ID: 1069771539

View in Genome Browser
Species Human (GRCh38)
Location 10:70903606-70903628
Sequence TGCACCCAGGTCCCAGCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069771539_1069771549 24 Left 1069771539 10:70903606-70903628 CCCCGTGCTGGGACCTGGGTGCA No data
Right 1069771549 10:70903653-70903675 GCCTGTGTCCGCAGTGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069771539 Original CRISPR TGCACCCAGGTCCCAGCACG GGG (reversed) Intergenic
No off target data available for this crispr