ID: 1069769485

View in Genome Browser
Species Human (GRCh38)
Location 10:70888364-70888386
Sequence CTCTGTCGCTGGCGGCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069769485_1069769495 9 Left 1069769485 10:70888364-70888386 CCTCCCCGCCGCCAGCGACAGAG 0: 1
1: 0
2: 1
3: 15
4: 160
Right 1069769495 10:70888396-70888418 GAGACCCCACTTTCGGACCCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1069769485_1069769501 22 Left 1069769485 10:70888364-70888386 CCTCCCCGCCGCCAGCGACAGAG 0: 1
1: 0
2: 1
3: 15
4: 160
Right 1069769501 10:70888409-70888431 CGGACCCCGGCGGCTCCGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 87
1069769485_1069769496 12 Left 1069769485 10:70888364-70888386 CCTCCCCGCCGCCAGCGACAGAG 0: 1
1: 0
2: 1
3: 15
4: 160
Right 1069769496 10:70888399-70888421 ACCCCACTTTCGGACCCCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1069769485_1069769494 2 Left 1069769485 10:70888364-70888386 CCTCCCCGCCGCCAGCGACAGAG 0: 1
1: 0
2: 1
3: 15
4: 160
Right 1069769494 10:70888389-70888411 CCGGGCAGAGACCCCACTTTCGG 0: 1
1: 0
2: 0
3: 10
4: 193
1069769485_1069769502 23 Left 1069769485 10:70888364-70888386 CCTCCCCGCCGCCAGCGACAGAG 0: 1
1: 0
2: 1
3: 15
4: 160
Right 1069769502 10:70888410-70888432 GGACCCCGGCGGCTCCGCAGGGG 0: 1
1: 0
2: 1
3: 17
4: 165
1069769485_1069769500 21 Left 1069769485 10:70888364-70888386 CCTCCCCGCCGCCAGCGACAGAG 0: 1
1: 0
2: 1
3: 15
4: 160
Right 1069769500 10:70888408-70888430 TCGGACCCCGGCGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069769485 Original CRISPR CTCTGTCGCTGGCGGCGGGG AGG (reversed) Intronic
900180144 1:1307693-1307715 CTTTGTGCCCGGCGGCGGGGTGG - Intronic
900494934 1:2972031-2972053 CTCCTTCTCTGGCGGGGGGGGGG + Intergenic
901104279 1:6743308-6743330 CTCTGTGCCTGGCGGGGGGTTGG + Intergenic
901577167 1:10210460-10210482 GTCCGTCGCGGGCGCCGGGGCGG + Intergenic
904353906 1:29926367-29926389 CTCTGAAGCTGGCGTGGGGGAGG - Intergenic
904682741 1:32240490-32240512 CTCTGCCGCTGGGAGCCGGGTGG + Intergenic
906345307 1:45010972-45010994 TGCTGTCGCGGGCGGCGCGGAGG + Exonic
910498998 1:87867169-87867191 GTCTGTTGCTGGCGGGGGGGCGG - Intergenic
912429402 1:109621072-109621094 CACTCCCGCTGGGGGCGGGGCGG + Exonic
912670532 1:111620123-111620145 CTCTGGCCCTGGCGGCGGCCGGG - Intronic
915523920 1:156464721-156464743 CTCTGTCCCTGGGGATGGGGTGG - Exonic
917837771 1:178954368-178954390 TGCTGTCGGTGGCGGCGGGGTGG - Intergenic
917954767 1:180083820-180083842 GTATGTGGCGGGCGGCGGGGAGG + Intronic
924439469 1:244074267-244074289 CTGGGTGGCTGGCGGCAGGGTGG + Intergenic
1065970094 10:30799293-30799315 CTCTATCCCAGGTGGCGGGGGGG - Intergenic
1065997013 10:31068911-31068933 CTCTGTCCCTGCCTGAGGGGAGG - Intergenic
1067745325 10:48931437-48931459 CTCTGTGGCTGGCTGAGGGTGGG - Intronic
