ID: 1069776588

View in Genome Browser
Species Human (GRCh38)
Location 10:70930806-70930828
Sequence ACCTCGCAAAAGCTACATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069776588_1069776591 6 Left 1069776588 10:70930806-70930828 CCTTCATGTAGCTTTTGCGAGGT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1069776591 10:70930835-70930857 GATGGTGTGTGGAAAGCCCCAGG 0: 1
1: 0
2: 3
3: 22
4: 206
1069776588_1069776590 -5 Left 1069776588 10:70930806-70930828 CCTTCATGTAGCTTTTGCGAGGT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1069776590 10:70930824-70930846 GAGGTTCGTGAGATGGTGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 135
1069776588_1069776596 28 Left 1069776588 10:70930806-70930828 CCTTCATGTAGCTTTTGCGAGGT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1069776596 10:70930857-70930879 GCTCAATGCTGGCACAGAGCAGG 0: 1
1: 0
2: 4
3: 32
4: 267
1069776588_1069776592 17 Left 1069776588 10:70930806-70930828 CCTTCATGTAGCTTTTGCGAGGT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1069776592 10:70930846-70930868 GAAAGCCCCAGGCTCAATGCTGG 0: 1
1: 0
2: 3
3: 20
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069776588 Original CRISPR ACCTCGCAAAAGCTACATGA AGG (reversed) Intergenic
905134078 1:35784786-35784808 ACCTTGCAAAAGCTAGATGCAGG - Intergenic
908880529 1:68726741-68726763 ACCTACCATAAGCTACTTGAGGG + Intergenic
911524513 1:98967686-98967708 ACCTCACAACAGCCCCATGATGG - Intronic
912160966 1:106984557-106984579 AGCTCTAAAAAGCTACATGGAGG + Intergenic
917541619 1:175920084-175920106 ACCTGCCTAAAGCTCCATGAAGG + Intergenic
918769049 1:188529371-188529393 ACATCGCAAAAGTTACCTGGTGG - Intergenic
921716342 1:218420899-218420921 ACCTGGCAAGAGCTTCACGAGGG - Intronic
1066043187 10:31572982-31573004 ACCTCACCAAAGATACACGATGG + Intergenic
1069776588 10:70930806-70930828 ACCTCGCAAAAGCTACATGAAGG - Intergenic
1070301068 10:75203911-75203933 TCCTGCCAAAAGCCACATGAGGG + Intergenic
1077800382 11:5530436-5530458 TCCTCCCATAAGCTACATAAAGG + Intronic
1080582148 11:33652450-33652472 ACCTGGCAAAATCTTCAAGAAGG + Intronic
1085306152 11:75487148-75487170 ACCCCGGAAAAGCTACCTGCAGG - Intronic
1091747977 12:3004636-3004658 TCCTCACAACAGCTAAATGAGGG - Intronic
1093707868 12:22295430-22295452 ACATGGCAAAACCTACATGCAGG + Intronic
1093840126 12:23888121-23888143 AACACACAAAAACTACATGAGGG + Intronic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1103206788 12:119136002-119136024 ACAGAGCATAAGCTACATGAGGG - Intronic
1111978775 13:94995463-94995485 TCCTCACAACAGCTATATGAAGG - Intergenic
1116553885 14:46278370-46278392 ACCTCCCAAAAGCTTCCTGAAGG - Intergenic
1130285421 15:82550569-82550591 ACCTGGCAGAAGTTACAAGAGGG + Intronic
1138839244 16:60478504-60478526 ACCTCACAAAGGTTTCATGAGGG - Intergenic
1144496838 17:15752210-15752232 ACTTCTCAAAAGCCACATGTGGG - Intergenic
1144606402 17:16669596-16669618 ACTTCTCAAAAGCCACATGTGGG - Intergenic
1144904801 17:18632688-18632710 ACTTCTCAAAAGCCACATGTGGG + Intergenic
1147694180 17:42338910-42338932 ACCTCAAAAAAGATACATGCAGG + Intronic
1153678605 18:7478625-7478647 AGCTCCCAAAGGCTTCATGAGGG - Intergenic
1156625761 18:38906063-38906085 ACCTCCCAATAGCAAAATGAAGG + Intergenic
927638095 2:24830588-24830610 GCCACTCCAAAGCTACATGACGG + Intronic
929595751 2:43174607-43174629 TTCTGGCAAAAGCTACAGGAGGG - Intergenic
942691828 2:178593391-178593413 ACCTGGAATAAGCCACATGATGG - Exonic
