ID: 1069771552

View in Genome Browser
Species Human (GRCh38)
Location 10:70903661-70903683
Sequence CCCTTCGGCCTGGGACACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069771552_1069771565 19 Left 1069771552 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
Right 1069771565 10:70903703-70903725 GGCAGTGGGCAGCTCTGCCTAGG No data
1069771552_1069771568 22 Left 1069771552 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
Right 1069771568 10:70903706-70903728 AGTGGGCAGCTCTGCCTAGGGGG No data
1069771552_1069771564 5 Left 1069771552 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
Right 1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG No data
1069771552_1069771566 20 Left 1069771552 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
Right 1069771566 10:70903704-70903726 GCAGTGGGCAGCTCTGCCTAGGG No data
1069771552_1069771563 4 Left 1069771552 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
Right 1069771563 10:70903688-70903710 TGGGGGTTTCAAGGAGGCAGTGG No data
1069771552_1069771561 -5 Left 1069771552 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
Right 1069771561 10:70903679-70903701 AAGGGATTGTGGGGGTTTCAAGG No data
1069771552_1069771569 25 Left 1069771552 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
Right 1069771569 10:70903709-70903731 GGGCAGCTCTGCCTAGGGGGAGG No data
1069771552_1069771567 21 Left 1069771552 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
Right 1069771567 10:70903705-70903727 CAGTGGGCAGCTCTGCCTAGGGG No data
1069771552_1069771570 29 Left 1069771552 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
Right 1069771570 10:70903713-70903735 AGCTCTGCCTAGGGGGAGGCCGG No data
1069771552_1069771562 -2 Left 1069771552 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
Right 1069771562 10:70903682-70903704 GGATTGTGGGGGTTTCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069771552 Original CRISPR CCCTTCGGCCTGGGACACTG CGG (reversed) Intergenic