1068103842 10:52590333-52590355 CTCTGGGGCTGGGGGTGGGGTGG + Intergenic
1069769485 10:70888364-70888386 CTCTGTCGCTGGCGGCGGGGAGG - Intronic
1076702792 10:132282936-132282958 CTCTGAGGCTGGGGTCGGGGAGG + Intronic
1076896989 10:133317810-133317832 CTCTGTGTCTGGGGGGGGGGGGG - Intronic
1077326141 11:1964925-1964947 CGCTGTCCCTGCCGACGGGGAGG - Intronic
1078085149 11:8229469-8229491 CTCTGTCGCAGGCTGCTGGATGG - Intronic
1079714638 11:23730539-23730561 CACTCGCGCTGGAGGCGGGGAGG - Intergenic
1080015896 11:27506643-27506665 CTGTGTCGCTGGAGGGGAGGAGG - Intronic
1081675791 11:44968223-44968245 CTCTGTCCCTACCGGCAGGGGGG + Intergenic
1083246225 11:61429990-61430012 GTGTGACGCCGGCGGCGGGGGGG - Intronic
1083432569 11:62621950-62621972 CTCGGGCGCGGGCGGCGGCGCGG - Exonic
1083648267 11:64185651-64185673 CTGTGTCGCCGGCGGCTGCGGGG - Exonic
1083670870 11:64299422-64299444 CTCCTTCTCCGGCGGCGGGGCGG - Exonic
1085119274 11:73956985-73957007 CTCTGGGGATGGCGGCGAGGCGG + Intronic
1087672752 11:101127549-101127571 CTCTGCCGCCGCCGCCGGGGCGG - Exonic
1089496451 11:118910620-118910642 CTCTGCCGAAGGGGGCGGGGTGG - Exonic
1090256378 11:125287491-125287513 CTCTGTCCCATGTGGCGGGGAGG + Intronic
1090656519 11:128850072-128850094 CTCTATGGTTGGAGGCGGGGGGG - Intronic
1091358358 11:134955508-134955530 CAGTGTCGCAGCCGGCGGGGCGG - Intergenic
1202809121 11_KI270721v1_random:20104-20126 CGCTGTCCCTGCCGACGGGGAGG - Intergenic
1095946891 12:47758787-47758809 CCCTGTCGCCGGTGGCTGGGTGG - Intronic
1099285497 12:80710111-80710133 ATCTGTCTCTGGAGGTGGGGTGG + Intergenic
1100816386 12:98391051-98391073 CTCTGTGGATGGGGACGGGGAGG - Intergenic
1101428362 12:104606160-104606182 CTCTGGGGCGGGGGGCGGGGGGG + Intronic
1101592772 12:106138799-106138821 CTCGGTCACTGGCGGCGGCGGGG + Exonic
1103509866 12:121467020-121467042 TGCTGCCGCTGCCGGCGGGGCGG - Intronic
1113927895 13:113951470-113951492 TGCTGTTGGTGGCGGCGGGGGGG - Intergenic
1114663487 14:24365985-24366007 CTCTGAGGCGGGGGGCGGGGGGG - Intronic
1115664480 14:35533449-35533471 CTCGGAGGCTGGCGGCGGGCAGG + Intergenic
1116452831 14:45083971-45083993 CGCCCTCGCTCGCGGCGGGGCGG + Intergenic
1122575115 14:102737219-102737241 CGCTGTAGCTGGCTGTGGGGAGG - Intergenic
1122799074 14:104220912-104220934 CTCTGTGGCGGGCGGCATGGCGG + Intergenic
1124641242 15:31397859-31397881 CTTTGGGGGTGGCGGCGGGGGGG + Intronic
1125180649 15:36878510-36878532 CTCAGCCGGTGGGGGCGGGGGGG + Intergenic
1127988744 15:64095851-64095873 CTTAGGCGCTGGGGGCGGGGCGG - Intronic
1128636808 15:69307787-69307809 CCCTGTGGCTGTCGGTGGGGTGG + Intronic
1129020582 15:72513879-72513901 CTCTGTCTTTGGCGGAGGCGGGG - Intronic
1130649088 15:85751923-85751945 CTCTGAAGCTGGGGGTGGGGTGG - Intergenic
1132349858 15:101132969-101132991 CTCTGTAGCTGTCTGCGGAGTGG + Intergenic
1132658459 16:1051200-1051222 CTCTGTCCCTGGGGTCGGGAGGG + Intergenic
