ID: 1069772964

View in Genome Browser
Species Human (GRCh38)
Location 10:70911070-70911092
Sequence CTCCTGAAGGGAGGCCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069772964_1069772974 27 Left 1069772964 10:70911070-70911092 CCTCTCAGGCCTCCCTTCAGGAG No data
Right 1069772974 10:70911120-70911142 ATCCCAGCTGCCGCACCTGCAGG No data
1069772964_1069772969 -8 Left 1069772964 10:70911070-70911092 CCTCTCAGGCCTCCCTTCAGGAG No data
Right 1069772969 10:70911085-70911107 TTCAGGAGAAGCTACCCCAAGGG No data
1069772964_1069772968 -9 Left 1069772964 10:70911070-70911092 CCTCTCAGGCCTCCCTTCAGGAG No data
Right 1069772968 10:70911084-70911106 CTTCAGGAGAAGCTACCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069772964 Original CRISPR CTCCTGAAGGGAGGCCTGAG AGG (reversed) Intergenic
No off target data available for this crispr