCCCAAGCCCCAGAGG - Intergenic
1078690931 11:13579739-13579761 CCACCGCCACCACGGCCCCATGG - Intergenic
1080858200 11:36130375-36130397 CCAGCCCCTTCCAGCCCCCGTGG - Intronic
1083303084 11:61748902-61748924 CCAGCTCCACCTAGTCCCCAAGG - Intergenic
1083620873 11:64048814-64048836 CTATCCCCACCAAGCACCCGAGG + Intronic
1084304330 11:68271872-68271894 CGAGGGCCACCAGGCCGCCGGGG - Exonic
1084667638 11:70585030-70585052 CCAGTGCATCCAAGCCCCTGGGG - Intronic
1090187010 11:124745659-124745681 CCAGCTCCGCCAGGCCCCCCAGG - Exonic
1090247507 11:125226919-125226941 CCAGAGCCTCCCAGCCCCAGCGG - Intronic
1090333355 11:125947687-125947709 CCAGCCCCACCCGACCCCCGAGG + Intergenic
1090596329 11:128324656-128324678 GCAGCCCAAGCAAGCCCCCGTGG + Intergenic
1090803359 11:130188185-130188207 CCAGCACCACCCAGCGCCCCGGG - Exonic
1095440985 12:42238426-42238448 CCAGCGCGGCCCAGCACCCGCGG + Intronic
1103274681 12:119701473-119701495 CCAGCACCACCAAGTCCCCTTGG - Intronic
1103561668 12:121796121-121796143 CCAGCGCGGCCCAGCCTCCGAGG - Intronic
1106078215 13:26479065-26479087 CCTGCTCCACAAAGCCCCCTGGG + Intergenic
1107959011 13:45542690-45542712 CCAGCACTACCAAGCCCGAGTGG - Intronic
1113378627 13:109784799-109784821 GCAGCGCCACCTTGCTCCCGCGG + Exonic
1113625834 13:111845751-111845773 CCAGCTGCAGCAAGCCCCGGTGG + Intergenic
1113711261 13:112466869-112466891 CCAGCGCCACCCACACGCCGCGG + Intergenic
1119596648 14:75941107-75941129 GCAGCACCACCAAGCCCTCATGG - Intronic
1122736588 14:103847210-103847232 CCCGCGGCTCCCAGCCCCCGCGG - Intronic
1123689643 15:22827332-22827354 CCAGCACCACAAAGCCCCCCTGG + Exonic
1123710024 15:22980293-22980315 CCAGGACCCCCAAGCCGCCGCGG - Exonic
1123753628 15:23379211-23379233 GCTGAGCCCCCAAGCCCCCGAGG - Intergenic
1124187252 15:27541692-27541714 CCAGGGCCTCCAATCCCTCGCGG - Exonic
1124252843 15:28118274-28118296 CCAGCTCCCCGAAGCCCACGGGG + Intronic
1125657157 15:41367420-41367442 CCACCCCTACCAAGCCCCTGTGG + Intronic
1127801244 15:62479160-62479182 CCAGCTCCCCCAAGCTCCAGAGG - Intronic
1128017093 15:64356931-64356953 CCACCACCACCCCGCCCCCGAGG - Intronic
1129779409 15:78260252-78260274 CCAGATCCACCCAGCCCCCGGGG + Intergenic
1130969044 15:88718073-88718095 CCAGGGCCCCCAAGCCGACGCGG - Intergenic
1132670843 16:1101787-1101809 CCAGAGGCACCCAGCCCCTGGGG + Intergenic
1132778518 16:1610524-1610546 CCGGCGCCGCCGAGTCCCCGCGG - Intronic
1132838059 16:1964573-1964595 CCAGGGCCACCAGGGCCCCCGGG + Exonic
1132843462 16:1989755-1989777 CGAGCCCCACCCTGCCCCCGGGG + Intronic
1137785463 16:51134414-51134436 CCGCCGCCGCCAAGTCCCCGGGG - Intergenic
1138349913 16:56341000-56341022 CCAGGGACAGCAGGCCCCCGAGG + Intronic
1138360623 16:56424992-56425014 CTAGGCCCACCACGCCCCCGCGG + Intronic
1139432416 16:66918241-66918263 CCAGGCCCACCAAGGCCCCCAGG + Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141499827 16:84436365-84436387 CCAGGGCGAGCAAGCCCACGTGG - Intronic
