ID: 1069776158

View in Genome Browser
Species Human (GRCh38)
Location 10:70928505-70928527
Sequence AAGCCTCCTATGAAGTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069776144_1069776158 30 Left 1069776144 10:70928452-70928474 CCCTGATTGTGGCTGCTGTGTTT No data
Right 1069776158 10:70928505-70928527 AAGCCTCCTATGAAGTCCCAGGG No data
1069776145_1069776158 29 Left 1069776145 10:70928453-70928475 CCTGATTGTGGCTGCTGTGTTTG No data
Right 1069776158 10:70928505-70928527 AAGCCTCCTATGAAGTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069776158 Original CRISPR AAGCCTCCTATGAAGTCCCA GGG Intergenic
No off target data available for this crispr