945044434 2:205769768-205769790 TCCTAGAAAAAGATACATGACGG - Intronic
946638490 2:221756857-221756879 GCCTCGCAAAAACTACCTAAAGG + Intergenic
1169459185 20:5779779-5779801 GCCAAGCACAAGCTACATGAAGG - Intronic
1176701278 21:10053832-10053854 ACCTCACATGAGCTAGATGATGG - Intergenic
1176959290 21:15141302-15141324 TCCTAGCAAAAGCCACAGGAAGG + Intergenic
1182106697 22:27694887-27694909 ACTTCTCTGAAGCTACATGATGG - Intergenic
1185145944 22:49136724-49136746 ACCTCACAGAAGCCACAGGAGGG + Intergenic
952119503 3:30225396-30225418 ATCTCACAAAGGCTACAAGAAGG - Intergenic
957668110 3:83262751-83262773 ACCTCCAAAGAGCTACAGGAAGG + Intergenic
963795084 3:149623879-149623901 ACATTGCCAAAACTACATGAAGG - Intronic
969416225 4:7061366-7061388 AACTCTCAAAAGCTACTTGTGGG + Intronic
969871894 4:10109822-10109844 ACCTCTCAAAAGAGAGATGAGGG + Intronic
970439148 4:16065104-16065126 ACCCTGCCAAAGCAACATGAAGG - Intronic
970612121 4:17735492-17735514 ACATAGAAAAAGCTACATGTAGG - Intronic
974887415 4:67836945-67836967 ATCTAGCAAAAGTTTCATGAAGG - Intronic
976800731 4:88988919-88988941 ACATTTCAAAAGCTACATGAGGG + Intronic
980373426 4:131910091-131910113 ACCTCACATGAGCTAGATGATGG - Intergenic
985839143 5:2292606-2292628 ACCTGGCAAAGACTTCATGACGG + Intergenic
987762846 5:22188084-22188106 ACCTCCCAACACCTACATGCTGG - Intronic
991619633 5:68532162-68532184 TCCTCACAATAGCTCCATGAGGG - Intergenic
991897632 5:71421482-71421504 ACCTCCCAACACCTACATGCTGG - Intergenic
1001671910 5:173480759-173480781 ACCTCACAATGGCTACCTGACGG - Intergenic
1001920779 5:175597698-175597720 ACATGGCAAATACTACATGATGG + Intergenic
1004227192 6:13796819-13796841 ACCTGGGAAAAACTACATCAAGG - Intronic
1004301595 6:14463365-14463387 TCCTTGCAACAGCTGCATGATGG + Intergenic
1004737594 6:18423032-18423054 ACCTTAGAAAAGCTTCATGAGGG - Intronic
1009919614 6:70041138-70041160 TCCTAGCAAGAGATACATGAAGG - Intronic
1018190596 6:161306327-161306349 ACCTCCCAGAAGATGCATGAAGG + Intergenic
1021360126 7:19702352-19702374 ACAACGGGAAAGCTACATGAAGG + Intronic
1029186355 7:98741618-98741640 ACCACGCCAATGCTACAGGAGGG + Intergenic
1031120388 7:117715270-117715292 ACATGTGAAAAGCTACATGAAGG + Intronic
1034835747 7:154350421-154350443 ACCACACACAAGCTCCATGAAGG - Intronic
1036010845 8:4721061-4721083 ACCTCTCAAGAGTAACATGAGGG + Intronic
1040063115 8:43121596-43121618 ACCCCGAAAAGCCTACATGAGGG - Intronic
1053365846 9:37521957-37521979 ACCTCGGACAAGCCACCTGATGG + Intronic
1053621464 9:39823750-39823772 ACCTCACTAAAGATACACGAAGG + Intergenic
1053638421 9:40040378-40040400 ACCTCACATGAGCTAGATGATGG - Intergenic
1053767659 9:41424818-41424840 ACCTCACATGAGCTAGATGATGG + Intergenic
1054262699 9:62883687-62883709 ACCTCACTAAAGATACACGAAGG - Intergenic
1054319218 9:63636917-63636939 ACCTCACATGAGCTAGATGATGG - Intergenic
1054546330 9:66336334-66336356 ACCTCACATGAGCTAGATGATGG + Intergenic
1054898853 9:70345869-70345891 ACCACGTAAGAGATACATGATGG + Intronic
1202786295 9_KI270719v1_random:23910-23932 ACCTCACATGAGCTAGATGATGG - Intergenic
1195006851 X:100693536-100693558 ACCATCCAAGAGCTACATGATGG - Intronic
1196145696 X:112314502-112314524 TCCTGGTGAAAGCTACATGAAGG + Intergenic
1197388944 X:125837122-125837144 GCCTCACAAAAGCTCCATGAGGG + Intergenic
1198708897 X:139479834-139479856 ACATCTCAAATGCAACATGAAGG + Intergenic
1199056397 X:143300570-143300592 ACATCACGACAGCTACATGAAGG + Intergenic