1132731793 16:1366494-1366516 CTCTGTAGCTGGTGGCCGGGCGG - Intronic
1133916486 16:10113409-10113431 CCCTGTCCCTGGCCCCGGGGAGG + Intronic
1134322745 16:13178601-13178623 CTGTGTTGCTGGGGACGGGGAGG - Intronic
1134509283 16:14833723-14833745 CTCTGGCGGCGGCGGTGGGGCGG + Exonic
1134974854 16:18562147-18562169 CTCTGGCGGCGGCGGTGGGGCGG - Intronic
1136055569 16:27686243-27686265 CTCTGTATCTGGGGTCGGGGAGG + Intronic
1139570141 16:67806554-67806576 TTGTGTCACTGGGGGCGGGGAGG + Exonic
1139691874 16:68646357-68646379 CCCAGACGCTGGGGGCGGGGTGG - Intronic
1139958038 16:70702510-70702532 CTCTGGGGCTGGCAGCGGAGGGG + Intronic
1140063664 16:71592037-71592059 CCCTGTCTCTAGCGGGGGGGGGG - Intergenic
1142374900 16:89701727-89701749 CCGTGACGCTGGGGGCGGGGCGG + Intergenic
1142976404 17:3647258-3647280 CTCTGTCTCTGGCAGCAGGTGGG + Intronic
1143178079 17:4967961-4967983 CTCTGTCTGCGGGGGCGGGGCGG - Intergenic
1143346157 17:6250698-6250720 CTCTGTCCATGGCGTCCGGGTGG - Intergenic
1143986774 17:10921422-10921444 CTCTGTCGTTGGAGGTGAGGAGG - Intergenic
1146416238 17:32635684-32635706 CTCCGTCTCGGGTGGCGGGGGGG + Intronic
1147404326 17:40200158-40200180 TTCTGTCGCTGTCGCCGGGCTGG - Intergenic
1148180664 17:45602319-45602341 CTCTGCGGGTGGCGGCGGCGCGG - Intergenic
1148441136 17:47712072-47712094 CTCTGTGGCTGGGGGCAGGGCGG + Intergenic
1150380004 17:64712950-64712972 CTCTGTTGCTGGCGGGGGCCAGG - Intergenic
1150776724 17:68087205-68087227 CTCTGTTGCTGGCGGGGGCCAGG + Intergenic
1151557011 17:74851750-74851772 TGCTGTCGGTGGCGGCGGTGAGG - Intronic
1152164449 17:78693259-78693281 CTCTGGCGGTGGTGGCTGGGAGG + Intronic
1152855111 17:82661157-82661179 GTCTCACGCTGGCGGCGTGGTGG - Intronic
1153525942 18:5994665-5994687 CTCTGTCGCTGGAGGCAGTCTGG - Intronic
1153896729 18:9569358-9569380 CTCTGTCTCGGGCGTGGGGGAGG - Intronic
1154496587 18:14965710-14965732 CAGTGTCGCAGCCGGCGGGGCGG + Intergenic
1158649416 18:59272937-59272959 CGCCGGGGCTGGCGGCGGGGAGG + Exonic
1160454847 18:78992959-78992981 CTGCGGCGCTGGCGCCGGGGCGG - Exonic
1161477393 19:4494151-4494173 CGCTGTCACTGGAGGCGGAGGGG - Exonic
1162090053 19:8273681-8273703 CTCTGTCTCGGGCGGGGTGGCGG - Intronic
1162092287 19:8288544-8288566 CTCTGTCTCGGGCGGGGTGGCGG - Intronic
1162451413 19:10757368-10757390 CCCAGTGGCTGGCGTCGGGGGGG - Intronic
1162562064 19:11422664-11422686 CTCTGGGGAGGGCGGCGGGGCGG - Intronic
1164051321 19:21587299-21587321 CTCTGCCGCTGGCGTAGGGGCGG - Intergenic
1164834774 19:31349935-31349957 CCCTTTCGCTGGCGGGGCGGGGG - Intergenic
1164959781 19:32417836-32417858 CTCTGTCCCTGGTTACGGGGAGG - Intronic
1165750565 19:38256667-38256689 CTCTGGCGGTGGCGGGGTGGGGG + Intronic
1165862427 19:38916191-38916213 CTGTGCCGCTGGGGACGGGGTGG - Intronic
1166997808 19:46728119-46728141 CTCTGGCCCTGGGGGAGGGGGGG + Intronic
