ID: 1069771564

View in Genome Browser
Species Human (GRCh38)
Location 10:70903689-70903711
Sequence GGGGGTTTCAAGGAGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069771545_1069771564 25 Left 1069771545 10:70903641-70903663 CCACCCCTTGCAGCCTGTGTCCG No data
Right 1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG No data
1069771544_1069771564 26 Left 1069771544 10:70903640-70903662 CCCACCCCTTGCAGCCTGTGTCC No data
Right 1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG No data
1069771558_1069771564 -5 Left 1069771558 10:70903671-70903693 CCAGGCCGAAGGGATTGTGGGGG No data
Right 1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG No data
1069771552_1069771564 5 Left 1069771552 10:70903661-70903683 CCGCAGTGTCCCAGGCCGAAGGG No data
Right 1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG No data
1069771556_1069771564 -4 Left 1069771556 10:70903670-70903692 CCCAGGCCGAAGGGATTGTGGGG No data
Right 1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG No data
1069771560_1069771564 -10 Left 1069771560 10:70903676-70903698 CCGAAGGGATTGTGGGGGTTTCA No data
Right 1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG No data
1069771546_1069771564 22 Left 1069771546 10:70903644-70903666 CCCCTTGCAGCCTGTGTCCGCAG No data
Right 1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG No data
1069771547_1069771564 21 Left 1069771547 10:70903645-70903667 CCCTTGCAGCCTGTGTCCGCAGT No data
Right 1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG No data
1069771550_1069771564 12 Left 1069771550 10:70903654-70903676 CCTGTGTCCGCAGTGTCCCAGGC No data
Right 1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG No data
1069771548_1069771564 20 Left 1069771548 10:70903646-70903668 CCTTGCAGCCTGTGTCCGCAGTG No data
Right 1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG No data
1069771543_1069771564 27 Left 1069771543 10:70903639-70903661 CCCCACCCCTTGCAGCCTGTGTC No data
Right 1069771564 10:70903689-70903711 GGGGGTTTCAAGGAGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069771564 Original CRISPR GGGGGTTTCAAGGAGGCAGT GGG Intergenic