1142263046 16:89051399-89051421 CCAGCTCCTCCAAGCCCGGGAGG - Intergenic
1142279178 16:89138760-89138782 GCAGGGCCACCAGGCCCACGAGG + Intronic
1142434397 16:90047540-90047562 CCAGCGACACCTAGGCCCCCAGG - Intergenic
1142622041 17:1171421-1171443 CCAGCTCCACCGATGCCCCGGGG + Intronic
1143485384 17:7251338-7251360 CCAGCTCCGCCAGCCCCCCGGGG + Exonic
1144604563 17:16653488-16653510 CCAGCGCCGCCAGGCCCGCAGGG + Intronic
1146568975 17:33936968-33936990 CCACCTCCACCAAGCCCAAGCGG + Intronic
1148820376 17:50356447-50356469 CCAGCCCCACCATGCCCTCTGGG + Intronic
1149470290 17:56910803-56910825 CCAAGGCAACCCAGCCCCCGAGG + Intronic
1150132575 17:62677276-62677298 CCAGCGCCACGCAGCCCCCACGG - Exonic
1150138885 17:62712225-62712247 ACAAAGCCACCCAGCCCCCGGGG + Intronic
1151590607 17:75041737-75041759 CATGCGCCACCACGCCCCAGGGG - Intronic
1151728453 17:75897414-75897436 CCACCCCCAACAATCCCCCGGGG + Intergenic
1151829109 17:76539107-76539129 CCAGCCCCTCCAAGACCCCCAGG - Intronic
1152178652 17:78803885-78803907 CCAGTACCCCCAAGCCCCCAGGG - Exonic
1152458206 17:80428004-80428026 CCAGACCCCCCATGCCCCCGGGG + Intronic
1152463015 17:80451084-80451106 ACTTCGCCACCCAGCCCCCGAGG - Intergenic
1153565697 18:6415020-6415042 CCAGCGCCACCCGGCTCCCCGGG - Intronic
1160514247 18:79469810-79469832 CCAGCCCCACCAGCCCCCAGGGG + Intronic
1161138872 19:2636491-2636513 CCAGGGCCACCCAGCCCTCCAGG + Intronic
1161379904 19:3959397-3959419 CCAGCGCCTCCACGTCCTCGTGG + Exonic
1161518941 19:4713012-4713034 CCAGCGCCACCCCACCCCCAAGG + Intronic
1162646275 19:12052631-12052653 CCAGCTCCACCCAGCGGCCGAGG + Intronic
1163170494 19:15527625-15527647 GCAGCCTCACCCAGCCCCCGTGG - Intronic
1163469028 19:17486302-17486324 CCAGGGCCACCAAGCCAGCTGGG + Intronic
1163501381 19:17678610-17678632 TCAGCCCCACCCAGCCCCCAGGG + Intronic
1164517392 19:28948025-28948047 CCAGCCCCTCCAAGTCCACGTGG + Intergenic
1167079870 19:47271423-47271445 CCAAGACCACCAAGCCCCAGAGG + Exonic
1168161446 19:54513032-54513054 CCACCGCCCCCAAGCCCACCTGG + Intergenic
926077486 2:9952243-9952265 CGAGCCCCACCAGGCTCCCGAGG - Intronic
927698153 2:25251596-25251618 CCACCGCCCCCAAGCCCATGCGG + Intronic
928287907 2:30009239-30009261 CCAGTGCCACCAGGCCCACTTGG + Intergenic
933487040 2:82936964-82936986 CCACCGCCACCCAGCCCTCCAGG - Intergenic
937089763 2:119198396-119198418 CCAGCCCCACCAAGGCCATGAGG + Intergenic
937932923 2:127219823-127219845 CCAGCTCCCCCAACCCACCGCGG + Intronic
945039630 2:205733234-205733256 CCAGCGTCACCCAGCTCCCGTGG + Intronic
946233274 2:218306012-218306034 CCAGCCCTACCATGCCCCCGGGG - Intronic
946326360 2:218986447-218986469 CCAGAGCCACGAAGCCCCATAGG - Intergenic
947026790 2:225745112-225745134 CCAGCGAGACCACGACCCCGGGG + Intergenic
947142259 2:227030505-227030527 CCAGGGCCACCAGGTCCCCCTGG - Exonic
947603599 2:231469400-231469422 CCAGCTCCACCAGGTCCCCCAGG + Intronic
