ID: 1069771547

View in Genome Browser
Species Human (GRCh38)
Location 10:70903645-70903667
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069771547_1069771551 -8 Left 1069771547 10:70903645-70903667 CCCTTGCAGCCTGTGTCCGCAGT No data
Right 1069771551 10:70903660-70903682 TCCGCAGTGTCCCAGGCCGAAGG No data
1069771547_1069771553 -7 Left 1069771547 10:70903645-70903667 CCCTTGCAGCCTGTGTCCGCAGT No data
Right 1069771553 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
1069771547_1069771559 3 Left 1069771547 10:70903645-70903667 CCCTTGCAGCCTGTGTCCGCAGT No data
Right 1069771559 10:70903671-70903693 CCAGGCCGAAGGGATTGTGGGGG No data
1069771547_1069771563 20 Left 1069771547 10:70903645-70903667 CCCTTGCAGCCTGTGTCCGCAGT No data
Right 1069771563 10:70903688-70903710 TGGGGGTTTCAAGGAGGCAGTGG No data
1069771547_1069771564 21 Left 1069771547 10:70903645-70903667 CCCTTGCAGCCTGTGTCCGCAGT No data
Right 1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG No data
1069771547_1069771557 2 Left 1069771547 10:70903645-70903667 CCCTTGCAGCCTGTGTCCGCAGT No data
Right 1069771557 10:70903670-70903692 CCCAGGCCGAAGGGATTGTGGGG No data
1069771547_1069771561 11 Left 1069771547 10:70903645-70903667 CCCTTGCAGCCTGTGTCCGCAGT No data
Right 1069771561 10:70903679-70903701 AAGGGATTGTGGGGGTTTCAAGG No data
1069771547_1069771562 14 Left 1069771547 10:70903645-70903667 CCCTTGCAGCCTGTGTCCGCAGT No data
Right 1069771562 10:70903682-70903704 GGATTGTGGGGGTTTCAAGGAGG No data
1069771547_1069771555 1 Left 1069771547 10:70903645-70903667 CCCTTGCAGCCTGTGTCCGCAGT No data
Right 1069771555 10:70903669-70903691 TCCCAGGCCGAAGGGATTGTGGG No data
1069771547_1069771554 0 Left 1069771547 10:70903645-70903667 CCCTTGCAGCCTGTGTCCGCAGT No data
Right 1069771554 10:70903668-70903690 GTCCCAGGCCGAAGGGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069771547 Original CRISPR ACTGCGGACACAGGCTGCAA GGG (reversed) Intergenic