ID: 1069771554

View in Genome Browser
Species Human (GRCh38)
Location 10:70903668-70903690
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069771547_1069771554 0 Left 1069771547 10:70903645-70903667 CCCTTGCAGCCTGTGTCCGCAGT No data
Right 1069771554 10:70903668-70903690 GTCCCAGGCCGAAGGGATTGTGG No data
1069771548_1069771554 -1 Left 1069771548 10:70903646-70903668 CCTTGCAGCCTGTGTCCGCAGTG No data
Right 1069771554 10:70903668-70903690 GTCCCAGGCCGAAGGGATTGTGG No data
1069771544_1069771554 5 Left 1069771544 10:70903640-70903662 CCCACCCCTTGCAGCCTGTGTCC No data
Right 1069771554 10:70903668-70903690 GTCCCAGGCCGAAGGGATTGTGG No data
1069771542_1069771554 26 Left 1069771542 10:70903619-70903641 CCTGGGTGCACTAAGACGAGCCC No data
Right 1069771554 10:70903668-70903690 GTCCCAGGCCGAAGGGATTGTGG No data
1069771543_1069771554 6 Left 1069771543 10:70903639-70903661 CCCCACCCCTTGCAGCCTGTGTC No data
Right 1069771554 10:70903668-70903690 GTCCCAGGCCGAAGGGATTGTGG No data
1069771546_1069771554 1 Left 1069771546 10:70903644-70903666 CCCCTTGCAGCCTGTGTCCGCAG No data
Right 1069771554 10:70903668-70903690 GTCCCAGGCCGAAGGGATTGTGG No data
1069771550_1069771554 -9 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771554 10:70903668-70903690 GTCCCAGGCCGAAGGGATTGTGG No data
1069771545_1069771554 4 Left 1069771545 10:70903641-70903663 CCACCCCTTGCAGCCTGTGTCCG No data
Right 1069771554 10:70903668-70903690 GTCCCAGGCCGAAGGGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069771554 Original CRISPR GTCCCAGGCCGAAGGGATTG TGG Intergenic