ID: 1069776152

View in Genome Browser
Species Human (GRCh38)
Location 10:70928467-70928489
Sequence CTGTGTTTGGGGAGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069776145_1069776152 -9 Left 1069776145 10:70928453-70928475 CCTGATTGTGGCTGCTGTGTTTG No data
Right 1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG No data
1069776144_1069776152 -8 Left 1069776144 10:70928452-70928474 CCCTGATTGTGGCTGCTGTGTTT No data
Right 1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG No data
1069776143_1069776152 -7 Left 1069776143 10:70928451-70928473 CCCCTGATTGTGGCTGCTGTGTT No data
Right 1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069776152 Original CRISPR CTGTGTTTGGGGAGGGGAGC AGG Intergenic
No off target data available for this crispr