ID: 1069771542

View in Genome Browser
Species Human (GRCh38)
Location 10:70903619-70903641
Sequence GGGCTCGTCTTAGTGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069771542_1069771555 27 Left 1069771542 10:70903619-70903641 CCTGGGTGCACTAAGACGAGCCC No data
Right 1069771555 10:70903669-70903691 TCCCAGGCCGAAGGGATTGTGGG No data
1069771542_1069771553 19 Left 1069771542 10:70903619-70903641 CCTGGGTGCACTAAGACGAGCCC No data
Right 1069771553 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
1069771542_1069771554 26 Left 1069771542 10:70903619-70903641 CCTGGGTGCACTAAGACGAGCCC No data
Right 1069771554 10:70903668-70903690 GTCCCAGGCCGAAGGGATTGTGG No data
1069771542_1069771551 18 Left 1069771542 10:70903619-70903641 CCTGGGTGCACTAAGACGAGCCC No data
Right 1069771551 10:70903660-70903682 TCCGCAGTGTCCCAGGCCGAAGG No data
1069771542_1069771557 28 Left 1069771542 10:70903619-70903641 CCTGGGTGCACTAAGACGAGCCC No data
Right 1069771557 10:70903670-70903692 CCCAGGCCGAAGGGATTGTGGGG No data
1069771542_1069771549 11 Left 1069771542 10:70903619-70903641 CCTGGGTGCACTAAGACGAGCCC No data
Right 1069771549 10:70903653-70903675 GCCTGTGTCCGCAGTGTCCCAGG No data
1069771542_1069771559 29 Left 1069771542 10:70903619-70903641 CCTGGGTGCACTAAGACGAGCCC No data
Right 1069771559 10:70903671-70903693 CCAGGCCGAAGGGATTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069771542 Original CRISPR GGGCTCGTCTTAGTGCACCC AGG (reversed) Intergenic
No off target data available for this crispr