947720909 2:232368661-232368683 CCAGGGCCACCTGGGCCCCGCGG + Intergenic
947734437 2:232447353-232447375 CCAGGGCCACCTGGTCCCCGAGG + Intergenic
948189128 2:236044811-236044833 CCAGAGCCAGGAAGCCCCCAGGG - Intronic
948422688 2:237870260-237870282 CCAGGGTCACCAGGCCCTCGGGG - Intronic
948867224 2:240782301-240782323 CCAGGGCCCCCACGCCCCCCGGG + Intronic
948875150 2:240822568-240822590 GCAGTGCCACCAAGCCCCTGGGG - Intergenic
1168753146 20:297817-297839 CCGGCGCCGCCAGGCCCGCGGGG - Exonic
1171852291 20:30317128-30317150 CTAGGCCCACCAAGGCCCCGCGG + Intergenic
1174096487 20:48093450-48093472 CCAGGGCCACCATGCCTCCAGGG - Intergenic
1174342467 20:49906426-49906448 CCCGCGTGACCAAGCCCTCGAGG - Exonic
1175289929 20:57868788-57868810 CCAGCTCCACAGAGCCCCCTCGG - Intergenic
1175847589 20:62066474-62066496 CCGGCCCCTCCAAGCCGCCGCGG + Intergenic
1176200807 20:63859491-63859513 CCAGAACCACCAATCCCCAGGGG + Intergenic
1179123298 21:38568835-38568857 CCAGCCTCATCAAGCACCCGAGG + Intronic
1179880402 21:44291228-44291250 CCAGCGCAACCAGGCCACCCCGG + Intronic
1180191706 21:46168469-46168491 CCAGAGCCACATAGCCACCGAGG - Exonic
1180669271 22:17540691-17540713 GCAGCTCCACACAGCCCCCGCGG + Exonic
1181590585 22:23882678-23882700 CCTGCAACACCAAGCCCCCGGGG - Intronic
1181731701 22:24851693-24851715 TCAACGCCACCACGCCCCCTTGG - Intronic
1182791892 22:32960127-32960149 CCAGGGCCAGCAAGGCCCAGGGG - Intronic
1183440434 22:37819987-37820009 CCAGCTCCTCAAAGGCCCCGGGG - Intergenic
1183976392 22:41514923-41514945 CCAGCCCCACAAGGCCCCTGAGG - Intronic
1184244514 22:43229033-43229055 CCAGGGCCACCTCCCCCCCGAGG - Intronic
1184557571 22:45241286-45241308 CCACCTCCACCAAGTCCCCTCGG + Intergenic
953407308 3:42665760-42665782 CCAGTCCCCCCAATCCCCCGAGG - Exonic
954426732 3:50447325-50447347 CCATCGCCTCCAAGACCCCATGG - Intronic
960115068 3:113885233-113885255 CCAGCTCCGCCAGCCCCCCGGGG - Intronic
961539372 3:127589852-127589874 CCAGCACCGCCAAGCCCCGCTGG + Intronic
961813608 3:129536006-129536028 CCAGCCTCACCAAGGCACCGAGG - Intergenic
969083841 4:4640808-4640830 CCAGCGCCCTCAAAGCCCCGAGG - Intergenic
975650318 4:76586356-76586378 CCCAAGCCACCAAGCCCCCGCGG + Intronic
976658129 4:87510876-87510898 CCAGCCACGCCAAGCCCCAGAGG - Intronic
985045115 4:185932732-185932754 CCAGGGCAACCGAGCCCCAGGGG - Intronic
985591784 5:769495-769517 CCAGCTCCACCATGCCAGCGTGG - Intergenic
985609699 5:880454-880476 CCAGCTCCACCATGCCAGCGTGG - Intronic
998435941 5:142108895-142108917 CCAGCGCTCCCAAGCCGCAGCGG + Exonic
999768245 5:154756259-154756281 CCAGCACCTCCAGGGCCCCGGGG + Intronic
999820416 5:155222450-155222472 CCAGTGCCACCTTGCCCCAGAGG + Intergenic
1002426518 5:179179996-179180018 CCAGGGCCATCCAGCACCCGAGG - Intronic
1005987286 6:30883007-30883029 CCTGTCCCACCAAGCCCCCAGGG - Intronic
1007419576 6:41711687-41711709 TCAGCTCCCCCAAGCCCCAGGGG + Intronic
