ID: 1069771541

View in Genome Browser
Species Human (GRCh38)
Location 10:70903608-70903630
Sequence AGTGCACCCAGGTCCCAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069771541_1069771553 30 Left 1069771541 10:70903608-70903630 CCGTGCTGGGACCTGGGTGCACT No data
Right 1069771553 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
1069771541_1069771551 29 Left 1069771541 10:70903608-70903630 CCGTGCTGGGACCTGGGTGCACT No data
Right 1069771551 10:70903660-70903682 TCCGCAGTGTCCCAGGCCGAAGG No data
1069771541_1069771549 22 Left 1069771541 10:70903608-70903630 CCGTGCTGGGACCTGGGTGCACT No data
Right 1069771549 10:70903653-70903675 GCCTGTGTCCGCAGTGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069771541 Original CRISPR AGTGCACCCAGGTCCCAGCA CGG (reversed) Intergenic
No off target data available for this crispr