ID: 1069771198

View in Genome Browser
Species Human (GRCh38)
Location 10:70901549-70901571
Sequence CCTTCTATGCAGGTGCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069771187_1069771198 19 Left 1069771187 10:70901507-70901529 CCCAGGCTCCTGCCCAGGGGTGG No data
Right 1069771198 10:70901549-70901571 CCTTCTATGCAGGTGCCCCCAGG No data
1069771193_1069771198 -9 Left 1069771193 10:70901535-70901557 CCCTGAGCTGCCAGCCTTCTATG No data
Right 1069771198 10:70901549-70901571 CCTTCTATGCAGGTGCCCCCAGG No data
1069771192_1069771198 6 Left 1069771192 10:70901520-70901542 CCAGGGGTGGCAGCTCCCTGAGC No data
Right 1069771198 10:70901549-70901571 CCTTCTATGCAGGTGCCCCCAGG No data
1069771194_1069771198 -10 Left 1069771194 10:70901536-70901558 CCTGAGCTGCCAGCCTTCTATGC No data
Right 1069771198 10:70901549-70901571 CCTTCTATGCAGGTGCCCCCAGG No data
1069771189_1069771198 18 Left 1069771189 10:70901508-70901530 CCAGGCTCCTGCCCAGGGGTGGC No data
Right 1069771198 10:70901549-70901571 CCTTCTATGCAGGTGCCCCCAGG No data
1069771190_1069771198 11 Left 1069771190 10:70901515-70901537 CCTGCCCAGGGGTGGCAGCTCCC No data
Right 1069771198 10:70901549-70901571 CCTTCTATGCAGGTGCCCCCAGG No data
1069771191_1069771198 7 Left 1069771191 10:70901519-70901541 CCCAGGGGTGGCAGCTCCCTGAG No data
Right 1069771198 10:70901549-70901571 CCTTCTATGCAGGTGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069771198 Original CRISPR CCTTCTATGCAGGTGCCCCC AGG Intergenic
No off target data available for this crispr