1007821059 6:44561067-44561089 CCAGGGCCAGCAAGGCCACGGGG + Intergenic
1010133421 6:72522700-72522722 CCTGAGCCACCAAGTCCCCTAGG + Intergenic
1011685389 6:89819657-89819679 CCAGCGTCCCCAAGCCGCCGAGG + Exonic
1013091329 6:106903300-106903322 CCAGCGACACCCAGCCTCTGAGG + Intergenic
1014500336 6:122180890-122180912 CCATCACCAGCAAGCCCCTGTGG + Intergenic
1014724998 6:124962735-124962757 CCAGCGCCCCAGAGCCCGCGAGG + Exonic
1018390457 6:163337260-163337282 ACAGCGCCACCCATCCCCGGAGG + Intergenic
1019999178 7:4745183-4745205 CCAGTGCCGCCCCGCCCCCGCGG + Intronic
1021231051 7:18086730-18086752 CCAGCCCCGCCCAGCCTCCGCGG + Intergenic
1024153707 7:46599171-46599193 CCAGTGTCCCCAAGCCCTCGTGG - Intergenic
1025942909 7:66086840-66086862 CCACCCCCACCAGGCCCTCGGGG - Intronic
1025992402 7:66505817-66505839 TCAGCGCCATCAAGACCCTGTGG - Intergenic
1027138254 7:75639346-75639368 CCGGCGCGCCCGAGCCCCCGGGG + Intronic
1029543075 7:101196056-101196078 CCAGCGCCTCCACCCCACCGAGG - Exonic
1032076338 7:128837889-128837911 CCAGCCCCACTCAGCCCCCATGG - Intronic
1033216665 7:139498403-139498425 TCAGAGACACCAGGCCCCCGAGG + Intergenic
1036770039 8:11572462-11572484 CCTGGGCCACCAGGCCCCTGTGG + Intergenic
1036784895 8:11679630-11679652 CCAGGGCAGCCAAGCACCCGCGG + Intronic
1036910725 8:12755240-12755262 CCAGCGCCAGCAGCTCCCCGCGG + Exonic
1037728480 8:21504009-21504031 CCAGCCCCACAATGCCCCAGTGG + Intergenic
1037814092 8:22102811-22102833 CCAGCACCACCACGCCCTGGAGG - Exonic
1039989929 8:42478830-42478852 CCACCTCCACCAAGTCCCCTAGG + Intronic
1046643201 8:116755559-116755581 CCAGCCACACCAAGCCCAAGGGG + Intronic
1046848966 8:118951837-118951859 CCGCCGCCTCCAAGCCCCTGAGG - Exonic
1047254929 8:123207490-123207512 CCAGCCCCACCAAGGCCCTTGGG + Exonic
1049746632 8:144265838-144265860 CCAGGGCCACCAGGCCCCTCAGG - Intronic
1049756457 8:144313259-144313281 CCACTGCCACCAAGGCCCCCAGG + Intronic
1049896919 9:117498-117520 CCAGCGCCACCAACCGACCCCGG - Exonic
1056577808 9:87869308-87869330 CCAGCGCCTGCATGCCCCCCAGG + Intergenic
1056788936 9:89612983-89613005 CCAGCACGTCCAAGGCCCCGGGG - Intergenic
1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG + Intronic
1061711117 9:132488713-132488735 CCAGCGCCCGGAAGCCCCCTGGG - Intronic
1061986072 9:134131124-134131146 CCAGCACCACCGAGAACCCGAGG + Intergenic
1062501582 9:136854197-136854219 CCTGCCCCACCCAGCCCCCCAGG + Exonic
1062633465 9:137477955-137477977 CCAGCACCTCCTAGCACCCGAGG + Intronic
1186333380 X:8560287-8560309 CCACCCCAACCAAGCCCCCCAGG - Intronic
1187415664 X:19091199-19091221 CCTTGGCCACCAAGCCCCCTTGG - Intronic
1190245649 X:48688779-48688801 CCACCCCCACCAACACCCCGGGG + Exonic
1190732046 X:53232989-53233011 CCCCCGCCCCCAAGCCCCAGTGG + Exonic
1192167402 X:68834557-68834579 CCAGCTCCACCCAGCCCCCGAGG - Intronic
1198024877 X:132695039-132695061 CCAGCGCCACCTCGTCCCTGGGG - Intronic