1167056141 19:47112543-47112565 CTCTGATGGCGGCGGCGGGGGGG + Exonic
1168332606 19:55578992-55579014 AGCTGGCGCTGGCGGCCGGGCGG - Exonic
926162964 2:10501316-10501338 CTCTCTCGCTGGAGTCTGGGTGG + Intergenic
928186608 2:29115832-29115854 CGGTGTCGCTGGCCGCGGGGAGG + Intronic
930730748 2:54725175-54725197 CTTTGTGGCTGGGGTCGGGGTGG + Exonic
938262903 2:129907773-129907795 CTCTGTCCGGGGAGGCGGGGTGG - Intergenic
938370967 2:130768210-130768232 TTCTGTCTCTGCCAGCGGGGAGG - Intergenic
945057817 2:205883731-205883753 CTCTGTCTCGGGGGGTGGGGGGG - Intergenic
1172404452 20:34677181-34677203 CGCTGCCGCTGGCGCCGGAGAGG + Intergenic
1172906137 20:38370871-38370893 CTCTGTAGCTGGTGGGAGGGGGG + Intronic
1174453977 20:50636818-50636840 CCCTCTGGCTGGCGGTGGGGAGG - Intronic
1175346022 20:58276721-58276743 CTTTGTTGGTGGGGGCGGGGGGG + Intergenic
1175358646 20:58389625-58389647 CGCTGTCGCGGGGGGCGGCGAGG + Intronic
1175517338 20:59577742-59577764 CTCTGTGGCTGGGGGCGCAGCGG - Intronic
1180042768 21:45288402-45288424 CTCTGGAGCTGGGGTCGGGGCGG + Intergenic
1181631897 22:24155980-24156002 CTCTCTCGCTCGCGGCGGGCCGG - Intronic
1182295523 22:29309564-29309586 CACTGCCGCTGTGGGCGGGGAGG + Intronic
1184322480 22:43753113-43753135 CTCTGCTGCTGGGGGCGGTGGGG - Intronic
1184365933 22:44051390-44051412 CTCTGTGGCTGGCGCCTGGCTGG + Intronic
1184459049 22:44626899-44626921 CTCTGTTGCAGGCTGCAGGGAGG + Intergenic
950657158 3:14443790-14443812 CTCTGTGGCTGGCGGCTTCGTGG + Exonic
950785092 3:15427698-15427720 TTCTGGCGCTGGCGTCTGGGAGG - Exonic
950966680 3:17151626-17151648 CTCTGTCCCTGGTGGCAGTGTGG - Intergenic
952242338 3:31544928-31544950 CTCTGTCTCAGGGAGCGGGGGGG + Intronic
954054758 3:48012655-48012677 GTGTGTGGCTGGGGGCGGGGTGG - Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968577476 4:1374601-1374623 TTGTCTTGCTGGCGGCGGGGCGG + Intronic
968697753 4:2041214-2041236 CTGTGTCGGTGTCGGCGTGGGGG + Intronic
968886739 4:3338636-3338658 CTCTGTGGTTGGCGGGCGGGCGG + Intronic
976287750 4:83386426-83386448 CTCTGGCGGTGGGGGTGGGGTGG - Intergenic
982452601 4:155570788-155570810 CACTGTGGCTGGAGGTGGGGAGG + Intergenic
987518968 5:18953645-18953667 CTCTATCTCGGGGGGCGGGGGGG + Intergenic
989983238 5:50667250-50667272 GTCTGTGGCTGGGGGTGGGGTGG + Intronic
992550128 5:77851926-77851948 CCCGGTCGCTCGCGGCGCGGAGG + Intronic
998615270 5:143733673-143733695 CTCTGTCAGTGGGGGAGGGGGGG - Intergenic
1001934665 5:175695650-175695672 CGATGTCGCTGGCAGCAGGGAGG - Intergenic
1006090695 6:31627092-31627114 CTCTGTCTCTGGAGGCCGAGAGG - Exonic
1006185570 6:32179887-32179909 CTCTGGCCCTGGGGGCGGGGTGG - Exonic
1007012946 6:38435185-38435207 CTCTGTCTCGGGGGGTGGGGGGG + Intronic
1013170790 6:107634941-107634963 CTGGGTCGCCGGCGGCGGGCGGG - Exonic
