ID: 1069771549

View in Genome Browser
Species Human (GRCh38)
Location 10:70903653-70903675
Sequence GCCTGTGTCCGCAGTGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069771543_1069771549 -9 Left 1069771543 10:70903639-70903661 CCCCACCCCTTGCAGCCTGTGTC No data
Right 1069771549 10:70903653-70903675 GCCTGTGTCCGCAGTGTCCCAGG No data
1069771542_1069771549 11 Left 1069771542 10:70903619-70903641 CCTGGGTGCACTAAGACGAGCCC No data
Right 1069771549 10:70903653-70903675 GCCTGTGTCCGCAGTGTCCCAGG No data
1069771541_1069771549 22 Left 1069771541 10:70903608-70903630 CCGTGCTGGGACCTGGGTGCACT No data
Right 1069771549 10:70903653-70903675 GCCTGTGTCCGCAGTGTCCCAGG No data
1069771540_1069771549 23 Left 1069771540 10:70903607-70903629 CCCGTGCTGGGACCTGGGTGCAC No data
Right 1069771549 10:70903653-70903675 GCCTGTGTCCGCAGTGTCCCAGG No data
1069771544_1069771549 -10 Left 1069771544 10:70903640-70903662 CCCACCCCTTGCAGCCTGTGTCC No data
Right 1069771549 10:70903653-70903675 GCCTGTGTCCGCAGTGTCCCAGG No data
1069771539_1069771549 24 Left 1069771539 10:70903606-70903628 CCCCGTGCTGGGACCTGGGTGCA No data
Right 1069771549 10:70903653-70903675 GCCTGTGTCCGCAGTGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069771549 Original CRISPR GCCTGTGTCCGCAGTGTCCC AGG Intergenic
No off target data available for this crispr