ID: 1069776608

View in Genome Browser
Species Human (GRCh38)
Location 10:70930958-70930980
Sequence CAGGACCGGGAACTGTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069776608_1069776611 -5 Left 1069776608 10:70930958-70930980 CCAAAAAACAGTTCCCGGTCCTG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1069776611 10:70930976-70930998 TCCTGCTTTTCCAGCCCCAGAGG 0: 1
1: 0
2: 2
3: 36
4: 303
1069776608_1069776619 18 Left 1069776608 10:70930958-70930980 CCAAAAAACAGTTCCCGGTCCTG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1069776619 10:70930999-70931021 GAAGAGAGACCCAAGGCACCAGG 0: 1
1: 1
2: 0
3: 29
4: 245
1069776608_1069776613 -4 Left 1069776608 10:70930958-70930980 CCAAAAAACAGTTCCCGGTCCTG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1069776613 10:70930977-70930999 CCTGCTTTTCCAGCCCCAGAGGG 0: 1
1: 0
2: 0
3: 33
4: 411
1069776608_1069776618 11 Left 1069776608 10:70930958-70930980 CCAAAAAACAGTTCCCGGTCCTG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1069776618 10:70930992-70931014 CCAGAGGGAAGAGAGACCCAAGG 0: 1
1: 0
2: 6
3: 54
4: 493
1069776608_1069776622 30 Left 1069776608 10:70930958-70930980 CCAAAAAACAGTTCCCGGTCCTG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1069776622 10:70931011-70931033 AAGGCACCAGGTGCTAAACCAGG 0: 1
1: 0
2: 5
3: 38
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069776608 Original CRISPR CAGGACCGGGAACTGTTTTT TGG (reversed) Intergenic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
905789531 1:40782982-40783004 CAGGTCAGGGAACTGGGTTTGGG - Intergenic
907509503 1:54947685-54947707 CAGGCCCTGGATCTGTTCTTCGG - Intergenic
909250792 1:73353534-73353556 TAGAACTGGGAACTGTGTTTGGG - Intergenic
913231435 1:116743634-116743656 CAGAAACAGGAACTGTTTTAGGG + Intergenic
913504971 1:119508669-119508691 GAGGACAGGGAATTGTTTTGGGG - Intronic
918613770 1:186521327-186521349 CAGTACAGGGAAATGTTTGTGGG + Intergenic
919819549 1:201464507-201464529 CAGGACAGGGAAGTTTTTATTGG + Intergenic
920377065 1:205514509-205514531 CAGGCCAGGGACCTGTTTCTAGG - Intronic
1069776608 10:70930958-70930980 CAGGACCGGGAACTGTTTTTTGG - Intergenic
1080016194 11:27509225-27509247 TAGGAACGGGAACTATTCTTAGG + Intergenic
1099287037 12:80726080-80726102 TATGACCTGGAAGTGTTTTTGGG + Intergenic
1099432832 12:82608470-82608492 CAAGACAGAGAACTGTTTTGGGG + Intergenic
1108066933 13:46587376-46587398 GAGGCCTGGGAACTGATTTTTGG + Intronic
1108517045 13:51213251-51213273 AAGCACCGGGAATTGTTTTTTGG - Intergenic
1115148836 14:30259696-30259718 CAGGTCAGGAAACTGTTTCTTGG - Intergenic
1119197369 14:72727046-72727068 CAGGACAGGGAAGTGGCTTTTGG - Intronic
1121199407 14:92105257-92105279 CAGGGCCAGGTAATGTTTTTGGG - Intronic
1122008552 14:98726826-98726848 CAGGTCTGGGAACTAGTTTTTGG + Intergenic
1123168266 14:106347238-106347260 AAGGACCAGGAACTTTATTTGGG - Intergenic
1123194562 14:106604170-106604192 AAGGACCAGGAACTTTATTTGGG - Intergenic
1128579025 15:68795936-68795958 GAGGAGCAGGAACTGTTTTGGGG + Intronic
1148885575 17:50769889-50769911 CAGGACTGGGTAATATTTTTTGG + Intergenic
1151846686 17:76660814-76660836 CAGGACCAGGAAATGTATATGGG + Intergenic
