ID: 1069771553

View in Genome Browser
Species Human (GRCh38)
Location 10:70903661-70903683
Sequence CCGCAGTGTCCCAGGCCGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069771547_1069771553 -7 Left 1069771547 10:70903645-70903667 CCCTTGCAGCCTGTGTCCGCAGT No data
Right 1069771553 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
1069771546_1069771553 -6 Left 1069771546 10:70903644-70903666 CCCCTTGCAGCCTGTGTCCGCAG No data
Right 1069771553 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
1069771545_1069771553 -3 Left 1069771545 10:70903641-70903663 CCACCCCTTGCAGCCTGTGTCCG No data
Right 1069771553 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
1069771543_1069771553 -1 Left 1069771543 10:70903639-70903661 CCCCACCCCTTGCAGCCTGTGTC No data
Right 1069771553 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
1069771541_1069771553 30 Left 1069771541 10:70903608-70903630 CCGTGCTGGGACCTGGGTGCACT No data
Right 1069771553 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
1069771542_1069771553 19 Left 1069771542 10:70903619-70903641 CCTGGGTGCACTAAGACGAGCCC No data
Right 1069771553 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
1069771544_1069771553 -2 Left 1069771544 10:70903640-70903662 CCCACCCCTTGCAGCCTGTGTCC No data
Right 1069771553 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
1069771548_1069771553 -8 Left 1069771548 10:70903646-70903668 CCTTGCAGCCTGTGTCCGCAGTG No data
Right 1069771553 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069771553 Original CRISPR CCGCAGTGTCCCAGGCCGAA GGG Intergenic