ID: 1069776145

View in Genome Browser
Species Human (GRCh38)
Location 10:70928453-70928475
Sequence CAAACACAGCAGCCACAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069776145_1069776155 4 Left 1069776145 10:70928453-70928475 CCTGATTGTGGCTGCTGTGTTTG No data
Right 1069776155 10:70928480-70928502 GGGGAGCAGGAGATGGAGCTGGG No data
1069776145_1069776152 -9 Left 1069776145 10:70928453-70928475 CCTGATTGTGGCTGCTGTGTTTG No data
Right 1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG No data
1069776145_1069776159 30 Left 1069776145 10:70928453-70928475 CCTGATTGTGGCTGCTGTGTTTG No data
Right 1069776159 10:70928506-70928528 AGCCTCCTATGAAGTCCCAGGGG No data
1069776145_1069776157 28 Left 1069776145 10:70928453-70928475 CCTGATTGTGGCTGCTGTGTTTG No data
Right 1069776157 10:70928504-70928526 AAAGCCTCCTATGAAGTCCCAGG No data
1069776145_1069776156 5 Left 1069776145 10:70928453-70928475 CCTGATTGTGGCTGCTGTGTTTG No data
Right 1069776156 10:70928481-70928503 GGGAGCAGGAGATGGAGCTGGGG No data
1069776145_1069776158 29 Left 1069776145 10:70928453-70928475 CCTGATTGTGGCTGCTGTGTTTG No data
Right 1069776158 10:70928505-70928527 AAGCCTCCTATGAAGTCCCAGGG No data
1069776145_1069776153 -3 Left 1069776145 10:70928453-70928475 CCTGATTGTGGCTGCTGTGTTTG No data
Right 1069776153 10:70928473-70928495 TTGGGGAGGGGAGCAGGAGATGG No data
1069776145_1069776154 3 Left 1069776145 10:70928453-70928475 CCTGATTGTGGCTGCTGTGTTTG No data
Right 1069776154 10:70928479-70928501 AGGGGAGCAGGAGATGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069776145 Original CRISPR CAAACACAGCAGCCACAATC AGG (reversed) Intergenic
No off target data available for this crispr