ID: 1069776143

View in Genome Browser
Species Human (GRCh38)
Location 10:70928451-70928473
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069776143_1069776153 -1 Left 1069776143 10:70928451-70928473 CCCCTGATTGTGGCTGCTGTGTT No data
Right 1069776153 10:70928473-70928495 TTGGGGAGGGGAGCAGGAGATGG No data
1069776143_1069776155 6 Left 1069776143 10:70928451-70928473 CCCCTGATTGTGGCTGCTGTGTT No data
Right 1069776155 10:70928480-70928502 GGGGAGCAGGAGATGGAGCTGGG No data
1069776143_1069776157 30 Left 1069776143 10:70928451-70928473 CCCCTGATTGTGGCTGCTGTGTT No data
Right 1069776157 10:70928504-70928526 AAAGCCTCCTATGAAGTCCCAGG No data
1069776143_1069776152 -7 Left 1069776143 10:70928451-70928473 CCCCTGATTGTGGCTGCTGTGTT No data
Right 1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG No data
1069776143_1069776156 7 Left 1069776143 10:70928451-70928473 CCCCTGATTGTGGCTGCTGTGTT No data
Right 1069776156 10:70928481-70928503 GGGAGCAGGAGATGGAGCTGGGG No data
1069776143_1069776154 5 Left 1069776143 10:70928451-70928473 CCCCTGATTGTGGCTGCTGTGTT No data
Right 1069776154 10:70928479-70928501 AGGGGAGCAGGAGATGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069776143 Original CRISPR AACACAGCAGCCACAATCAG GGG (reversed) Intergenic
No off target data available for this crispr