ID: 1069771138

View in Genome Browser
Species Human (GRCh38)
Location 10:70901300-70901322
Sequence ATATACAATCTACACTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069771122_1069771138 24 Left 1069771122 10:70901253-70901275 CCTCAGACTAGAATGTGGTAGAA No data
Right 1069771138 10:70901300-70901322 ATATACAATCTACACTTGGGGGG No data
1069771125_1069771138 1 Left 1069771125 10:70901276-70901298 CCCCCGTGCCCCGCCATGGGCTG No data
Right 1069771138 10:70901300-70901322 ATATACAATCTACACTTGGGGGG No data
1069771126_1069771138 0 Left 1069771126 10:70901277-70901299 CCCCGTGCCCCGCCATGGGCTGG No data
Right 1069771138 10:70901300-70901322 ATATACAATCTACACTTGGGGGG No data
1069771130_1069771138 -7 Left 1069771130 10:70901284-70901306 CCCCGCCATGGGCTGGATATACA No data
Right 1069771138 10:70901300-70901322 ATATACAATCTACACTTGGGGGG No data
1069771129_1069771138 -2 Left 1069771129 10:70901279-70901301 CCGTGCCCCGCCATGGGCTGGAT No data
Right 1069771138 10:70901300-70901322 ATATACAATCTACACTTGGGGGG No data
1069771128_1069771138 -1 Left 1069771128 10:70901278-70901300 CCCGTGCCCCGCCATGGGCTGGA No data
Right 1069771138 10:70901300-70901322 ATATACAATCTACACTTGGGGGG No data
1069771131_1069771138 -8 Left 1069771131 10:70901285-70901307 CCCGCCATGGGCTGGATATACAA No data
Right 1069771138 10:70901300-70901322 ATATACAATCTACACTTGGGGGG No data
1069771132_1069771138 -9 Left 1069771132 10:70901286-70901308 CCGCCATGGGCTGGATATACAAT No data
Right 1069771138 10:70901300-70901322 ATATACAATCTACACTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069771138 Original CRISPR ATATACAATCTACACTTGGG GGG Intergenic
No off target data available for this crispr