ID: 1069772974

View in Genome Browser
Species Human (GRCh38)
Location 10:70911120-70911142
Sequence ATCCCAGCTGCCGCACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069772971_1069772974 -3 Left 1069772971 10:70911100-70911122 CCCAAGGGACGTGACTGACCATC No data
Right 1069772974 10:70911120-70911142 ATCCCAGCTGCCGCACCTGCAGG No data
1069772964_1069772974 27 Left 1069772964 10:70911070-70911092 CCTCTCAGGCCTCCCTTCAGGAG No data
Right 1069772974 10:70911120-70911142 ATCCCAGCTGCCGCACCTGCAGG No data
1069772972_1069772974 -4 Left 1069772972 10:70911101-70911123 CCAAGGGACGTGACTGACCATCC No data
Right 1069772974 10:70911120-70911142 ATCCCAGCTGCCGCACCTGCAGG No data
1069772966_1069772974 15 Left 1069772966 10:70911082-70911104 CCCTTCAGGAGAAGCTACCCCAA No data
Right 1069772974 10:70911120-70911142 ATCCCAGCTGCCGCACCTGCAGG No data
1069772965_1069772974 18 Left 1069772965 10:70911079-70911101 CCTCCCTTCAGGAGAAGCTACCC No data
Right 1069772974 10:70911120-70911142 ATCCCAGCTGCCGCACCTGCAGG No data
1069772970_1069772974 -2 Left 1069772970 10:70911099-70911121 CCCCAAGGGACGTGACTGACCAT No data
Right 1069772974 10:70911120-70911142 ATCCCAGCTGCCGCACCTGCAGG No data
1069772967_1069772974 14 Left 1069772967 10:70911083-70911105 CCTTCAGGAGAAGCTACCCCAAG No data
Right 1069772974 10:70911120-70911142 ATCCCAGCTGCCGCACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069772974 Original CRISPR ATCCCAGCTGCCGCACCTGC AGG Intergenic
No off target data available for this crispr