ID: 1069771562

View in Genome Browser
Species Human (GRCh38)
Location 10:70903682-70903704
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069771545_1069771562 18 Left 1069771545 10:70903641-70903663 CCACCCCTTGCAGCCTGTGTCCG No data
Right 1069771562 10:70903682-70903704 GGATTGTGGGGGTTTCAAGGAGG No data
1069771550_1069771562 5 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771562 10:70903682-70903704 GGATTGTGGGGGTTTCAAGGAGG No data
1069771548_1069771562 13 Left 1069771548 10:70903646-70903668 CCTTGCAGCCTGTGTCCGCAGTG No data
Right 1069771562 10:70903682-70903704 GGATTGTGGGGGTTTCAAGGAGG No data
1069771543_1069771562 20 Left 1069771543 10:70903639-70903661 CCCCACCCCTTGCAGCCTGTGTC No data
Right 1069771562 10:70903682-70903704 GGATTGTGGGGGTTTCAAGGAGG No data
1069771546_1069771562 15 Left 1069771546 10:70903644-70903666 CCCCTTGCAGCCTGTGTCCGCAG No data
Right 1069771562 10:70903682-70903704 GGATTGTGGGGGTTTCAAGGAGG No data
1069771544_1069771562 19 Left 1069771544 10:70903640-70903662 CCCACCCCTTGCAGCCTGTGTCC No data
Right 1069771562 10:70903682-70903704 GGATTGTGGGGGTTTCAAGGAGG No data
1069771552_1069771562 -2 Left 1069771552 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
Right 1069771562 10:70903682-70903704 GGATTGTGGGGGTTTCAAGGAGG No data
1069771547_1069771562 14 Left 1069771547 10:70903645-70903667 CCCTTGCAGCCTGTGTCCGCAGT No data
Right 1069771562 10:70903682-70903704 GGATTGTGGGGGTTTCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069771562 Original CRISPR GGATTGTGGGGGTTTCAAGG AGG Intergenic