ID: 1069771157

View in Genome Browser
Species Human (GRCh38)
Location 10:70901371-70901393
Sequence GTTTGCCCGATCCCAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069771140_1069771157 21 Left 1069771140 10:70901327-70901349 CCCGCCTCCTACCCCACCTCCCT No data
Right 1069771157 10:70901371-70901393 GTTTGCCCGATCCCAAAGGAGGG No data
1069771149_1069771157 2 Left 1069771149 10:70901346-70901368 CCCTAAGTGGTTCATGAACCCTA No data
Right 1069771157 10:70901371-70901393 GTTTGCCCGATCCCAAAGGAGGG No data
1069771142_1069771157 17 Left 1069771142 10:70901331-70901353 CCTCCTACCCCACCTCCCTAAGT No data
Right 1069771157 10:70901371-70901393 GTTTGCCCGATCCCAAAGGAGGG No data
1069771147_1069771157 8 Left 1069771147 10:70901340-70901362 CCACCTCCCTAAGTGGTTCATGA No data
Right 1069771157 10:70901371-70901393 GTTTGCCCGATCCCAAAGGAGGG No data
1069771150_1069771157 1 Left 1069771150 10:70901347-70901369 CCTAAGTGGTTCATGAACCCTAG No data
Right 1069771157 10:70901371-70901393 GTTTGCCCGATCCCAAAGGAGGG No data
1069771148_1069771157 5 Left 1069771148 10:70901343-70901365 CCTCCCTAAGTGGTTCATGAACC No data
Right 1069771157 10:70901371-70901393 GTTTGCCCGATCCCAAAGGAGGG No data
1069771144_1069771157 14 Left 1069771144 10:70901334-70901356 CCTACCCCACCTCCCTAAGTGGT No data
Right 1069771157 10:70901371-70901393 GTTTGCCCGATCCCAAAGGAGGG No data
1069771141_1069771157 20 Left 1069771141 10:70901328-70901350 CCGCCTCCTACCCCACCTCCCTA No data
Right 1069771157 10:70901371-70901393 GTTTGCCCGATCCCAAAGGAGGG No data
1069771139_1069771157 22 Left 1069771139 10:70901326-70901348 CCCCGCCTCCTACCCCACCTCCC No data
Right 1069771157 10:70901371-70901393 GTTTGCCCGATCCCAAAGGAGGG No data
1069771146_1069771157 9 Left 1069771146 10:70901339-70901361 CCCACCTCCCTAAGTGGTTCATG No data
Right 1069771157 10:70901371-70901393 GTTTGCCCGATCCCAAAGGAGGG No data
1069771145_1069771157 10 Left 1069771145 10:70901338-70901360 CCCCACCTCCCTAAGTGGTTCAT No data
Right 1069771157 10:70901371-70901393 GTTTGCCCGATCCCAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069771157 Original CRISPR GTTTGCCCGATCCCAAAGGA GGG Intergenic
No off target data available for this crispr