ID: 1069777206

View in Genome Browser
Species Human (GRCh38)
Location 10:70934120-70934142
Sequence ATAGACTGCCTGGTGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069777195_1069777206 22 Left 1069777195 10:70934075-70934097 CCTGCTGTAAGAACTTTCTAGCC No data
Right 1069777206 10:70934120-70934142 ATAGACTGCCTGGTGTGGTGGGG No data
1069777199_1069777206 0 Left 1069777199 10:70934097-70934119 CCTTAGAGATGGTCCCTAATGGA No data
Right 1069777206 10:70934120-70934142 ATAGACTGCCTGGTGTGGTGGGG No data
1069777197_1069777206 1 Left 1069777197 10:70934096-70934118 CCCTTAGAGATGGTCCCTAATGG No data
Right 1069777206 10:70934120-70934142 ATAGACTGCCTGGTGTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069777206 Original CRISPR ATAGACTGCCTGGTGTGGTG GGG Intergenic