1013177694 6:107691305-107691327 TGCTGTCGGTGGAGGCGGGGAGG - Intergenic
1013219351 6:108063675-108063697 GTGTGTGGCAGGCGGCGGGGTGG - Intronic
1014205512 6:118651596-118651618 CTCTGGCTCTGCCGGCGGAGGGG - Intronic
1016596985 6:145814480-145814502 CGCTGGCGCTGGCGGCCGTGGGG - Intronic
1019102449 6:169642303-169642325 CTCTGTTTCTGTGGGCGGGGGGG - Intronic
1020140197 7:5607611-5607633 CTCTGCTGCCGACGGCGGGGAGG - Intergenic
1020784452 7:12556414-12556436 CACTGCCGGGGGCGGCGGGGCGG + Intergenic
1022943746 7:35262101-35262123 CGGTGTCGCTGGCGGCGGCGGGG + Intergenic
1026869691 7:73842647-73842669 CTCATTGGCTGGCGGGGGGGGGG - Intergenic
1031833925 7:126659039-126659061 CTCTGAACCTGGGGGCGGGGCGG - Intronic
1034589770 7:152129213-152129235 TTCTGCCGGTGACGGCGGGGAGG - Intergenic
1034950989 7:155297368-155297390 CGCGGGCTCTGGCGGCGGGGAGG - Intergenic
1035082992 7:156233165-156233187 GTCTGTCGCGGGCGGCGGGCGGG + Intergenic
1035220289 7:157402428-157402450 CTCTCTTGCTGGCCGTGGGGCGG + Intronic
1035391323 7:158506805-158506827 CTATGGCGATGGCGGAGGGGCGG - Intronic
1038444959 8:27596816-27596838 CTCTGTCTCGGGGGGCGGGGGGG + Intergenic
1038786150 8:30618276-30618298 CTCTGTCTCGGGGGGCGGGGGGG + Intronic
1039572808 8:38600899-38600921 CTCTGGCCCTGGGGGCGGGGTGG + Intergenic
1043899083 8:85762784-85762806 TTCTTTCGCTTGCGGCGAGGTGG + Intergenic
1044692898 8:94896266-94896288 CGCTGGCGGCGGCGGCGGGGCGG - Intronic
1045316552 8:101048493-101048515 CTCTGTGGCTGGCGGTTGGTGGG + Intergenic
1048460184 8:134615110-134615132 CACTGTCCCTGGCTGAGGGGAGG - Intronic
1049492994 8:142914897-142914919 CTAAGTTGCTGGCTGCGGGGAGG + Exonic
1050350899 9:4740806-4740828 CTCTGTCCCGGGCGGCGGGAGGG + Intronic
1050744256 9:8858138-8858160 CTCCGCCGCTCGCGGCTGGGGGG + Intronic
1053346638 9:37383178-37383200 CTCTGACGCTGTGGGCCGGGTGG + Intergenic
1056992225 9:91423217-91423239 CTCTGGGGCTGGCGGCGTAGGGG - Intronic
1057365599 9:94417861-94417883 CTCTGTCGGGGGGGGGGGGGGGG - Intronic
1060503579 9:124181174-124181196 CTCTGTGGGTGGCGTGGGGGCGG - Intergenic
1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG + Intronic
1061540829 9:131277266-131277288 ACCTGGCGCTGGCGGCGCGGCGG - Intergenic
1062379579 9:136280792-136280814 CTCCTTGGCTGGCAGCGGGGAGG - Intergenic
1185656337 X:1688689-1688711 CTCTGTCTCGGGGGGAGGGGAGG + Intergenic
1187507306 X:19887859-19887881 CTCTGGCGCGGGCGGTGAGGAGG - Intergenic
1188060078 X:25590417-25590439 CTCTGTCGCTGGAGTGGGTGGGG + Intergenic
1198177125 X:134167664-134167686 CTCTGGTGGTGGCGGCTGGGGGG - Intergenic
1200012920 X:153133670-153133692 CTGTGTCGGGGGCGGGGGGGAGG - Intergenic
1200026681 X:153266253-153266275 CTGTGTCGGGGGCGGGGGGGAGG + Intergenic
1200146741 X:153930296-153930318 CCCTGTCGCTGGCTGAGGAGAGG + Intronic
1200786365 Y:7263918-7263940 GCCTGTCGGTGGGGGCGGGGAGG - Intergenic