ID: 1069771550

View in Genome Browser
Species Human (GRCh38)
Location 10:70903654-70903676
Sequence GCCTGGGACACTGCGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069771550_1069771561 2 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771561 10:70903679-70903701 AAGGGATTGTGGGGGTTTCAAGG No data
1069771550_1069771559 -6 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771559 10:70903671-70903693 CCAGGCCGAAGGGATTGTGGGGG No data
1069771550_1069771564 12 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG No data
1069771550_1069771568 29 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771568 10:70903706-70903728 AGTGGGCAGCTCTGCCTAGGGGG No data
1069771550_1069771563 11 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771563 10:70903688-70903710 TGGGGGTTTCAAGGAGGCAGTGG No data
1069771550_1069771557 -7 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771557 10:70903670-70903692 CCCAGGCCGAAGGGATTGTGGGG No data
1069771550_1069771566 27 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771566 10:70903704-70903726 GCAGTGGGCAGCTCTGCCTAGGG No data
1069771550_1069771555 -8 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771555 10:70903669-70903691 TCCCAGGCCGAAGGGATTGTGGG No data
1069771550_1069771565 26 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771565 10:70903703-70903725 GGCAGTGGGCAGCTCTGCCTAGG No data
1069771550_1069771554 -9 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771554 10:70903668-70903690 GTCCCAGGCCGAAGGGATTGTGG No data
1069771550_1069771567 28 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771567 10:70903705-70903727 CAGTGGGCAGCTCTGCCTAGGGG No data
1069771550_1069771562 5 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771562 10:70903682-70903704 GGATTGTGGGGGTTTCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069771550 Original CRISPR GCCTGGGACACTGCGGACAC AGG (reversed) Intergenic