1158400540 18:57117476-57117498 CAGGACTTGTAACTGTTCTTGGG + Intergenic
1158974843 18:62702392-62702414 CAGGACCCTGAACTGCTTTGGGG + Intergenic
1161631013 19:5355484-5355506 CAGGACTGGAAACTGTCTCTGGG + Intergenic
1165621795 19:37254282-37254304 CATCACTGGGAACTGTTATTTGG - Intergenic
1165633380 19:37320415-37320437 CATCACTGGGAACTGTTATTTGG - Intronic
931713642 2:65011024-65011046 CATCACCGGGATCTGTTTATGGG + Intronic
933015368 2:77117794-77117816 CAGGACCCATAAATGTTTTTAGG - Intronic
939366123 2:141233376-141233398 CAGGAGAGAGAAATGTTTTTAGG - Intronic
1174810597 20:53642127-53642149 CAGGAAATGGAAATGTTTTTGGG + Intergenic
1180654537 22:17408583-17408605 CAGGACCTGGAATGGTGTTTCGG - Intronic
1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG + Intergenic
1183733359 22:39630381-39630403 GAGGACAGGGAACTCTGTTTTGG + Intronic
1184159311 22:42688479-42688501 CAGGAGCTGGAACAGTTGTTGGG + Intergenic
1184334452 22:43845066-43845088 GGGGACCTGGAGCTGTTTTTGGG - Intronic
956765276 3:72479561-72479583 CAGGGCTGGGAACTGTGTTGTGG - Intergenic
957269201 3:78007290-78007312 CAGCAGGGGGAACTGTTTTGAGG - Intergenic
959036186 3:101367247-101367269 CAGGACCTTGTAATGTTTTTGGG - Intronic
962014298 3:131424580-131424602 CAGGACCTGGAAGTGTTCTCAGG - Intergenic
962492244 3:135905680-135905702 AAGGACCAGGAACATTTTTTAGG - Intergenic
969861655 4:10040592-10040614 CAGGACCTGGAACTGAAGTTCGG + Intronic
970389437 4:15592863-15592885 CAGGAAGGGGAGCTGGTTTTGGG - Intronic
974413817 4:61578150-61578172 CAGGAAAGGGAACTTCTTTTAGG - Intronic
977424012 4:96842525-96842547 CAGGACCACGAACTGATTTGAGG + Intergenic
987448196 5:18048053-18048075 CAGATCAGGGAACTGTTTTGAGG - Intergenic
990984738 5:61630963-61630985 CAGGAACGGGACCTGTTTTATGG + Intergenic
995615984 5:113964822-113964844 AATGAGCGGAAACTGTTTTTTGG - Intergenic
995700727 5:114932135-114932157 CAGTCCCAGGAACTGTGTTTTGG + Intergenic
998421090 5:141987221-141987243 CATGGCCGGGAACTGTTTTCAGG + Intronic
1002799140 6:504413-504435 CAGGACCAGAATCTGATTTTTGG + Intronic
1005474100 6:26190461-26190483 AAGGACCTGGAACTTTTTATGGG - Intergenic
1007095609 6:39210949-39210971 GAGGGGCGGGCACTGTTTTTAGG - Intronic
1011443901 6:87417179-87417201 CTGCACCAGGAACTGTTTTCAGG - Intronic
1022595791 7:31712515-31712537 ATGGACAGGGAACTGTTTTTAGG - Intergenic
1036118693 8:5990048-5990070 CAGGACAGGGAATTGTTACTTGG - Intergenic
1040979306 8:53229338-53229360 CAGGATCCTGAACTGTATTTCGG + Exonic
1056763070 9:89428324-89428346 CAGGGCCAGGGACTGTGTTTGGG - Intronic
1056808687 9:89747608-89747630 AAGGACTGGGAACTTTTTGTCGG - Intergenic
1062496014 9:136832027-136832049 CAGGGCCGGGAACTGTGTGCTGG + Intronic
1062588904 9:137264160-137264182 CAGGGCCTGGAGCTGTGTTTGGG + Intronic
1203710024 Un_KI270742v1:89539-89561 CAGGACTGGGCACCGTTTTCAGG + Intergenic
1185971229 X:4666911-4666933 CAGGTCCTGGAAGTGTTTTCTGG + Intergenic
1192185113 X:68941498-68941520 CAGGACTGGGAACTGAGTCTGGG - Intergenic
1196093211 X:111769660-111769682 AGGGACCTGGAACTGTTCTTGGG - Intergenic
1198840522 X:140852363-140852385 CAGGCACCGGAAGTGTTTTTGGG + Intergenic