ID: 1069772969

View in Genome Browser
Species Human (GRCh38)
Location 10:70911085-70911107
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069772959_1069772969 25 Left 1069772959 10:70911037-70911059 CCAAGAGGTCAGAGTGGCTGCCG No data
Right 1069772969 10:70911085-70911107 TTCAGGAGAAGCTACCCCAAGGG No data
1069772958_1069772969 26 Left 1069772958 10:70911036-70911058 CCCAAGAGGTCAGAGTGGCTGCC No data
Right 1069772969 10:70911085-70911107 TTCAGGAGAAGCTACCCCAAGGG No data
1069772957_1069772969 27 Left 1069772957 10:70911035-70911057 CCCCAAGAGGTCAGAGTGGCTGC No data
Right 1069772969 10:70911085-70911107 TTCAGGAGAAGCTACCCCAAGGG No data
1069772964_1069772969 -8 Left 1069772964 10:70911070-70911092 CCTCTCAGGCCTCCCTTCAGGAG No data
Right 1069772969 10:70911085-70911107 TTCAGGAGAAGCTACCCCAAGGG No data
1069772962_1069772969 5 Left 1069772962 10:70911057-70911079 CCGCAGAAGGACACCTCTCAGGC No data
Right 1069772969 10:70911085-70911107 TTCAGGAGAAGCTACCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069772969 Original CRISPR TTCAGGAGAAGCTACCCCAA GGG Intergenic
No off target data available for this crispr