ID: 1069776159

View in Genome Browser
Species Human (GRCh38)
Location 10:70928506-70928528
Sequence AGCCTCCTATGAAGTCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069776145_1069776159 30 Left 1069776145 10:70928453-70928475 CCTGATTGTGGCTGCTGTGTTTG No data
Right 1069776159 10:70928506-70928528 AGCCTCCTATGAAGTCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069776159 Original CRISPR AGCCTCCTATGAAGTCCCAG GGG Intergenic
No off target data available for this crispr